CN110982722A

CN110982722A - Construction method of saccharomyces cerevisiae for efficiently synthesizing α -amyrin

Info

Publication number: CN110982722A
Application number: CN201911346558.4A
Authority: CN
Inventors: 王颖; 余源; 常鹏程; 刘皓然; 李春
Original assignee: Beijing Institute of Technology BIT
Current assignee: Beijing Institute of Technology BIT
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2020-04-10

Abstract

The invention provides a method for constructing Saccharomyces cerevisiae (Saccharomyces cerevisiae) for efficiently synthesizing α -balsamic alcohol, belonging to the field of bioengineering.A series of mutants are obtained by carrying out semi-rational design on α -balsamic alcohol synthase derived from apples (Malus domestica) through saturated mutation and iterative mutation of key amino acid residue sites, wherein the mutants comprise MdOSC1 mutants with the highest catalytic activity, and then key genes in a α -balsamic alcohol synthesis way are overexpressed, and diacylglycerol acyltransferase (DGA1) is overexpressed, so that the storage capacity of α -balsamic alcohol in Saccharomyces cerevisiae cells is improved.

Description

Construction method of saccharomyces cerevisiae for efficiently synthesizing α -amyrin

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a construction method and application of saccharomyces cerevisiae for efficiently synthesizing α -amyrin.

Background

α -citronellol is an important ursane-type pentacyclic triterpenoid, has various common biological activities including anti-tumor, anti-inflammatory, anti-oxidation, immune enhancement and liver protection, and has the strongest antiproliferative activity, α -citronellol is widely distributed in leaves, fruits and rhizomes of plants as a plant secondary metabolite, but the accumulation amount is small, the traditional chemical synthesis and plant source extraction efficiency is low, the yield is limited, the period is long, and the pollution is serious.

The traditional metabolic engineering strategy is used for improving the yield, and the measures of over-expression of key genes of a target product synthesis pathway, down-regulation and balance of a competitive pathway, utilization of pathway intermediates and the like are widely applied, and in addition, the storage capacity of the saccharomyces cerevisiae for hydrophobic compounds can be improved, so that the accumulation of α -balsam stem (3s) -2, 3-oxidized squalene can be increased, and the yield of α -balsam stem is expected to be improved.

More importantly, the catalytic activity of α -balsamic alcohol synthase greatly affected α -balsamic alcohol production, so I performed (semi-) rational design and engineering of α -balsamic alcohol synthase to increase catalytic activity and specificity of the enzyme, the semi-rational design approach we adopted created a small and precise library of mutations relative to directed evolution based on crystal structure and computational models, using residues around the active site and substrate binding site as optimal candidates for mutagenesis, modified to produce α -balsamic alcohol synthase with increased catalytic activity or specificity, microbial production of plant natural product α -balsamic alcohol was achieved by introducing α -balsamic alcohol synthase into Saccharomyces cerevisiae, combining protein engineering with metabolic engineering to further optimize the Saccharomyces cerevisiae cell factory, increasing α -balsamic alcohol production, which all provided valuable reference for efficient production of plant natural products using Saccharomyces cerevisiae.

Disclosure of Invention

The invention aims to provide a construction method of saccharomyces cerevisiae for efficiently synthesizing α -balsamic alcohol, which comprises the construction of a α -balsamic alcohol synthase mutant with high activity.

Semi-rational design of enzymes, according to

claims

1,2 and 3, comprising semi-rational design of apple-derived α -balsamic alcohol synthase MdOSC1(Malus domimestica, GenBank accession No. ACM89977.1), homogeneous modeling with the crystal structure of human lanosterol synthase (PDB:1W6K) as template by means of the on-line tool Swiss-Model, and simultaneous use of the on-line tool Pub chem

(https:// pubchem. ncbi. nlm. nih. gov /) 3D structure of the substrate (3S) -2, 3-oxidosqualene was predicted and molecular docking was performed using Autodock1.5.6 software.

The construction of α -balsamic alcohol synthase mutants, as shown in

claims

1,2 and 4, involves selecting the sequence closest to the substrate binding domain (353DQIHYEDENSRYITIGCVEKPLMML377), the sequence near the catalytic domain (249LPFHPSKMFCYCRLTYLPMS268) and the N-terminal part sequence (2WKIKFGEGANDPMLFSTNNFHGRQ25) as mutation sites and subjecting them to alanine scanning mutation after molecular docking of α -balsamic alcohol synthase MdOSC1 with the substrate (3S) -2, 3-oxidosqualene, and selecting the nonpolar amino acid residues P250 and P373 near the active center and the polar amino acid residue N11 outside the active center for saturation mutation among the amino acid residues whose catalytic activity is markedly enhanced after mutation.

The process of claim 1,2 or 5, wherein the obtaining of a series of mutants from α -balsamic alcohol synthase mutants with high activity comprises selecting single-point mutants N11I, P250N and P373A with high catalytic activity as candidate mutation sites of iterative mutants, combining them, constructing α -balsamic alcohol synthase iterative mutants using α -balsamic alcohol synthase plasmid containing single-point mutations as template to generate double mutants and triple mutants, and finally obtaining α -balsamic alcohol synthase mutant MdOSC1-1 with highest catalytic activity, introducing original strain Insc1 of Saccharomyces cerevisiae to obtain strain aAM8, and increasing aAM8 by 1310% compared with MdOSC1 of strain introduced MdOSC1 gene in terms of production of α -balsamic alcohol in Saccharomyces cerevisiae.

The construction of high copy plasmids overexpressing α -key enzymes of the balsamic alcohol synthesis pathway, as shown in claims 6 and 7, the α -balsamic alcohol synthase mutant MdOSC1-1 expression cassette was constructed on pYYG vector.

The method for constructing α -overexpression of 3-hydroxy-3-methylglutaryl coenzyme A reductase in the synthetic pathway of citronellol as shown in the claims 6 and 7 comprises constructing PTEF1-HIS3-TADH1 gene expression cassette, transforming and integrating the gene expression cassette into rDNA locus of Saccharomyces cerevisiae XII chromosome, and introducing truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase expression cassette P into the rDNA locus_TDH3-tHMG1-T_HMG1And P_TEF1-HIS3-T_ADH1。

As shown in claim 9, the construction of recombinant strain integrating Saccharomyces cerevisiae endogenous diacylglycerol acyltransferase (DGA1) at high copy site of genome is carried out by introducing Saccharomyces cerevisiae INVSC1(MATa/MAT α his3 delta 1leu2 trp1-289ura3-52) as host strain on delta site by homologous recombination technique to improve the storage capacity of Saccharomyces cerevisiae for hydrophobic oil and fat substances, wherein the constructed expression cassette is "P1_ADH1-DGA1-T_DGA1”。

The method of claims 8 and 10, wherein the constructed recombinant strain comprises 6,7 and 9 integrated to obtain the engineered saccharomyces cerevisiae aamm 15 with enhanced expression of MVA pathway and enhanced product storage capacity, and experiments prove that the yield of α -balsamic alcohol high-yield engineered bacterium aAM15 and α -balsamic alcohol obtained by the homologous recombination method reaches 213.79mg/L, which is 93.6 times higher than that of the strain without protein engineering and metabolic engineering modification.

The saccharomyces cerevisiae engineering bacteria have the following advantages:

1. the expression of α -balsamic alcohol synthase in the invention is induced by galactose, thus realizing the production of α -balsamic alcohol in a specific stage, reducing the damage of α -balsamic alcohol to the cells of Saccharomyces cerevisiae (Saccharomyces cerevisiae), and improving the yield.

2. The invention utilizes Saccharomyces cerevisiae as a chassis host, and α -balsamic alcohol synthase is transformed through semi-rational design to obtain the mutant MdOSC1-1 with greatly improved catalytic activity, which can be applied to the high-efficiency synthesis of other downstream metabolites (such as ursolic acid and the like).

3. According to the invention, the Saccharomyces cerevisiae engineering bacteria directly synthesize a large amount of α -balsam alcohol by using glucose and galactose, so that the high-efficiency synthesis of the plant secondary metabolite in the Saccharomyces cerevisiae is realized, the problems of low early-stage chemical synthesis and separation extraction yield are solved, and the industrial production of α -balsam alcohol is promoted.

Drawings

FIG. 1 shows the strategy for constructing a Saccharomyces cerevisiae cell factory for efficient synthesis of α -amycolate.

FIG. 2 is a Pymol software analysis of the α -balsamic alcohol synthase MdOSC1 and (3S) -2, 3-oxidosqualene docking model.

FIG. 3 shows the yield of all α -balsamic alcohol synthase MdOSC1 mutants constructed during the patent design.

FIG. 4 shows the results of gas mass spectrometry detection and yield of α -balsam alcohol produced by the engineered strain of Saccharomyces cerevisiae in the patent construction.

Detailed Description

The present invention will be further described with reference to the following examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The sequences of the PCR primers (Table 1) used in the following examples:

TABLE 1 PCR primer sequences

Example 1 MdOSC1 mutant screening

For molecular docking of wild-type α -balsamic alcohol synthase MdOSC1 from apple, the study used the X-ray crystal structure of human lanosterol synthase (PDB:1W6K) reported in the PDB database (http:// www.wwpdb.org) as a homologous protein template to MODEL the 3D structure of MdOSC1 by the online tool SWISS-MODEL (http:// www.swissmodel.expasy.org). Simultaneous with the online tool Pubchem (htps:// pubchem.ncbi.nlm.nih.gov /) to predict the 3D structure of the substrate (3S) -2, 3-oxidosqualene, the structure files for MdOSC1 and (3S) -2, 3-oxidosene, respectively, were downloaded, and the molecular docking simulation was performed using AutoDock1.5.6, introducing MdOSC1 and (3S) -2, 3-oxidosene, respectively, where the structure files for MdOSC1 and (3S) -2, 3-oxidosene (3-oxidosene, 5459811, were performed as substrates:

Edit>Charges>Add Kollman Charges

Edit>Hydrogens>Add(Hydrogens)>Polar Only>OK

WithBondOrder

Yes

Grid>Macromolecule>choose>pdb name>Select Molecule

if the file is opened smoothly, the molecular file to be docked (receiver) is saved in the pdbqt format

Grid>Grid box>Spacing(angstrom)＝1

Number of points in x-dimension

Number of points in y-dimension

Number of points in z-dimension

With the region between the substrate binding domain and the catalytic domain of MdOSC1 as the molecular docking center, a molecular docking region with a Grid box parameter of 80X 80(x center, y center and z center) is set to enable the lattice center to be at the protein molecular center, the terminal is opened, the destination folder is entered (entry method: cd/next level directory), the default installation path is used as an example, the previously saved α -balsamic alcohol synthase MdOSC1 and the (3S) -2, 3-oxidosqualene profile, pdbqt and the Grid box parameter txt internal information is used as a reference, the command C: \\\ Program Files:. pdbqt-pdt-center _ x-center _ y-title _ search _ visual _ visual _ Vina _ Vina _.

The created substrate docking model was further analyzed by PyMOL software to examine and identify key amino acid residues around the binding pocket (484DCTAE488) and catalytic site (256MFCYCR261) of MdOSC1, select the sequence near the substrate binding domain (353DQIHYEDENSRYITIGCVEKPLMML377), the sequence near the catalytic domain (249LPFHPSKMFCYCRLTYLPMS268), and the N-terminal portion sequence (2WKIKFGEGANDPMLFSTNNFHGRQ25) as mutation sites, use alanine scanning mutation to mutate the candidate amino acid residue sites to alanine, convert saccharomyces cerevisiae, GC-MS detects the yield of α -balsamic alcohol, select the mutant with significantly changed yield among MdOSC1 mutants, further combine the single-point mutants with higher catalytic activity to generate double mutants and triple mutants using MdOSC1 as a template, convert saccharomyces cerevisiae, GC-MS detects the yield of α -balsamic alcohol, and screen iterative mutants that can further improve the catalytic activity of MdOSC1.

Example 2 construction of mutant MdOSC1-1 high expression plasmid

The pYYG vector is a truncated vector based on the pESC plasmid, the plasmid is minimized by removing non-essential sequences in the plasmid, the pESC-Trp-MdOSC1-1 plasmid is used as a template, BamHI and XhoI enzyme cutting sites are respectively introduced into an upstream primer and a downstream primer, the MdOSC1-1 gene is amplified by PCR, a PCR reaction system is shown in Table 2, and PCR reaction conditions are specifically set according to the actual conditions such as the primer composition, the size of an amplified fragment and the like.

TABLE 2 PCR reaction System

And (3) PCR reaction conditions: from the second step to the 4 th step, 30 cycles were repeated.

Construction of pYYG-Trp-MdOSC1-1 plasmid:

the PCR product of MdOSC1-1 and the pYYG-Trp vector were digested with BamHI and XhoI restriction enzymes, and the desired fragment was inserted into the corresponding site of the pYYG-Trp vector, and the digestion system is shown in Table 3. After the reaction, electrophoresis was performed using 1% agarose gel, and the target fragment was recovered by a DNA gel recovery kit.

TABLE 3 plasmid digestion reaction

Reaction conditions are as follows: reacting at 37 ℃ for 2-6 hours.

The desired fragment MdOSC1-1 was ligated to the pYYG-Trp vector fragment using T4 DNA ligase from Thermo, and ligation transformation was performed according to the following system (Table 4).

TABLE 4 plasmid digestion reactions

Note that: the components must be added sequentially, and the molar ratio of the insert to the carrier is 2-10: 1. Mixing the components evenly, and carrying out water bath at 16 ℃ for 2 h. After the reaction was complete, the ligation product (10. mu.l) was transformed into E.coli competent cells. Positive clones were screened by colony PCR and correct clones were verified by sequencing. The successfully constructed plasmid was used as a backbone for the construction of the point mutant plasmid.

Example 3 Co-expression of Key genes and diacylglycerol acyltransferase (DGA1) Gene in the MVA pathway

Assembling metabolic pathway key gene expression cassette P by the same method as constructing plasmid gene expression cassette_TDH3-tHMG1-T_HMG1Meanwhile, pESC-His plasmid is taken as a template, and a His screening gene expression cassette P is amplified by PCR_TEF1-HIS3-T_ADH1. The rDNA site homology arms were amplified by PCR using yeast genomic DNA as a template. Primers used to construct the genome assembly strain AM1 are shown in table 5, with the overlap indicated by underlining.

TABLE 5 Gene expression cassettes ERG20, ERG9, ERG1 genome Whole primers

Assembly of Gene expression cassette P Using PCR_DGA1-DGA1-T_DGA1Meanwhile, using pESC-Leu plasmid as template, PCR amplifying Leu screening gene expression box P_TEF1-HIS3-T_ADH1. The rDNA site homology arms were amplified by PCR using yeast genomic DNA as a template. The primers used are shown in Table 6, the primers are underlined to indicate the overlap.

TABLE 6 Gene expression cassette tHMG1, DGA1 genome Whole primer

And (3) converting Leu and DGA1 expression cassettes obtained by PCR amplification into AM1 Saccharomyces cerevisiae competent cells, screening by using an SD-His-Leu solid culture medium, and verifying the positive engineering bacteria AM2 by colony PCR.

Example 4 construction of engineered Saccharomyces cerevisiae efficiently synthesizing α -citronellol and detection of products

Combining the MdOSC1 mutant with the highest catalytic activity constructed in example 2 with the Saccharomyces cerevisiae Chassis host bacteria constructed in example 3 to obtain α -amycolatol high-yielding engineering bacteria aAM15, inoculating a single colony thereof into a liquid culture medium, performing shake culture at 30 ℃ for 24 hours, inoculating the single colony to a new liquid culture medium in an amount of 5% by volume, performing shake culture at 30 ℃ for 48 hours, adding galactose to 2g/L, performing continuous culture for 5 days, centrifuging for 5 minutes after fermentation, collecting thalli, suspending in 10 ml of 20% (w/v) potassium hydroxide, boiling at 100 ℃ for 10 minutes to lyse the cells, extracting N-hexane, transferring the organic phase, and performing rotary evaporation to dryness, alkylating the crude sample at 80 ℃ with N-methyl-N (trimethylsilyl) trifluoroacetamide and pyridine, performing gas chromatography-mass spectrometry using Shimadzu GCMS-QP PLUS (Shimadzu), performing qualitative and quantitative analysis using DB-5mS column (Agilen), performing qualitative and quantitative analysis at an initial temperature of 80 ℃, maintaining the initial temperature at 40 min to 280 min, maintaining the temperature at a temperature of 300 ℃/1 ℃/min, and performing temperature distribution detection at a temperature distribution mode of 10 ℃/1 μ L.

Sequence listing

<110> Beijing university of science and technology

<120> construction method of saccharomyces cerevisiae for efficiently synthesizing α -balsam stem

<130>1

<160>19

<170>SIPOSequenceListing 1.0

<210>1

<211>2119

<212>DNA

<213> apple (Malus domestica)

<400>1

atgtggaaga tcaagtttgg agagggtgca aatgacccta tgttgttcag cacaaacaac 60

ttccatggaa ggcagacatg ggagttcgac ccagatgcag gtaccgagga ggagcgagca 120

gaagttgaag ctgctcgtga gcatttctac caaaatcgct tcaaggtcca gcctagcagc 180

gacctcctat ggcgttttca gatactaaga gagaaaaact ttaaacaaga aattcctcca 240

gtaagagttg gggagggtga ggacattaca tatgatcagg ccacagctgc attcaggagg 300

gctgctacct tctggaatgc cttgcaatca ccccatggac attggcctgc tgaaaatgct 360

ggcccaaact tttacttccc tcccttggtc atggctgcat acattccagg atatctcaat 420

gttattttct ccgctgagca caagaaggaa atcttgcgtt acacatacaa ccatcaaaat 480

gaagatggtg gctggggact gcacatagcg gggcctagta tgatgtttac tacatgccta 540

aactactgta tgatgcgtat tctcggagat ggccccgatg gtggtcgtga caatgcctgt 600

gcaagggcac gaaagtggat tcttgaccgt ggtggtgcgt actattctgc atcatggggc 660

aaaacttgga tggcgattct tggtgtgtat gactgggaag gcagcaaccc aatgccccca 720

gaattctgga ctgggtcgac tctgcttcct tttcatccat caaaaatgtt ctgctactgt 780

aggttgactt acctacctat gtcttacttt tatgccacaa gatttgttgg cccaatcact 840

ccacttgttg aggaattgag acaagaaatt tactgtgaat cttacaacga aattaactgg 900

cctaaagtgc gccattggtg tgcaacagaa gataactact atccccatgg tcgtgtacaa 960

cgttttatgt gggacggttt ttacaatatc gtcgagcctc tcctaaaacg ctggcctttc 1020

aagaagatca gagacaatgc aattcaattc acaattgacc aaattcatta tgaagatgag 1080

aacagtcgtt acattacaat cggatgcgtg gaaaagccat tgatgatgct tgcttgctgg 1140

gccgaggatc ctagtggaga agctttcaag aagcatcttc ctagagttac cgattatatc 1200

tggctcggag aggatggaat caagatgcaa agttttggaa gccagtcatg ggattgtgct 1260

cttgtgattc aagctttgct tgctgggaat cttaatgctg aaatgggacc cacccttaag 1320

aaagcacacg aattcctcaa gatatctcag gtgaggatta atacatccgg tgactaccta 1380

tctcatttcc gtcacatttc aaagggcgca tggacattct ctgaccgtga tcatggatgg 1440

caagtgtcag attgcactgc agaagcactg aggtgttgct gcatttttgc aaatatgtcc 1500

ccagaagttg ttggtgagcc aatggaagct gagtgtatgt atgatgctgt caatgtcatc 1560

atgtctcttc aaagtccaaa tggtggtgta tcagcctggg agccaacagg agcaccaaaa 1620

tggttggagt ggctcaaccc tgtggagttt cttgaggacc ttgtcattga gtacgagtac 1680

atcgagtgca cttcatcttc gatccaggcc ttaacattgt ttaggaagtt gtaccctggc 1740

catagaagga aggagatcaa caatttcatc acaagggctg cagactacat tgaagacata 1800

cagtaccctg atggctcatg gtatggaaac tggggaatct gcttcgtgta tggtacatgg 1860

ttcgcaatca aagggctgga ggctgccggc aggacataca acaactgtga ggcagtgcgc 1920

aaaggtgtcg actttttgct caaaacacaa agggcagatg gtggctgggg agagcactac 1980

acctcatgca caaacaagaa atatacagct caagacagta caaatttagt ccaaactgca 2040

ctcggattaa tgggtctgat tcacggtcga caggctgaga gagatccaac tcctattcac 2100

cgggctgctg cggtgttaa 2119

<210>2

<211>1491

<212>DNA

<213> Candida albicans (Candida albicans)

<400>2

atgagttcag ttaagtatga tgctattatt attggtgcag gggttattgg tcccaccatt 60

gcaactgctt ttgccagaca agggagaaag gttttgattg tggaaagaga ctggtccaag 120

ccagatagaa ttgttggaga gttgatgcaa ccggctggta tcaaggcatt aagagagttg 180

gggatgatca aagctattaa taatattagg gctgttgatt gtactgggtactatatcaaa 240

tattatgacg agaccattac tatcccttat ccattgaaaa aagatgcctg tatcactaat 300

ccagtgaagc cagttcctga tgccgttgat ggtgtaaatg ataaattgga tagtgattcc 360

acattgaatg ttgatgactg ggattttgat gaaagagtac gtggggctgc atttcaccat 420

ggggatttcc ttatgaattt aagacaaatt tgtcgtgatg aaccaaatgt taccgcagtt 480

gaagcaacag taacaaagat tttgcgtgat cctctggatc ctaacacagt tattggtgtg 540

caaacaaaac aacccagtgg cactgttgat taccatgcaa agttgacaat cagttgtgat 600

ggtatttact ccaaattcag aaaggaatta agtcctacta atgttccaac cattggctct 660

tactttattg ggttgtattt gaagaatgct gaattaccag ctaagggcaa aggtcatgtg 720

ttattgggag gacatgcacc agcattgata tattcagtgt ccccaactga aacacgtgta 780

ttgtgtgttt atgtttcatc aaaacctcct tctgctgcta acgatgcagt ttacaagtat 840

ttgagagata acattttgcc agcaattcct aaagagactg ttcctgcttt taaggaagcc 900

cttgaagaaa gaaagtttag aatcatgcca aaccagtatc tttctgctat gaaacaaggt 960

agtgaaaacc ataaagggtt tatattgtta ggtgattctt taaatatgag acatccatta 1020

actgggggtg gtatgacagt tggtttaaat gatagtgtgt tattagcaaa attgttgcat 1080

ccaaaatttg ttgaagattt tgatgatcac caattgattg ctaaaagatt aaagacattc 1140

cacagaaaaa gaaagaattt ggacgctgtt atcaacacat tatctatttc attatattca 1200

ttatttgccg ctgataagaa acctttaaga atattaagaa atggttgttt taaatatttc 1260

caaagaggtg gagaatgtgt taacgggcca attggattat tgagtggcat gttaccattc 1320

ccaatgttgt tattcaacca ttttttcagt gttgccttct attcggtcta tttgaatttt 1380

atagaaagag gacttttggg attcccattg gcattatttg aggcatttga agtgttgttc 1440

actgcaattg taatctttac tccatattta tggaacgaga ttgtaagata g 1491

<210>3

<211>1335

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>3

atgggaaagc tattacaatt ggcattgcat ccggtcgaga tgaaggcagc tttgaagctg 60

aagttttgca gaacaccgct attctccatc tatgatcagt ccacgtctcc atatctcttg 120

cactgtttcg aactgttgaa cttgacctcc agatcgtttg ctgctgtgat cagagagctg 180

catccagaat tgagaaactg tgttactctc ttttatttga ttttaagggc tttggatacc 240

atcgaagacg atatgtccat cgaacacgat ttgaaaattg acttgttgcg tcacttccac 300

gagaaattgt tgttaactaa atggagtttc gacggaaatg cccccgatgt gaaggacaga 360

gccgttttga cagatttcga atcgattctt attgaattcc acaaattgaa accagaatat 420

caagaagtca tcaaggagat caccgagaaa atgggtaatg gtatggccga ctacatctta 480

gatgaaaatt acaacttgaa tgggttgcaa accgtccacg actacgacgt gtactgtcac 540

tacgtagctg gtttggtcgg tgatggtttg acccgtttga ttgtcattgc caagtttgcc 600

aacgaatctt tgtattctaa tgagcaattg tatgaaagca tgggtctttt cctacaaaaa 660

accaacatca tcagagatta caatgaagat ttggtcgatg gtagatcctt ctggcccaag 720

gaaatctggt cacaatacgc tcctcagttg aaggacttca tgaaacctga aaacgaacaa 780

ctggggttgg actgtataaa ccacctcgtc ttaaacgcat tgagtcatgt tatcgatgtg 840

ttgacttatt tggccggtat ccacgagcaa tccactttcc aattttgtgc cattccccaa 900

gttatggcca ttgcaacctt ggctttggta ttcaacaacc gtgaagtgct acatggcaat 960

gtaaagattc gtaagggtac tacctgctat ttaattttga aatcaaggac tttgcgtggc 1020

tgtgtcgaga tttttgacta ttacttacgt gatatcaaat ctaaattggc tgtgcaagat 1080

ccaaatttct taaaattgaa cattcaaatc tccaagatcg aacagtttat ggaagaaatg 1140

taccaggata aattacctcc taacgtgaag ccaaatgaaa ctccaatttt cttgaaagtt 1200

aaagaaagat ccagatacga tgatgaattg gttccaaccc aacaagaaga agagtacaag 1260

ttcaatatgg ttttatctat catcttgtcc gttcttcttg ggttttatta tatatacact 1320

ttacacagag cgtga 1335

<210>4

<211>1059

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>4

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttacttctt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatcaa tgacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatag 1059

<210>5

<211>1578

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>5

atggaccaat tggtgaaaac tgaagtcacc aagaagtctt ttactgctcc tgtacaaaag 60

gcttctacac cagttttaac caataaaaca gtcatttctg gatcgaaagt caaaagttta 120

tcatctgcgc aatcgagctc atcaggacct tcatcatcta gtgaggaaga tgattcccgc 180

gatattgaaa gcttggataa gaaaatacgt cctttagaag aattagaagc attattaagt 240

agtggaaata caaaacaatt gaagaacaaa gaggtcgctg ccttggttat tcacggtaag 300

ttacctttgt acgctttgga gaaaaaatta ggtgatacta cgagagcggt tgcggtacgt 360

aggaaggctc tttcaatttt ggcagaagct cctgtattag catctgatcg tttaccatat 420

aaaaattatg actacgaccg cgtatttggc gcttgttgtg aaaatgttat aggttacatg 480

cctttgcccg ttggtgttat aggccccttg gttatcgatg gtacatctta tcatatacca 540

atggcaacta cagagggttg tttggtagct tctgccatgc gtggctgtaa ggcaatcaat 600

gctggcggtg gtgcaacaac tgttttaact aaggatggta tgacaagagg cccagtagtc 660

cgtttcccaa ctttgaaaag atctggtgcc tgtaagatat ggttagactc agaagaggga 720

caaaacgcaa ttaaaaaagc ttttaactct acatcaagat ttgcacgtct gcaacatatt 780

caaacttgtc tagcaggaga tttactcttc atgagattta gaacaactac tggtgacgca 840

atgggtatga atatgatttc taaaggtgtc gaatactcat taaagcaaat ggtagaagag 900

tatggctggg aagatatgga ggttgtctcc gtttctggta actactgtac cgacaaaaaa 960

ccagctgcca tcaactggat cgaaggtcgt ggtaagagtg tcgtcgcaga agctactatt 1020

cctggtgatg ttgtcagaaa agtgttaaaa agtgatgttt ccgcattggt tgagttgaac 1080

attgctaaga atttggttgg atctgcaatg gctgggtctg ttggtggatt taacgcacat 1140

gcagctaatt tagtgacagc tgttttcttg gcattaggac aagatcctgc acaaaatgtt 1200

gaaagttcca actgtataac attgatgaaa gaagtggacg gtgatttgag aatttccgta 1260

tccatgccat ccatcgaagt aggtaccatc ggtggtggta ctgttctaga accacaaggt 1320

gccatgttgg acttattagg tgtaagaggc ccgcatgcta ccgctcctgg taccaacgca 1380

cgtcaattag caagaatagt tgcctgtgcc gtcttggcag gtgaattatc cttatgtgct 1440

gccctagcag ccggccattt ggttcaaagt catatgaccc acaacaggaa acctgctgaa 1500

ccaacaaaac ctaacaattt ggacgccact gatataaatc gtttgaaaga tgggtccgtc 1560

acctgcatta aatcctaa 1578

<210>6

<211>1257

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>6

atgtcaggaa cattcaatga tataagaaga aggaagaagg aagaaggaag ccctacagcc 60

ggtattaccg aaaggcatga gaataagtct ttgtcaagca tcgataaaag agaacagact 120

ctcaaaccac aactagagtc atgctgtcca ttggcgaccc cttttgaaag aaggttacaa 180

actctggctg tagcatggca cacttcttca tttgtactct tctccatatt tacgttattt 240

gcaatctcga caccagcact gtgggttctt gctattccat atatgattta tttttttttc 300

gataggtctc ctgcaactgg cgaagtggta aatcgatact ctcttcgatt tcgttcattg 360

cccatttgga agtggtattg tgattatttc cctataagtt tgattaaaac tgtcaattta 420

aaaccaactt ttacgctttc aaaaaataag agagttaacg aaaaaaatta caagattaga 480

ttgtggccaa ctaagtattc cattaatctc aaaagcaact ctactattga ctatcgcaac 540

caggaatgta cagggccaac gtacttattt ggttaccatccacacggcat aggagcactt 600

ggtgcgtttg gagcgtttgc aacagaaggt tgtaactatt ccaagatttt cccaggtatt 660

cctatttctc tgatgacact ggtcacacaa tttcatatcc cattgtatag agactactta 720

ttggcgttag gtatttcttc agtatctcgg aaaaacgctt taaggactct aagcaaaaat 780

cagtcgatct gcattgttgt tggtggcgct agggaatctt tattaagttc aacaaatggt 840

acacaactga ttttaaacaa aagaaagggt tttattaaac tggccattca aacggggaat 900

attaacctag tgcctgtgtt tgcatttgga gaggtggact gttataatgt tctgagcaca 960

aaaaaagatt cagtcctggg taaaatgcaa ctatggttca aagaaaactt tggttttacc 1020

attcccattt tctacgcaag aggattattc aattacgatt tcggtttgtt gccatttaga 1080

gcgcctatca atgttgttgt tggaaggcct atatacgttg aaaagaaaat aacaaatccg 1140

ccagatgatg ttgttaatca tttccatgat ttgtatattg cggagttgaa aagactatat 1200

tacgaaaata gagaaaaata tggggtaccg gatgcagaat tgaagatagt tgggtaa 1257

<210>7

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>7

ctttttaagc tggcatccag aaaaaaaaag aatcccagca ccaaaatatt gttttcttca 60

ccaaccatca gttcataggt ccattctctt agcgcaacta cagagaacag gggcacaaac 120

aggcaaaaaa cgggcacaac ctcaatggag tgatgcaacc tgcctggagt aaatgatgac 180

acaaggcaat tgacccacgc atgtatctat ctcattttct tacaccttct attaccttct 240

gctctctctg atttggaaaa agctgaaaaa aaaggttgaa accagttccc tgaaattatt 300

cccctacttg actaataagt atataaagac ggtaggtatt gattgtaatt ctgtaaatct 360

atttcttaaa cttcttaaat tctactttta tagttagtct tttttttagt tttaaaacac 420

caagaactta gtttcgaata aacacacata aacaaacaaa 460

<210>8

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>8

attcaaattg ttctagtgac ccaccaaagc tgtatcatgc catgttcaga gacgactaca 60

ccaagaagtt aagtctaaaa tcagcaatat accgtcctat gttagcggtt tttagtgccc 120

tgcaaaaaag tcaacgatga cctgaataat ttgcagatta aacctaacaa ttcagaaccc 180

tatattttat ttaatcatga tcaacggatt ggccgtttct tttttctctt ttttttcatc 240

cgctcgatgg atgatgagta aaacaagaaa aacgcagttg gcgactgcta tcagatatga 300

aagcagtttg attgaacaaa gtcggttttt tttaaataga attacaaaaa aggcgtgctt 360

ccaacatctt cttatttaag acaagacgac gtcaactacc ggattaagga acttgactct 420

ttctttcaag aagcaattaa ctacatcaac tagaaccata 460

<210>9

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>9

agccatagtg atgtctaagt aacctttatg gtatatttct taatgtggaa agatactagc60

gcgcgcaccc acacacaagc ttcgtctttt cttgaagaaa agaggaagct cgctaaatgg 120

gattccactt tccgttccct gccagctgat ggaaaaaggt tagtggaacg atgaagaata 180

aaaagagaga tccactgagg tgaaatttca gctgacagcg agtttcatga tcgtgatgaa 240

caatggtaac gagttgtggc tgttgccagg gagggtggtt ctcaactttt aatgtatggc 300

caaatcgcta cttgggtttg ttatataaca aagaagaaat aatgaactga ttctcttcct 360

ccttcttgtc ctttcttaat tctgttgtaa ttaccttcct ttgtaatttt ttttgtaatt 420

attcttctta ataatccaaa caaacacaca tattacaata 460

<210>10

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>10

ctcttcagca tactcaggat catccttttt gacaagagat cccctgctgt tgtctccatt 60

tggtacgcct ggggaactag aattgctgcc gttttgaccc attctcatcc tcaggaaatt 120

tcttctcatt ctgtctcttt taatgaaggg agaggcattc gtcggacctc ccccgtttct 180

actgcctggt ggattgcgtc tggacatcct tgcgcttact cgaataggcc tccctagcta 240

ttcttcaacc tttcgaacca tccatacttc ttactatcat aatttttatt ttatcatgga 300

ggcgagaagg tccttattcg agcatcacta agaacggaac tcgaacattt acaaagtaga 360

aaaattttat gaaaattaat tgttctttct tcagaataca aattagtcat tgtcaaaaag 420

agattagcat ccataaccgc atactctaat tgacgataac 460

<210>11

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>11

ttcactaccc tttttccatt tgccatctat tgaagtaata ataggcgcat gcaacttctt 60

ttcttttttt ttcttttctc tctcccccgt tgttgtctca ccatatccgc aatgacaaaa 120

aaatgatgga agacactaaa ggaaaaaatt aacgacaaag acagcaccaa cagatgtcgt 180

tgttccagag ctgatgaggg gtatctcgaa gcacacgaaa ctttttcctt ccttcattca 240

cgcacactac tctctaatga gcaacggtat acggccttcc ttccagttac ttgaatttga 300

aataaaaaaa agtttgctgt cttgctatca agtataaata gacctgcaat tattaatctt 360

ttgtttcctc gtcattgttc tcgttccctt tcttccttgt ttctttttct gcacaatatt 420

tcaagctata ccaagcatac aatcaactat ctcatataca 460

<210>12

<211>451

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>12

acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt 60

cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga 120

acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac 180

ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga 240

ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat 300

taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc 360

ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac 420

ctctatactt taacgtcaag gagaaaaaac c 451

<210>13

<211>460

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>13

gaatccttac atcacaccca atcccccaca agtgatcccc cacacaccat agcttcaaaa 60

tgtttctact ccttttttac tcttccagat tttctcggac tccgcgcatc gccgtaccac 120

ttcaaaacac ccaagcacag catactaaat ttcccctctt tcttcctcta gggtgtcgtt 180

aattacccgt actaaaggtt tggaaaagaa aaaagagacc gcctcgtttc tttttcttcg 240

tcgaaaaagg caataaaaat ttttatcacg tttctttttc ttgaaaattt ttttttttga 300

tttttttctc tttcgatgac ctcccattga tatttaagtt aataaacggt cttcaatttc 360

tcaagtttca gtttcatttt tcttgttcta ttacaacttt ttttacttct tgctcattag 420

aaagaaagca tagcaatcta atctaagttt taattacaaa 460

<210>14

<211>258

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>14

agtgaattta ctttaaatct tgcatttaaa taaattttct ttttatagct ttatgactta 60

gtttcaattt atatactatt ttaatgacat tttcgattca ttgattgaaa gctttgtgtt 120

ttttcttgat gcgctattgc attgttcttg tctttttcgc cacatgtaat atctgtagta 180

gatacctgat acattgtgga tgctgagtga aattttagtt aataatggag gcgctcttaa 240

taattttggg gatattgg 258

<210>15

<211>363

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>15

gaagttaaaa taaaacgaaa aataatgcat aggagttctt tttgtttatt ttgctcttaa 60

taaaaaagtg tcattgtata attagtctta gtttaattat ttatgttttt acaaggacaa 120

aagatttgct gttaaaaaga gttttaaata cccttttttc ttacatatgt atatatacag 180

gtttatgcta ataatattgt atagtttatc atgataatcg cctttcaatt tttcttgtct 240

tctatcaacc atttccaaat catatctctg ttctgcttgt tcttaatatc attctccatg 300

ttaaatttct tcacctttga aaaaccttta ttaatcttat tattcgacag gttagcctta 360

tta 363

<210>16

<211>336

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>16

gtctgaagaa tgaatgattt gatgatttct ttttccctcc atttttctta ctgaatatat 60

caatgatata gacttgtata gtttattatt tcaaattaag tagctatata tagtcaagat 120

aacgtttgtt tgacacgatt acattattcg tcgacatctt ttttcagcct gtcgtggtag 180

caatttgagg agtattatta attgaatagg ttcattttgc gctcgcataa acagttttcg 240

tcagggacag tatgttggaa tgagtggtaa ttaatggtga catgacatgt tatagcaata 300

accttgatgt ttacatcgta gtttaatgta cacccc 336

<210>17

<211>365

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>17

gcatagctta atccgttttc acgattcata atataataaa taagaaaaga tatatcatat 60

aaacgttata aaattaataa ccgggtaagt gtagaaaagt gatgcgacgg tttattttct 120

cttcctcttg cgattgaatt taacttgcag atagtgacca taaggcaact acccagtggc 180

aaacagtttt gataacgccc agtacatcaa cgagcgagta taaagacttt ggtacatttt 240

aaaaaggaaa catatattgt tttcattgct agaccctttt agtctcacct caataaaact 300

gctttattcc tcattgggct ttttattctt taattttgca tacttatagc gtgaaactgg 360

gcatt 365

<210>18

<211>363

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>18

taatgaattc attggaaaac acaaaatatg ttagaataaa taaggatttt ttagtgtttg 60

ggctgtatat cttaagtaag agtattaact tacaggaata ctggagttct cgttgaatat 120

tagtgattgt tttacgtaaa tttcatttat ttaaagcttt tacattagaa gttgtttgaa 180

tgtaagttta ggaaagcact acatagctta ccaggcaaag cgtaactgag aggcagtaaa 240

taccggtggt ttccatatga gtctattagg gtctattgtc cttctctttt tggctttaag 300

tcgattgtac ctatctaaaa tatcttcatt caggaaaata atatgctgac ccttgtaata 360

tcg 363

<210>19

<211>190

<212>DNA

<213> Saccharomyces cerevisiae S288C

<400>19

aagatccgct ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta 60

tttttttata gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt 120

tctgtacaga cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt 180

gggacgctcg 190

Claims

1. A construction method of saccharomyces cerevisiae for efficiently synthesizing α -amyrin.

2. The method of claim 1, wherein the method comprises, but is not limited to, semi-rational design of enzyme, increasing α -balsamic alcohol synthase enzyme activity, enhancing α -balsamic alcohol precursor metabolic pathway, increasing α -balsamic alcohol storage capacity in Saccharomyces cerevisiae, and the like.

3. As shown in claims 1-2, the semi-rational design of the enzyme includes designing mutation sites by means of an on-line tool Swiss-Model, homology modeling, molecular docking, etc. using the crystal structure of human lanosterol synthase (PDB:1W6K) as a template.

4. The method of increasing the enzyme activity of α -balsamic alcohol synthase, as described in claims 1-3, includes, but is not limited to, the construction of a mutant of high activity α -balsamic alcohol synthase.

5. The method of constructing high activity α -balsamic alcohol synthase mutants, as claimed in claims 1-4, comprises obtaining a series of mutants comprising:

the protein derived from α -balsamic alcohol synthase MdOSC1 with high activity is obtained by substituting and/or deleting and/or adding one or more amino acids in the amino acid sequence (353DQIHYEDENSRYITIGCVEKPLMML377) of the substrate binding domain shown in GenBank with the number of ACM 89977.1;

the protein derived from α -turpentine synthase MdOSC1 with high activity is obtained by substituting and/or deleting and/or adding one or more amino acids in a catalytic domain amino acid sequence (249LPFHPSKMFCYCRLTYLPMS268) shown in GenBank with the number of ACM 89977.1;

the protein derived from α -balsamic alcohol synthase MdOSC1 with high activity is obtained by substituting and/or deleting and/or adding one or more amino acids in an N-terminal part amino acid sequence (2WKIKFGEGANDPMLFSTNNFHGRQ25) shown in the GenBank number ACM 89977.1.

6. A high copy number plasmid obtained by overexpressing α a key enzyme in the balsamic alcohol synthesis pathway as shown in claims 1-5.

7. Key enzymes that are overexpressed, as shown in claims 1-6, include, but are not limited to, the high activity α -balsamic alcohol synthase mutant shown in claim 5.

8. A recombinant strain constructed by any one of the methods of claims 1 to 7, comprising a α -balsamic alcohol-producing strain, which overexpresses the α -balsamic alcohol synthase mutant with high activity shown in claim 5 and 3-hydroxy-3-methylglutaryl-CoA reductase.

9. A recombinant strain constructed using the method of any one of claims 1-7 comprising integration of a Saccharomyces cerevisiae endogenous diacylglycerol acyltransferase (DGA1) at a high copy site in the genome.

10. A saccharomyces cerevisiae cell factory for efficient production of α -balsamic alcohol, constructed using the method of any one of claims 1-7, comprising integration of saccharomyces cerevisiae endogenous diacylglycerol acyltransferase (DGA1), assembled at a high copy site in the genome, and overexpression of a α -balsamic alcohol synthase mutant with high activity as set forth in claim 5, and 3-hydroxy-3-methylglutaryl-coa reductase.