CN117511939A - Application of cyclic RNA circRERE in promoting nerve regeneration and repairing central nerve injury - Google Patents

Abstract

The invention discloses application of circular RNA circRERE in promoting nerve regeneration and repairing central nerve injury. The invention performs full transcriptome sequencing, selects the data of the annular RNA, and discovers that the annular RNA circRERE is obviously increased in the process of neuron development through screening of the expression quantity. Then, the invention designs siRNA interfering with the expression of the circRERE according to the cyclization site sequence of the circular RNA circRERE, and verifies the function of the circRERE. The invention provides a new therapeutic drug prospect for nerve regeneration and central nerve injury repair.

Description

Application of cyclic RNA circRERE in promoting nerve regeneration and repairing central nerve injury

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of circular RNA circRERE in promoting nerve regeneration and repairing central nerve injury.

Background

Neurites grow extensively in the developing nervous system and are relatively quiescent in adult individuals. When the nervous system is damaged, the neurites resume growth to connect the damaged nerve loops. It is well known that neurites consist of axons and dendrites, and that neurite growth is an intrinsic ability, whose growth is regulated by various extrinsic signals; the mechanism of regeneration thereof has been widely studied, and the molecules involved include transcription factors, protein kinases, protein phosphatases, cell scaffold components, and the like. However, the successful recovery of the nervous system from nerve damage, especially the central nerve, remains limited. Therefore, it is necessary to dig more molecules that favor axonal regeneration after nerve injury.

Circular RNA (circRNA) is an endogenous non-coding RNA. More and more researches show that the circular RNAs have the characteristics of rich variety, stable structure, conserved sequence, cell or tissue specific expression and the like, and are found to have important biological functions, such as being used as a miRNA cavernous body to adsorb and regulate the activity of miRNA, combined with a transcription regulatory element or interacted with a protein to regulate the transcription of genes and the like. Studies have shown that circular RNAs are associated with neurological diseases, diabetes, cardiovascular diseases, and cancer, and thus have significant research value. In addition, the broad expression of circular RNAs and disease-controlling mechanisms make them functional biomarkers and therapeutic targets for a variety of diseases.

The circRERE is one of the circular RNA molecules, and research reports mainly focus on cancer, but have not been reported on nerve injury.

Disclosure of Invention

The invention aims to provide the application of the circular RNA circRERE in promoting nerve regeneration and repairing central nerve injury.

The nucleotide sequence of the circular RNA circRERE is as follows, and is connected end to form a circular structure.

AGTAAGAGGGACCATCTACTCATGAACGTCAAATGGTACTACCGTCAGTCTGAAGTTCCAGATTCTGTCTATCAGCATTTGGTTCAGGACCGGCATAATGAAAACGACTCTGGAAGAGAACTTGTCATCACAGATCCAGTCATCAAGAACCGGGAGCTCTTCATTTCTGATTATGTTGACACCTACCATGCTGCTGCCCTGAGAGGGAAGTGCAACATCTCCCATTTTTCCGACATATTTGCTGCTCGTGAATTTAAAGCCCGAGTGGACTCGTTTTTCTACATATTAGGCTACAACCCTGAGACAAGGAGGCTGAATAGTACCCAAGGAGAAATTCGAGTTGGCCCTAGCCATCAGGCCAAACTTCCAGATTTGCAGCCATTTCCTTCTCCAGATGGTGACACTGTGACTCAGCATGAGGAACTTGTCTGGATGCCTGGAGTCAGTGACTGTGACCTCCTCATGTACTTGAGGGCAGCAAGGAGCATGGCAGCCTTCGCAGGAATGTGTGACGGAGGTTCCACAGAGGATGG

CTGTGTCGCAGCGTCTCGGGATGACACCACTCTCAATGCACTGAACACACTACATGAAA

GCAGTTATGATGCCGGCAAAGCCCTGCAGCGCCTGGTGAAGAAGCCTGTGCCCAAGCTGATCGAGAAGTGCTGGACAGAGGATGAAGTG(seq_1)。

The invention performs full transcriptome sequencing, selects the data of the annular RNA, and discovers that the annular RNA circRERE is obviously increased in the process of neuron development through screening of the expression quantity. Then, the invention designs siRNA interfering with the expression of the circRERE according to the cyclization site sequence of the circular RNA circRERE, and verifies the function of the circRERE.

The invention provides a new therapeutic drug prospect for nerve regeneration and central nerve injury repair.

Drawings

FIG. 1 shows the expression of circRERE during the development of the cerebral cortex.

FIG. 2 shows the knock-down efficiency results of the circRERE siRNA in neurons, A is a circRERE looping diagram, and B is the interference efficiency results of the circRERE siRNA.

FIG. 3 is a graph showing the results of the treatment with the circRERE siRNA on the axons of neurons, A is a graph showing representative staining of neurons after the treatment with the circRERE siRNA and Ctrl siRNA, and B is a statistical graph showing the length of the axons of neurons.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention may be made by those skilled in the art without departing from the spirit and scope of this invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

EXAMPLE 1 expression of circRERE during development of the cerebral cortex

As is well known, neurons in embryonic stage were more plastic than postnatal neurons, and earlier studies by the inventors showed that the axonal length of cortical neurons on day E18 was significantly longer in SD rats than in postnatal 3-day (P3) neurons (FIG. 1A, PMID: 33321289). For this purpose, full transcriptome sequencing was performed, and the data of the circular RNA was selected, and the circular RNA circRERE was found to be significantly increased in the development process by screening the expression level (FIG. 1B).

Example 2 functional verification of circre

1. Primary culture of cortical neurons

1. Advanced treatment instrument: sterilizing the instrument in lunch box or soaking in 75% ethanol for 30min, taking into cell room, and irradiating with ultraviolet lamp for 30min before use;

2. SD pregnant mice (E18) are anesthetized by diethyl ether, and after being sacrificed, the pregnant mice are put into 75 percent ethanol which is poured in advance, and the rats are fully soaked for 1min and quickly brought into a cell room;

3. placing the rat on an operating table, cutting the abdominal cavity by using surgical scissors, taking out the fetal rat, placing the fetal rat with placenta into a large ice cube dish, and adding Hanks dissecting solution with double antibodies into the large ice cube dish. Taking out the fetal mouse after breaking the amniotic membrane, shearing off the head, placing the head in Hanks dissecting liquid, and cleaning blood for at least two to three times;

4. operating under a stereoscopic microscope, leaving only the topmost area of the cerebral cortex, placing the separated cerebral cortex into a 15mL centrifuge tube, adding 0.25% pancreatin digestive juice, digesting for 12min at 37 ℃, and vibrating once every 3min to separate and fully digest the cortical adhesion part;

5. after completion of the digestion, the cells were centrifuged at 500rpm for 1 minute, pancreatin was discarded, the digestion was completed with DMEM/F12 complete medium, and neurons were isolated by blowing 5 to 10.

6. The supernatant was aspirated, screened (400 mesh), 1000rpm,5min, the supernatant was discarded, 5mL of F12 complete medium was added to re-blow the cell pellet, and the amount was counted after mixing.

7. Cell density of 5 x 10 ⁶ The culture medium is used for culturing the cells after the cells are planted in a large dish for 4 to 6 hours, and the cells are changed into liquid and are continuously cultured by using a neuron culture medium.

2. Primary P1/P3 cortical neuron sampling and E18/P1/P3 cortical neuron purification

1. After 1 day and 3 days (P1/P3) after birth, carrying into a cell room after the SD rat red skin is sterilized by alcohol, cutting off the head by using surgical scissors, wrapping cotton sprayed by alcohol, separating the brain by using microscopic scissors, placing the brain into a dish containing precooled dissecting liquid, and separating the brain cortex under a split microscope;

2. placing the separated cortex into an EP tube, adding 0.25% pancreatin prepared in advance, digesting for 12min at 37 ℃, vibrating once every 3min to separate and fully digest the cortex adhesion part;

3. discarding pancreatin after the digested tissue is completely settled, stopping digestion, adding 2mL of culture medium containing serum, lightly blowing with a gun for more than ten times, collecting upper cell suspension after the tissue is settled, and centrifuging;

4. after centrifugation, the supernatant was removed and resuspended, the suspension was collected, passed through a screen (400 mesh), the supernatant was discarded after centrifugation, and 5mL of F12 complete medium was added to blow up the pellet and mix well.

5. Preparing gradient centrifugate, optiPrep ^TM Density gradient medium: 800 μl, B27:100uL, hibernate ^TM -A Medium：4.1mL；

6. Adding an equal volume of cell suspension (5 mL) into the gradient centrifugation liquid, and 2000rpm at room temperature for 20min;

7. after centrifugation is completed, collecting about 4mL of layered liquid in the centrifuge tube, adding the cell culture medium with the same volume, mixing uniformly, centrifuging at room temperature conventionally, discarding the upper liquid, adding the Neurobasal culture medium again to blow up cells, calculating the number, and carrying out subsequent primary culture according to experimental requirements.

3. siRNA electric transfection of E18 cortical neurons

Counting E18 cortical neurons of raw materials, sucking a certain amount of cells, mixing with siRNA, and mixing thoroughly until the final concentration reaches 3.0X10 per 100 μl of mixed solution ⁶ Neuronal cells +200nM siRNA, where the cell volume is 90. Mu.L and the siRNA volume is 10. Mu.L. Electrotransfection was then performed with reference to NEPA21 (NEPAGENE Inc.) neuronal cells (275V, 0.7 ms) electrotransfection procedure.

The circre siRNA is shown below:

sense strand CAGAGGAUGAAGUGAGUAATT (seq_2)

Antisense strand UUACUCACUUCAUCCUCUGTT (seq_3)

Ctrl siRNA:

Sense strand UUCUCCGAACGUGUCACGUTT (seq_4)

Antisense strand ACGUGACACGUUCGGAGAATT (seq_5).

4. Extraction of neuronal cell RNA

1. Adding 20 mu L of beta-mercaptoethanol into each milliliter of RTL lysis buffer, uniformly mixing, and preparing before use;

2. the culture medium is discarded, 350 mu L of RTL lysis buffer/beta mercaptoethanol is added into each hole, the cells are fully lysed by blowing with a pipettor, and the cells are collected into 1.5mL RNase-free EP tube;

3. adding RNA Binding Buffer with equal volume into the lysate, and vortex mixing for 15s;

4. HiPure RNA Mini Column I was placed in a 2mL collection tube and the whole mixture was transferred to centrifugation, 8000g for 1min;

5. discarding the filtrate, adding 500 μL Buffer RW1 into a centrifugal column, standing for 3min, and centrifuging;

6. discarding the filtrate, adding 500 μl Buffer RW2 into a centrifugal column, standing for 3min, centrifuging at 8000g for 1min;

7. repeating (6) once;

8. discarding the filtrate, centrifuging 10000g of the filtrate for 3min;

9. transfer the column to 1.5mL RNase-free EP tube, add 20. Mu.L RNase-free Water to the center of the column membrane, stand for 1min, centrifuge with 10000g for 1min;

10. detecting OD value and concentration of RNA, and preserving at-80 ℃ for standby.

5. cDNA synthesis by RNA reverse transcription

500ng of RNA was reverse transcribed into cDNA using the reverse transcription kit (Vazyme R312-01). The reaction system was operated on ice, 20. Mu.L each, as follows:

the reaction procedure is: 15min at 37 ℃, 5sec at 85 ℃,4 ℃.

6. Real-time fluorescence quantitative PCR (qRT-PCR)

Designing the qRT-PCR primer sequence of the circRNAs according to the design principle of the circRNAs.

circRERE qRT-PCR primer

circRERE-F：5’-AGTTATGATGCCGGCAAAGC-3’(seq_6)

circRERE-R：5’-TGGAACTTCAGACTGACGGT-3’(seq_7)

The cDNA obtained by the reverse transcription reaction was diluted 1:5 and subjected to the following qRT-PCR reaction.

(1) The qRT-PCR reaction liquid is prepared according to the following components:

(2) The reaction solution was mixed uniformly and the reaction procedure of the Real-time PCR apparatus was as follows:

as shown in fig. 2, the circre siRNA can significantly interfere with the expression of circre in neuronal cells after 48h of siRNA treatment, P <0.05.

7. Neuronal cell immunohistochemistry and axon length measurement

The slide was placed in a 24-well plate, coated with polylysine overnight at 4℃and washed three times with deionized water, and irradiated with ultraviolet light for 30min for use. The neuron cells after electrotransformation were cultured on a slide glass with a moderately uniform density. The cells were washed once with rewarmed PBS 48h, then the neuronal cells were fixed with 4% paraformaldehyde for 30min, and washed 3 times with PBS for 5min each. Blocking with cell blocking solution (rewarming in advance, 300 μl per well) at 37deg.C for 1 hr; primary antibody (Tuj 1, 1:1000) was added overnight at 4 ℃. The next day the dishes were removed from the refrigerator, the primary antibody recovered and washed with PBS for more than 3 times, 5min each. The corresponding secondary antibody was incubated for 2h in the dark, then nuclei were stained with Hoechst for 15min, washed three times with PBS, blocked and photographed. Neuronal axon length was measured using image-pro plus6.0 (America MEDIA CYBERNETICS).

The results are shown in fig. 3, and compared with the control group, the circre siRNA treatment for 48 hours can significantly promote the growth of neuron axons, with P <0.01.

Claims (5)

1. Use of cyclic RNA circre in the preparation of a diagnostic reagent for central nerve damage.

2. Use of cyclic RNA circre for screening therapeutic drugs for promoting nerve regeneration and/or repairing central nerve damage.

3. Use of a cyclic RNA circre inhibitor for the preparation of a medicament for the treatment of promoting nerve regeneration and/or repairing central nerve damage.

4. The use according to claim 4, characterized in that: the cyclic RNA circRERE inhibitor is one or more selected from small molecule compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides or nucleic acids.

5. The use according to claim 5, characterized in that: the nucleic acid is siRNA, and the sequence of the siRNA is:

sense strand CAGAGGAUGAAGUGAGUAATT

Antisense strand UUACUCACUUCAUCCUCUGTT.