CN110982850B - Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity - Google Patents
Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity Download PDFInfo
- Publication number
- CN110982850B CN110982850B CN201811590694.3A CN201811590694A CN110982850B CN 110982850 B CN110982850 B CN 110982850B CN 201811590694 A CN201811590694 A CN 201811590694A CN 110982850 B CN110982850 B CN 110982850B
- Authority
- CN
- China
- Prior art keywords
- pyrg
- xdh
- aspergillus oryzae
- fragment
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity, which comprises the following steps: 1) obtaining aspergillus oryzae strains; 2) deleting orotidine-5' -phosphate decarboxylase gene (pyrG) serving as a screening marker by utilizing a gene homologous recombination technology, constructing a uridine auxotroph homologous transformation system based on pyrG deletion, and providing uridine auxotroph host bacteria for subsequent gene modification; 3) the xylitol CBP engineering bacteria with enhanced hemicellulose saccharification capacity are obtained by tracelessly deleting xdh gene by using a gene deletion technology with a recyclable screening marker.
Description
Technical Field
The invention relates to a method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity.
Background
Xylitol, i.e. xylol, is ubiquitous in nature, such as in melons, fruits, vegetables and grains, but is present in very low amounts. The xylitol production method mainly comprises an extraction method, a chemical synthesis method and a biotransformation method. Among them, the extraction method cannot meet the market demand due to low yield and high production cost. In industrial production, xylitol is mainly produced by a traditional chemical hydrogenation method, although the technology is mature, the process is complex, the energy consumption is high, the safety performance is poor, and the popularization and the production of the xylitol are not facilitated. The biotransformation method is a new and efficient xylitol production mode, and mainly comprises the steps of simply treating lignocellulose contained in forestry and animal husbandry waste to obtain xylose hydrolysate, and then utilizing alcohol obtained in microbial fermentation. The method has the advantages of mild reaction conditions, environmental protection, less equipment investment and the like, and has good application prospect.
The biotransformation of lignocellulose mainly comprises four processes: raw material pretreatment, production and enzymolysis of hydrolase, hexose fermentation and pentose fermentation. The above 4 processes can be carried out step by step, and can also be integrated partially or completely.
However, in the prior art, the degradation of cellulose and hemicellulose requires the addition of exogenous cellulose hydrolase and hemicellulose hydrolase. When the commercialized lignocellulose preparation is used for hydrolyzing lignocellulose, the enzyme requirement is large, the enzymolysis efficiency is poor, the yield of the cellulose preparation is low, the preparation cost is high, and the development of the lignocellulose fermentation industry is limited to a great extent
Integrated bioprocessing (CBP) refers to a bioprocessing process that directly converts lignocellulosic feedstock into biochemicals in one step without the addition of any exogenous hydrolytic enzymes. The ideal CBP engineering bacteria need to have the ability to both hydrolyze lignocellulose to monosaccharides and ferment monosaccharides as the target metabolite.
Aspergillus oryzae is a traditional food safety producing strain, can extracellularly secrete hemicellulose degrading enzyme system, and contains xylose catabolism related enzyme system. The inventor obtains an Aspergillus oryzae mutant strain C3-1 with xylitol dehydrogenase gene (xdh) deletion by using a metabolic engineering means in the early stage, and the Aspergillus oryzae mutant strain C3-1 can directly convert 50g/L of xylan into 8.12g/L of xylitol, so that the Aspergillus oryzae CBP method is realized to produce xylitol. However, the saccharification capacity of the mutant strain C3-1 hemicellulose is still low, so that the enhancement of the saccharification capacity of the aspergillus oryzae hemicellulose is the key for further improving the yield of the xylitol synthesized by the CBP method.
The inventor has obtained an aspergillus oryzae mutant strain a73 with xylanase activity twice as high as that of C3-1 by mutagenesis screening in the past (published in university of china, nature science edition, volume 32, 6 th edition, "breeding of aspergillus oryzae xylanase high producing strain", 2011, 11 months, plum morning, old macroculture).
Disclosure of Invention
The invention mainly aims to provide a method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity, which comprises the following steps:
1) obtaining aspergillus oryzae strains;
2) transforming the aspergillus oryzae strain in the step 1) by using a targeting vector pMD-pyrGAB with an orotidine-5' -phosphate decarboxylase gene (pyrG) gene knockout box, and obtaining a pyrG-deleted uridine-deficient mutant strain through resistance phenotype screening and PCR verification; taking pyrG-deleted uridine-deficient mutant strain as recipient strain, and carrying out complementary transformation by using recombinant vector pMD-pyrG carrying pyrG screening marker to obtain pyrG + Reverting mutant strains, and constructing a uridine auxotroph homologous transformation system based on pyrG deletion;
3) the xdh gene is subjected to traceless deletion by using a gene deletion technology (latex system) capable of recycling a screening marker, so that the xylitol CBP engineering bacteria with the enhanced rice hemicellulose saccharification capacity are obtained.
4) Synthesizing xylitol by using the aspergillus oryzae engineering bacteria obtained in the step 3).
Preferably, the Aspergillus oryzae strain obtained in step 1) is Aspergillus oryzae A73.
Preferably, the targeting vector pMD-pyrGAB with the pyrG gene knockout cassette is used for transforming A.oryzae A73 in the step 2), and a pyrG-deleted uridine-deficient mutant A.oryzae C16 is obtained by 5-fluoroorotic acid (5-FOA) resistance phenotype screening and PCR verification; c16 is used as recipient bacterium, and the recombinant vector pMD-pyrG carrying pyrG screening marker is used for complementary transformation to obtain pyrG + Reverting the mutant strain, and establishing a homologous transformation system with pyrG as a selection marker.
Preferably, the targeting vector pMD-pyrGAB is constructed by: a genome of A.oryzae CICC2012 is taken as a template, upstream and downstream homologous recombination fragments of pyrG (GenBank accession number: GQ496621) of 1.0kb PA and 1.5kb PB are amplified by primers respectively, the upstream and downstream fragments are spliced by overlap extension PCR by the primers, the spliced fragment of 2.5kb is connected with a linear vector pMD19-T of 2.7kb, a pyrG knockout targeting vector pMD19-pyrGAB of 5.2kb is obtained, and enzyme digestion verification is carried out.
Preferably, the primers are PA-F/PA-R and PB-F/PB-R.
Preferably, in the step 3), C16 is used as a host bacterium, a xdh traceless deletion targeting vector pMD-pyrG-xdhABC carrying pyrG is transformed into a receptor cell by using a Latour system, and after two times of homologous integration, a pyrG and xdh double-deletion mutant strain A.oryzae C17 is finally obtained through 5-FOA resistance screening and PCR verification.
Preferably, the construction method of the targeting vector pMD-pyrG-xdhABC comprises the following steps: primers are used for amplifying four fragments of an upstream fragment xdh-A, xdh-B, a downstream fragment xdh-C and pyrG of Aspergillus oryzae xdh; connecting the pyrG fragment with pMD19-T to obtain a recombinant plasmid pYRG; performing double enzyme digestion by using restriction enzyme SphI/HindIII, and connecting the double enzyme digestion with xdh-B fragment to obtain recombinant plasmid pYRG-B; carrying out double enzyme digestion by SacI/SmaI, and connecting with xdh-A fragment to obtain recombinant plasmid pYRG-AB; the plasmid is subjected to single enzyme digestion by BamH I, then is respectively subjected to smoothing and dephosphorylation by T4 DNA Polymerase and alkali Phosphotase, and is subjected to blunt end connection with xdh-C fragment which is subjected to T4 Polynucleotide Kinase treatment and 5' end phosphorylation to obtain the targeting vector.
Preferably, the primers are xdh-A1/xdh-A2, xdh-B1/xdh-B2, xdh-C1/xdh-C2 and pyrG-F/pyrG-R.
The invention takes an aspergillus oryzae mutant strain with deletion of xylitol dehydrogenase gene (xdh) as an original strain, deletes orotidine-5' -phosphate decarboxylase gene (pyrG) serving as a screening marker by utilizing a gene homologous recombination technology, constructs a uridine auxotroph homologous transformation system based on pyrG deletion, and provides uridine auxotroph host bacteria for subsequent gene modification; obtaining xylitol CB with enhanced hemicellulose saccharification capacity by using a gene deletion technology (latex system) capable of being recycled by a screening marker to delete xdh gene without trace P engineering bacteria. The engineering bacteria obtained by the method of the invention take 50g/L xylan as the only carbon source, the concentration of the produced xylitol is 13.5g/L, the concentration is improved by 66 percent compared with that of C3-1(8.12g/L), and the yield are 0.27g/g and 0.16 g.L respectively -1 ·h -1 The improvement is 69 percent and 129 percent respectively compared with that of C3-1.
Drawings
The invention is further illustrated by the following examples in conjunction with the drawings.
FIG. 1 flow chart of the construction of the pyrG knock-out targeting vector pMD19-pyrGAB (A) and xdh traceless knock-out targeting vector pMD19-pryG-xdhABC (B).
FIG. 2 shows the restriction enzyme of pMD19-pyrGAB plasmid.
FIG. 3 shows the principle of A.oryzae pyrG gene knockout.
FIG. 4 shows Aspergillus oryzae C-4(A) grown on 2% GP + uu and 2% GP media with uracil-deficient transformants (B).
FIG. 5 shows PCR validation of uridine deficient transformants Aspergillus oryzae transformants with PA-F/PB-R as primer.
FIG. 6 is a schematic diagram of the mechanism of knock-out of xdh gene by targeting vector pMD-pyrG-xdhABC.
Detailed Description
Materials and methods
1.1 materials
1.1.1 strains and plasmids: oryzae CICC2012 is purchased from China center for culture Collection of Industrial microorganisms; coli DH5 α competent cells and plasmid pMD19-T were purchased from Takara (Dalian) Co., Ltd.
1.1.2 Main reagents and instruments: taq DNA polymerase, pfu DNA polymerase, restriction enzyme, T4 ligase, helicase, dNTP, 5-fluoroorotic acid, agarose gel recovery and purification, PCR purification and plasmid miniprep kit are all purchased from Shanghai bioengineering technology, Inc.; the cellulase NS10006 used for the preparation of Aspergillus oryzae protoplast was provided by Novoxin Co., Ltd; the primer is synthesized by Shanghai.
1.1.3 Medium: LB medium (g/L): adjusting pH to 7.0 with yeast powder 5, peptone 10, NaCl 10 and NaOH, adding 15g/L agar powder into solid culture medium, and sterilizing at 121 deg.C for 20 min. Ampicillin was added if necessary to a final concentration of 100. mu.g/mL.
Aspergillus oryzae growth medium (2% GP, g/L): peptone 10, glucose 20, KH 2 PO 4 5、NaNO 3 1、MgSO 4 ·7H 2 O1, (solid medium plus 15g/L agar); 2% GP Medium (2% GP + UU) supplemented with 1.5g/L uridine and 0.7g/L uracil was used to culture uracil auxotrophic Aspergillus oryzae; 2% GP + UU culture medium of 2 g/L5-FOA is added for screening 5-FOA resistant transformants; 2% GP Medium with a glucose content of 5g/L was used to prepare hyphae; a2% GP double permeation plate (upper layer containing 1.2M sorbitol and 6g/L agar, lower layer containing 1.2M NaCl and 15g/L agar) was used for regeneration of protoplasts.
1.2 methods
1.2.1 Aspergillus oryzae genome extraction, protoplast preparation, and transformation reference methods.
1.2.2 primer design
Primers were designed using Primer Premier 5.0 software according to the DOGAN database, and the designed Primer sequences are shown in Table 1.
TABLE 1 primers used in the present invention
In Table 1, capital letters indicate primer sequences specific to the amplified fragments, lowercase letters indicate primer sequences complementary to adjacent fragments, and enzyme cleavage sites are underlined.
Example 1
1. Construction of the pyrG knockout targeting vector pMD19-pyrGAB
The construction of the pyrG knock-out targeting vector pMD19-pyrGAB is shown in FIG. 1 (A). A genome of A.oryzae CICC2012 is taken as a template, primers PA-F/PA-R and PB-F/PB-R are respectively used for PCR amplification of pyrG (GenBank accession number: GQ496621) upstream and downstream homologous recombination fragments 1.0kb PA and 1.5kb PB, the primers PA-F/PB-R are used for splicing the upstream and downstream fragments through overlap extension PCR, the spliced fragment of 2.5kb is connected with a linear vector pMD19-T of 2.7kb, a pyrG knockout targeting vector pMD19-pyrGAB of 5.2kb is obtained, and enzyme digestion verification is carried out.
2. In the pyrG knockout cassette pMD19-pyrGAB, the ends of the fused fragments PA and PB contain Sac I and BamH I enzyme cutting sites, and about 0.6kb of the fused fragment also contains a BamH I enzyme cutting site, so the fragments obtained after the pyrG knockout cassette pMD-pyrGAB is cut by Sac I and BamH I enzyme cutting have the sizes of 2.7kb, 1.9kb and 0.6kb, as shown in FIG. 3(A), the pyrG knockout cassette pMD19-pyrGAB is proved to be successfully constructed.
3. PyrG knockout in Aspergillus oryzae strain C-4
With PEG-CaCl 2 Transformation of the pyrG knockout cassette into protoplasts of Aspergillus oryzae C4 was mediated, and homologous recombination of the homology arms PA, PB of pMD19-pyrGAB with the corresponding sites in the Aspergillus oryzae genome deleted pyrG as shown in FIG. 3(B), and 5 '-FOA resistance was exhibited in regeneration medium containing 5' -FOA.
The transformants were passaged 2 times in 2% GP medium containing uridine and uracil to obtain a total of 161 aspergillus oryzae 5' -FOA resistant strains, inoculated in 2% GP + uu and 2% GP medium for phenotypic validation, and only 42 strains showed uracil auxotrophy as shown in fig. 4.
Transformants which can only grow on 2% GP + uu are subcultured and purified, the genome is extracted, PCR verification is carried out by using a primer PA-F/PB-R (table 1), and as shown in FIG. 5, only one transformant has a PCR band position of 2.5 kb; the remainder were around 3.7kb, identical in position to the parental A.oryzae band, indicating that A.oryzae strain successfully deleted the pyrG gene, this deletion strain was designated C16.
4. Sequencing verification of pyrG and pyrF genes
Since 5 '-FOA was used as a selection pressure in the experiment and 5' -FOA had a high mutagenic effect on pyrF, a gene encoding orotate phosphoribosyltransferase in the uridine synthetic pathway [3-6], if pyrF is mutated in the genome of C-16 strain, the host bacterium will not be converted into uracil prototrophy after the introduction of exogenous pyrG, resulting in the use of pyrG that cannot be introduced from an exogenous source as a selection marker. To further confirm that the pyrF gene of the C-16 strain was not mutated, gene sequencing using the primers pyrF-F/pyrF-R amplification pyrF demonstrated no change in pyrF in the C-16 strain. The research successfully obtains the aspergillus oryzae uracil auxotroph strain C-16 which can be used for high-efficiency genetic transformation and can be used as a host bacterium for subsequent metabolic engineering modification
Example 2
1. xdh construction of traceless knockout targeting vector pMD19-pyrG-xdhABC
xdh construction scheme of the traceless knockout targeting vector pMD19-pyrG-xdhABC is shown in FIG. 1 (B). The positions of the upstream xdh-A, xdh-B and downstream xdh-C of the Aspergillus oryzae xdh (GenBank accession number: GQ222265) gene are shown in FIG. 6. PCR was performed using primers xdh-A1/xdh-A2, xdh-B1/xdh-B2, xdh-C1/xdh-C2, and pyrG-F/pyrG-R, respectively, to amplify xdh-A, xdh-B, xdh-C and pyrG four fragments. The pyrG fragment was ligated with pMD19-T to give recombinant plasmid pYRG. The plasmid is double digested by restriction enzyme SphI/HindIII, and is connected with xdh-B fragment to obtain recombinant plasmid pYRG-B. The recombinant plasmid pYRG-AB is obtained by double digestion of SacI/SmaI and connection with xdh-A fragment. The plasmid is digested by BamH I, then smoothed and dephosphorylated by T4 DNA Polymerase and Alkaline Phosphotase respectively, and blunt-end connected with xdh-C fragment which is treated by T4 Polynucleotide Kinase and phosphorylated at 5' end, so as to obtain the targeting vector pYRG-ABC.
2. Traceless knockout of Aspergillus oryzae strain xdh
Xylitol Dehydrogenase (XDH) is one of the key enzymes of xylose metabolism in yeast and filamentous fungi, and the ability of xylitol production can be improved by knocking out xylitol dehydrogenase gene XDH in yeast or inhibiting XDH expression. The traceless knockout strategy which is not introduced with a marker gene and can be used for carrying out multi-gene knockout subsequently is designed, and is used for knocking out Aspergillus oryzae xdh, and the technical route is shown in figure 6. Transferring the targeting vector pMD19-pryG-xdhABC into a C16 strain, carrying out first homologous recombination, integrating pyrG gene on chromosome, screening recombinants by a uracil-free culture medium, and subculturing to stabilize the recombinants. The recombinants were placed in 5-FOA medium and a second homologous recombination occurred in the chromosome due to the induction pressure of 5' -FOA, and the portion between the two xdh-C fragments was knocked out, leaving only the xdh-A and xdh-C portions as shown in FIG. 6, thereby obtaining an Aspergillus oryzae xdh deletion strain. The whole process does not need exogenous recombinase mediation, does not introduce other exogenous fragments, and can quickly and effectively achieve the purpose of traceless knockout.
Then, using C16 as a host bacterium, transforming a xdh traceless targeting vector pMD-pyrG-xdhABC carrying pyrG into receptor cells by using a Latour system, carrying out homologous integration twice, and finally obtaining 4 pyrG and xdh double-deletion mutant strains A.oryzae C17, C18, C19 and C20 through 5-FOA resistance screening and PCR verification.
Wherein, the growth phenotype, the enzyme activity and the xylitol production capacity of the xdh deletion engineering bacterium C17 are examined, and the result shows that: the colony growth rate, hypha morphology and spore formation speed of C17 in plate culture with glucose as carbon source are not obviously different from those of C16; under aerobic conditions, C17 can grow by taking xylose, xylitol and xylan as the only carbon source, and the growth speed of colonies is slower than that of C16, but faster than that of C3-1; under the condition of limited oxygen, 75g/L xylose is used as a unique carbon source for fermentation, the maximum enzyme specific activities of C17 and C16 intracellular Xylose Reductase (XR) are close to each other and are respectively 0.19U/mg and 0.16U/mg, the difference between the maximum enzyme specific activities of intracellular xylitol dehydrogenase is obvious and is respectively 0.002U/mg and 0.058U/mg, and the xdh gene deletion in C17 is verified; under the condition of limited oxygen, 50g/L of xylan is used as a unique carbon source for fermentation, the maximum enzyme activity of the C17 extracellular xylanase is 379.65U/mL of fermentation liquor, and is close to that of C16(385.22U/mL of fermentation liquor), so that the deletion of xdh does not influence the secretion of extracellular induction enzyme; the xylanase activity of C17 is 2.6 times of that of C3-1(147.00U/mL fermentation liquor).
Under the condition of limited oxygen, the C17 takes 75g/L xylose as a unique carbon source, the concentration of the produced xylitol is 30.7g/L, the concentration is improved by 70 percent compared with that of C3-1(17.7g/L), and the yield are respectively 0.41g/g and 0.43 g.L -1 ·h -1 The ratio of the C3-1 is respectively improved by 70 percent and 139 percent; 50g/L of xylan is taken as a unique carbon source, the concentration of produced xylitol is 13.5g/L, the yield is improved by 66 percent compared with that of C3-1(8.12g/L), and the yield are respectively 0.27g/g and 0.16 g.L -1 ·h -1 The improvement is 69 percent and 129 percent respectively compared with that of C3-1. The second-generation xylitol CBP engineering bacteria with enhanced hemicellulose saccharification capacity further improve the xylitol synthesis capacity.
Claims (3)
1. A method for synthesizing xylitol by Aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity comprises the following steps:
1) obtaining an Aspergillus oryzae strain, saidThe Aspergillus oryzae strain is Aspergillus oryzaeA. oryzae A73；
2) By means of beltspyrGTargeting vector pMD-pyrGAB transformation of knockout cassetteA. oryzae A73, obtained by screening 5-fluoroorotic acid 5-FOA resistance phenotype and PCR verificationpyrGDeficient uridine-deficient mutant strainsA. oryzae C16; using C16 as recipient bacterium, and carryingpyrGScreening the marked recombinant vector pMD-pyrG for complementary transformation to obtainpyrG + Reverting mutants established bypyrGHomologous transformation systems for selection markers;
3) the gene deletion technology capable of being recycled by using the screening marker is used for carrying out traceless deletion on xdh gene to obtain the aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity: the construction method of the targeting vector pMD-pyrG-xdhABC comprises the following steps: primers are used for amplifying four fragments of an upstream fragment xdh-A, xdh-B, a downstream fragment xdh-C and pyrG of Aspergillus oryzae xdh; connecting the pyrG fragment with pMD19-T to obtain a recombinant plasmid pYRG; carrying out double enzyme digestion by using restriction enzyme SphI/HindIII, and connecting with xdh-B fragment to obtain recombinant plasmid pYRG-B; carrying out double enzyme digestion by SacI/SmaI, and connecting with xdh-A fragment to obtain recombinant plasmid pYRG-AB; the plasmid is subjected to single enzyme digestion by BamH I, then is subjected to smoothing and dephosphorylation treatment by T4 DNA polymerase and alkaline phosphatase respectively, and is subjected to blunt end connection with a xdh-C fragment which is subjected to T4 polynucleotide kinase treatment and 5' end phosphorylation to obtain a targeting vector; using C16 as host bacteria, and carrying the carrier by using gene deletion technology capable of being recycled by screening markers pyrGIs/are as followsxdhThe traceless missing targeting vector pMD-pyrG-xdhABC is transformed into receptor cells, after two times of homologous integration, 5-FOA resistance screening and PCR verification are carried out, and finally the receptor cells are obtainedpyrG、xdhA double-deleted mutant; primers for amplifying four fragments of upstream fragment xdh-A, xdh-B, downstream fragment xdh-C and pyrG of Aspergillus oryzae xdh are as follows:
xdh-A1：GCCGAGCTCCGGCGGAAATCAATAC
xdh-A2：TCCCCCGGGAAATCGCTTCGGTGAG
xdh-B1：CATGCATGCCAGAGTAGAATCCGAGTG
xdh-B2：CCCAAGCTTAACCTGACATCCACG
xdh-C1：TTGGTTTCTGCGGTGGCTTGTA
xdh-C2：ATTCGGCTCGGGTGGCGGTTC
pyrG-F：AAAATGCGAAGGTAAGTG
pyrG-R：AGTATGGAAAGAAAGAGGC
4) synthesizing xylitol by using the aspergillus oryzae engineering bacteria obtained in the step 3).
2. The method for synthesizing xylitol by using aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity as claimed in claim 1, is characterized in that: the construction method of the targeting vector pMD-pyrGAB comprises the following steps: the genome of A, oryzae CICC2012 is taken as a template, primers are used for amplifying 1.0 kb PA and 1.5 kb PB of upstream and downstream homologous recombination fragments of pyrG respectively, the primers are used for splicing the upstream and downstream fragments through overlap extension PCR, the spliced fragment of 2.5 kb is connected with a linear vector pMD19-T of 2.7 kb, a 5.2 kb pyrG knockout targeting vector pMD19-pyrGAB is obtained, and enzyme digestion verification is carried out.
3. The method for synthesizing xylitol by using aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity as claimed in claim 2, which is characterized in that: the primers for amplifying the homologous recombination fragments on the upstream and downstream of pyrG are as follows:
PA-F：TAAGCCACGATCTCGATCATTAACTAAAGACCACGAGAGG
PA-R：aggtgtcttattcgtacggaTTGATATATGGAATGAAATG
PB-F：catttcattccatatatcaaTCCGTACGAATAAGACACCT
PB-R：CTGTGACCTGTCTCAAATTATAGAACGAAAACTCAAAGCC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811590694.3A CN110982850B (en) | 2018-12-25 | 2018-12-25 | Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811590694.3A CN110982850B (en) | 2018-12-25 | 2018-12-25 | Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110982850A CN110982850A (en) | 2020-04-10 |
| CN110982850B true CN110982850B (en) | 2022-07-29 |
Family
ID=70059748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811590694.3A Active CN110982850B (en) | 2018-12-25 | 2018-12-25 | Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110982850B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112111415B (en) * | 2020-09-16 | 2022-10-14 | 福建农林大学 | Method for recycling pyrG screening marker and application |
| CN115058444B (en) * | 2022-06-28 | 2023-04-28 | 深圳技术大学 | Aflatoxin strain, construction method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012045088A9 (en) * | 2010-10-01 | 2012-07-26 | The Board Of Trustees Of The University Of Illinois | Combinatorial design of highly efficient heterologous pathways |
| CN103124783A (en) * | 2010-06-03 | 2013-05-29 | 马斯科马公司 | Yeast expressing saccharolytic enzymes for consolidated bioprocessing using starch and cellulose |
| CN106460022A (en) * | 2014-06-24 | 2017-02-22 | 加州大学董事会 | Methods for production of xylosyl-xylitol oligomers |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2012001071A (en) * | 2009-07-24 | 2012-10-09 | Univ California | Methods and compositions for improving sugar transport, mixed sugar fermentation, and production of biofuels. |
-
2018
- 2018-12-25 CN CN201811590694.3A patent/CN110982850B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103124783A (en) * | 2010-06-03 | 2013-05-29 | 马斯科马公司 | Yeast expressing saccharolytic enzymes for consolidated bioprocessing using starch and cellulose |
| WO2012045088A9 (en) * | 2010-10-01 | 2012-07-26 | The Board Of Trustees Of The University Of Illinois | Combinatorial design of highly efficient heterologous pathways |
| CN106460022A (en) * | 2014-06-24 | 2017-02-22 | 加州大学董事会 | Methods for production of xylosyl-xylitol oligomers |
Non-Patent Citations (3)
| Title |
|---|
| Construction of a high-efficiency gene-targeting system in brewing-wine Aspergillus oryzae industrial strain used in direct xylitol conversion from xylan;Chen hongwen et al.;《Acta Biochim Biophys Sin》;20180522;第50卷(第7期);第723-726页 * |
| Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation;Du Yu etal.;《Acta Biochim Biophys Sin》;20140416;第46卷(第6期);第477-483页 * |
| 米曲霉木聚糖酶高产菌株选育;李晨;《华侨大学学报（自然科学版）》;20111130;第32卷(第6期);第663-667页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110982850A (en) | 2020-04-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2901974C (en) | Method for producing ethanol using recombinant yeast | |
| CN105802854B (en) | Cellulase high-yield strain and application thereof | |
| Favaro et al. | Codon-optimized glucoamylase sGAI of Aspergillus awamori improves starch utilization in an industrial yeast | |
| US9243256B2 (en) | Biofuel production | |
| JP2004513632A (en) | Recombinant Zymomonas mobilis with improved xylose utilization | |
| US8383377B2 (en) | Bacterium capable of fermenting glucose, mannose and xylose simultaneously, and method for production of bioethanol using the bacterium | |
| US10947519B2 (en) | Yeast strains co-expressing exogenous glucoamylases, the method for obtaining said yeast strains and the use thereof to produce bioethanol | |
| CN110982850B (en) | Method for synthesizing xylitol by aspergillus oryzae engineering bacteria with enhanced hemicellulose saccharification capacity | |
| CN105368730B (en) | The Wine brewing yeast strain and construction method of one plant of Rapid Fermentation xylose producing and ethanol | |
| CN104024419A (en) | Method for producing ethanol that uses recombinant yeast | |
| CN106434402B (en) | Saccharomyces cerevisiae strain for expressing xylose isomerase and construction method thereof | |
| Jeffries | Engineering the Pichia stipitis genome for fermentation of hemicellulose hydrolysates | |
| KR101230638B1 (en) | Kluyveromyces marxianus having superior heat resistance and ethanol productivity | |
| JP6465470B2 (en) | Method for producing saccharifying enzyme, and method for saccharification of plant biomass | |
| CA3028926C (en) | A recombinant yeast and a method for producing ethanol using the same | |
| US10745684B2 (en) | Recombinant yeast and a method for producing ethanol using the same | |
| KR101412468B1 (en) | Mutant Beta-glucosidase with Advanced Activity and Process for Preparing Bio-ethanol Employing the Same | |
| US20130252286A1 (en) | Transformant of yeast of genus schizosaccharomyces, and method for producing same | |
| Rajoka et al. | Kinetics of β-glucosidase production by Saccharomyces cerevisiae recombinants harboring heterologous bgl genes | |
| JP2014064484A (en) | Gene recombinant yeast capable of assimilating xylooligosaccharide, screening method of the gene recombinant yeast, and ethanol production method using the gene recombinant yeast | |
| JP7078900B2 (en) | Transformed yeast and method for producing ethanol using it | |
| JP6346853B2 (en) | Neisseria gonorrhoeae mutant, transformant and method for producing saccharifying enzyme | |
| CN116179382A (en) | Genetic engineering bacterium for high-yield erythritol, construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |