CN110964761A - Tremella and application thereof - Google Patents
Tremella and application thereof Download PDFInfo
- Publication number
- CN110964761A CN110964761A CN201911283402.6A CN201911283402A CN110964761A CN 110964761 A CN110964761 A CN 110964761A CN 201911283402 A CN201911283402 A CN 201911283402A CN 110964761 A CN110964761 A CN 110964761A
- Authority
- CN
- China
- Prior art keywords
- tremella
- fermentation
- seed
- polysaccharide
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
Abstract
The invention relates to a Tremella (Tremella fuciformis) which is preserved in the China general microbiological culture Collection center of the culture Collection of microorganisms with the preservation number as follows: CGMCC NO. 15684. The invention also provides a method for producing the tremella polysaccharide by fermenting the tremella, the tremella polysaccharide product is obtained by the steps of seed liquid preparation, fermentation culture, post-treatment and the like, the actual yield can reach more than 25g/L, and the total sugar content is more than 85%; because the corn steep liquor which is a byproduct in corn starch processing is used as a main nitrogen source, and the post-treatment alcohol precipitation process adopts a process of firstly concentrating and then adding ethanol for precipitation, compared with the prior art, the ethanol consumption is saved, and the production cost is obviously reduced. The tremella strain related by the invention also has the characteristic of high growth speed, the whole production period is obviously shortened, the production efficiency of tremella polysaccharide is obviously improved, and industrialization of producing the tremella polysaccharide by submerged fermentation of tremella is facilitated.
Description
Technical Field
The invention belongs to the technical field of microbial fermentation, and particularly relates to a tremella and application thereof in preparation of tremella polysaccharide through high-density submerged fermentation.
Background
Tremella Polysaccharide (Tremella Polysaccharide) is an acidic heteropolysaccharide obtained from fruiting bodies of Tremella (Tremella fuciformis Berk), consists of mannose, xylose, glucose, aldehydic acid and a small amount of fucose, takes α (1-3) mannose as a main chain, has the functions of nourishing yin, moistening lung, nourishing stomach, tonifying kidney, tonifying qi and blood and the like, is used for treating various leukopenia, moderate acute myelopathy, chronic persistent hepatitis, chronic active hepatitis and the like, can also be used as an adjuvant drug for patients with chronic tracheitis, chronic pulmonary heart disease and low immune function, and has high clinical use value.
At present, the tremella polysaccharide is mainly obtained through a liquid submerged fermentation way, and industrialization is already realized. Wu Da kang, Zhang Jiu Chun et al explored the shake flask culture conditions for submerged fermentation of Tremella, and increased the yield by adding thickeners, this process added thickeners such as agar, CMS-Na, gelatin, sodium alginate in the fermentation, these thickeners component unit price was higher, is not suitable for large-scale production, and the dry weight of the thallus after 72 hours of fermentation was only 5g/L, low production efficiency, high cost (Tremella submerged fermentation conditions research "food science" 2002, Vol.23 (No. 1), page 64-69).
Chinese patent CN102559802B discloses a method for producing tremella polysaccharide by submerged fermentation of tremella, the dry weight of the fungus can reach 9.5g/L after 72 hours of fermentation, but only about less than 9kg of finished product can be obtained per ton of fermentation liquid, and the production cost is still relatively high.
Chinese patent CN107446825A discloses a strain capable of producing tremella polysaccharide by fermentation, and although the yield reaches 18g/L, because peptone used in the fermentation process is used as a nitrogen source, the nitrogen source cost is high, vitamin B1 needs to be additionally added into a culture medium, and the fermentation process needs to adopt a material fed-batch process, the production control process is complex.
The nitrogen source components of the tremella polysaccharide fermentation medium disclosed in Chinese patent CN109234334A are corn protein powder and nitrate with protein content of more than 60%, the culture period of each stage of seeds is 3-4 days, the final yield of tremella polysaccharide is 12.8g/L, and the production efficiency is low.
In the alcohol precipitation process of the tremella polysaccharide disclosed in the Chinese patent CN107446825A, the ethanol consumption is 2-3 times of the volume of the fermentation liquid, namely the ethanol consumption per ton of the fermentation liquid is 2000-3000L, and the cost is high.
Disclosure of Invention
The invention provides a tremella and a method for preparing tremella polysaccharide by using the tremella to perform high-density submerged fermentation, which can solve one or more of the problems in the prior art.
According to one aspect of the invention, the invention provides a tremella (Tremellafuriformis) which is preserved in China general microbiological culture Collection center (CGMCC) in 2018, 5 and 10 days, and the preservation number is CGMCC No. 15684.
The tremella is in the form that: colony gum, pale yellow-white, about 20mm in diameter; the hyphae can be seen under a microscope to form yeast-like conidia, and the size of the conidia is 4.5-5.5 multiplied by 3.0-3.5 mu m.
The invention provides application of the tremella in preparation of tremella polysaccharide.
The invention provides a method for preparing tremella polysaccharide by carrying out high-density submerged fermentation on the tremella, which comprises the following steps:
(1) and (3) strain culture: inoculating Tremella fuciformis into a seed culture medium, and culturing to obtain a seed solution;
(2) fermentation production: transferring the seed liquid obtained in the step (1) into a fermentation culture medium for fermentation culture to obtain a fermentation liquid;
(3) extraction: after fermentation, the fermentation liquor is concentrated and then added with ethanol for precipitation, after standing and layering, the precipitate is centrifugally taken out, dried and crushed to obtain the tremella polysaccharide.
In some embodiments, the seed medium is prepared from: 5-15 g/L of glucose, 15-30 g/L of sucrose, 0.1-1 g/L of monopotassium phosphate and 5-15 g/L of yeast extract.
In some embodiments, the fermentation medium is prepared from: 20-50 g/L of glucose, 5-30 g/L of sucrose, 0.1-0.8 g/L of monopotassium phosphate, 1.5-5.0 g/L of yeast extract, 0.5-2.0 g/L of urea and 5-20 g/L of corn steep liquor.
The corn steep liquor has solid matter content of over 45%, and is rich in amino acid, polypeptide, nitrogen source, vitamins, biotin and organic acid. The corn steep liquor is used as a main nitrogen source in the production of the tremella polysaccharide, so that the cost of a culture medium can be reduced, meanwhile, the corn steep liquor provides rich vitamins and biotin, the growth speed of strains can be effectively improved, the yield is increased, and the growth period is shortened.
In some embodiments, the seed liquid is prepared as follows:
① transferring Tremella fuciformis to PDA slant culture medium, controlling temperature at 18-25 deg.C, and culturing for 4-7 days to obtain Tremella fuciformis slant strain;
② inoculating the slant strain obtained in ① to a seed culture medium, controlling the temperature to be 18-25 ℃, and performing shake culture for 1-2 days to obtain shake flask seed liquid;
③ inoculating the shake flask seed solution obtained in ② into a seed culture medium, controlling the inoculation amount to be 1% -10%, controlling the temperature to be 18-25 ℃, introducing sterile air, controlling the air flow to be 0.5-1.5 vvm, and culturing for 1-2 days to obtain a first-grade seed solution.
Therefore, the tremella fuciformis strain is subjected to expanded culture.
In some embodiments, the first seed solution may be further expanded and cultured according to step ③, and the obtained first seed solution is expanded and cultured in the seed culture medium for several times according to the same culture method to obtain a second seed solution, a third seed solution, a fourth seed solution and other multi-stage seed solutions, and a suitable seed culture medium is selected for fermentation production according to the growth condition of the strain and the actual production requirement.
In some embodiments, in the fermentation production, the seed solution is transferred into the fermentation medium in an inoculation amount of 5% to 15%, sterile air is introduced, and the air flow: 0.5-1.0 vvm, stirring frequency: 20-25 Hz, 15-55% of DO value is maintained, the temperature is controlled to be 18-25 ℃, and the fermentation period is 68-73 hours. Therefore, excellent environmental conditions are provided for the fermentation of the tremella, the thalli can effectively utilize nutrient finished products in the culture medium, and the growth and the propagation of the thalli are promoted on one hand, and the production of the tremella polysaccharide is also promoted on the other hand.
In some embodiments, the ethanol concentration in step (3) is 95-99%, and the amount of ethanol is 2-3 times of the volume of the concentrated fermentation broth. The fermentation liquor is precipitated by using 95-99% ethanol, the separation effect of the tremella polysaccharide is obvious, and the yield of the tremella polysaccharide can be ensured.
In some embodiments, the fermentation broth is concentrated under reduced pressure to 1/2 to 1/5 of its original volume prior to precipitation with ethanol. Therefore, the consumption of ethanol can be greatly reduced, and the production cost is reduced.
In some embodiments, the precipitate obtained in step (3) is vacuum dried until the loss on drying is below 6%, and pulverized to obtain the final product of the tremella polysaccharide.
The tremella polysaccharide prepared by the tremella strain through high-density submerged fermentation has a yield of above 25g/L, and production efficiency is remarkably improved.
The invention has the beneficial effects that: provides a tremella strain which can grow faster in the seed culture period and can effectively shorten the whole production period. The tremella strain disclosed by the invention can utilize corn steep liquor with lower cost as a main nitrogen source, and high-yield tremella polysaccharide is obtained through fermentation, so that the cost of a culture medium is effectively reduced, the yield is increased, and the growth period is shortened.
In the alcohol precipitation process, the fermentation liquor is concentrated to 1/2-1/5 of the original volume, and then 2-3 times of ethanol is added, the ethanol consumption is reduced by more than 50% compared with the existing process, so that the solvent consumption can be effectively reduced, and the cost is low; meanwhile, the volume of the concentrated fermentation liquor is reduced, and the production efficiency of equipment in a clean area is improved.
The process of the invention does not need material feeding by optimizing the process parameters in the fermentation process, and the production process is simple to operate and easy to control. After fermentation for 72 hours, the dry weight of the thalli can reach more than 26g/L (the actual yield is 25g/L), compared with the prior art, the process provided by the invention has the advantages that the cost is obviously reduced, the production efficiency is obviously improved, and the industrialization degree of the tremella polysaccharide is favorably improved.
Biological preservation Instructions
The Tremella fuciformis (Tremellafuriformis) provided by the invention is preserved in the China general microbiological culture Collection center in 5-10.2018, and the preservation numbers are as follows: CGMCC NO.15684, the preservation address is as follows: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North.
Drawings
FIG. 1 is a colony morphology of Tremella bacteria of the present invention;
FIG. 2 is an electron micrograph of the Tremella fungus shown in FIG. 1.
Detailed Description
The present invention will be described in further detail with reference to examples.
Example 1
The embodiment provides a tremella (Tremellafuriformis) which is preserved in China general microbiological culture Collection center (CGMCC) in 2018, 5 months and 10 days, and the preservation number is CGMCC NO. 15684. The Tremella fuciformis is cultured on a PDA culture medium for 10 days at 25 ℃ in the dark, and the colony is colloidal and pale yellow and white, and has the diameter of 20mm, and is shown in figure 1; the hyphae form yeast-like conidia, the size of the conidia is 4.5-5.5 multiplied by 3.0-3.5 mu m, microscopic pictures are shown in figure 2, the ITS rRNA sequence of the strain is shown in SEQ ID No.1, and the similarity of the ITS sequence with the ITS sequence of Tremella fuciformis in GenBank is 100%.
Example 2
This example provides a method for preparing tremella polysaccharide by high-density submerged fermentation, and the employed strain is tremella (Tremellafuriformis) in example 1.
The specific steps of this example are as follows:
(1) transferring Tremella fuciformis to a PDA slant culture medium, controlling the temperature to be 18 ℃, and culturing for 4 days to obtain Tremella fuciformis slant strains;
(2) inoculating the slant strains of the tremella fuciformis in the step (1) into 1000mL of shake flask seed culture medium, wherein the shake flask seed culture medium is prepared from the following components in parts by weight: 8g/L of glucose, 20g/L of sucrose, 0.5g/L of monopotassium phosphate, 15g/L of yeast extract and the balance of water. Placing on a constant temperature shaking table after inoculation, controlling the temperature at 18 ℃ and the rotating speed at 180rpm, and culturing for 2 days to obtain shaking flask seed liquid;
(3) and (3) inoculating 1L of the shake flask seed liquid in the step (2) into 100L of first-level seed culture medium, wherein the culture medium comprises the following components in percentage by weight: 8g/L of glucose, 20g/L of sucrose, 0.5g/L of monopotassium phosphate and 15g/L of yeast extract. After inoculation, controlling the temperature at 18 ℃, controlling the air flow at 0.75vvm, stirring the mixture at 20Hz, maintaining the DO value at 40%, and culturing for 2 days to obtain a first-stage seed solution;
(4) transferring 100L of the first-stage seed liquid obtained in the step (3) into 2000L of fermentation medium, wherein the ratio of the fermentation medium is as follows: 25g/L of glucose, 5g/L of sucrose, 0.3g/L of monopotassium phosphate, 2.0g/L of yeast extract, 1.5g/L of urea and 15g/L of corn steep liquor. After inoculation, ventilation was controlled: 0.8vvm, stirring frequency 23Hz, maintaining DO value at 35%, and controlling temperature at 18 ℃ for fermentation culture.
(5) After fermentation for 72 hours, the dry weight of the cells in the fermentor was found to be 26.1 g/L. Concentrating the fermentation liquid to 500L, cooling to room temperature, adding 1250L of 95% ethanol, stirring for 2 hr, standing, and layering. And (3) centrifugally drying the precipitate, drying for 7 hours in vacuum, and crushing and weighing until the drying weight loss is 3.1 percent to obtain 53.0kg of tremella polysaccharide finished product, wherein the yield is 25.2g/L, and the total sugar content (calculated by anhydrous glucose) is 86.2 percent.
The tremella strain selected in the fermentation has the advantages of fast growth and short growth period in the seed culture period. After the fermentation stage, a large amount of carbon and nitrogen sources must be provided to obtain rapid proliferation of cells and high yields of tremella polysaccharide. The fermentation medium takes glucose and sucrose as carbon sources and takes yeast extract, urea and corn steep liquor as nitrogen sources. The yeast extract is the same as a nitrogen source in a seed culture medium, so that thalli transferred to a fermentation culture medium can be adapted to a new culture medium as soon as possible. A small amount of urea is used as a quick-acting nitrogen source to provide nutrition for cell proliferation in a short time, and the low-price corn steep liquor not only contains rich amino acid and polypeptide nitrogen source substances, but also contains rich vitamins, biotin and organic acid nutrient components, so that the growth speed of the strain can be effectively increased, the yield is increased, and the growth cycle is shortened.
The strain of example 1 was used for fermentation, and the strain was cultured at 18 ℃ while maintaining the DO value at 35% for 72 hours, after which the dry weight of the cells in the fermentor reached 26g/L or more. The strain has low growth requirement, simple nutritional requirement and strong adaptability. Compared with the prior art, the production efficiency and the yield of the tremella polysaccharide are greatly improved.
Example 3
This example provides a method for preparing tremella polysaccharide by high-density submerged fermentation, and the employed strain is tremella (Tremellafuriformis) in example 1.
The specific steps of this example are as follows:
(1) transferring Tremella fuciformis to a PDA slant culture medium, controlling the temperature to be 25 ℃, and culturing for 7 days to obtain Tremella fuciformis slant strains;
(2) inoculating the tremella slant strains in the step (1) into 6 bottles of 1000mL shake flask seed culture media respectively, wherein the mix ratio of the shake flask seed culture media is as follows: 12g/L of glucose, 15g/L of sucrose, 0.3g/L of monopotassium phosphate and 5g/L of yeast extract. Placing on a constant temperature shaking table after inoculation, controlling the temperature at 25 ℃ and the rotating speed at 180rpm, and culturing for 1 day to obtain a shaking seed solution;
(3) and (3) inoculating 6L of the shake flask seed liquid obtained in the step (2) into 200L of first-level seed culture medium, wherein the first-level seed culture medium is prepared from the following components in parts by weight: 12g/L of glucose, 15g/L of sucrose, 0.3g/L of monopotassium phosphate and 5g/L of yeast extract. After inoculation, introducing sterile air, controlling the temperature to be 25 ℃, stirring frequency to be 25Hz and ventilation volume to be 1.0vvm, and culturing for 1 day to obtain first-grade seed liquid;
(4) and (4) inoculating 200L of the first-stage seed liquid obtained in the step (3) into 2000L of fermentation medium. The proportion of the fermentation medium is as follows: 35g/L of glucose, 25g/L of sucrose, 0.1g/L of monopotassium phosphate, 2.0g/L of yeast extract, 1.5g/L of urea and 12g/L of corn steep liquor. After inoculation, introducing sterile air for culture, wherein the ventilation rate is 0.8vvm, the stirring frequency is 25Hz, the DO value is maintained at 45%, and the temperature is controlled at 25 ℃ for fermentation culture;
(5) after fermentation for 68 hours, the dry weight of the thalli in the fermentation tank is measured to reach 26.4g/L, the growth of the tremella strain selected in the fermentation is faster, the dry weight of the thalli in the obtained fermentation liquor is increased, and the yield of the tremella polysaccharide is improved. Concentrating the fermentation broth to 800L, cooling to room temperature, adding 2400L 95% ethanol, stirring for 1 hr, standing for layering, concentrating the fermentation broth, precipitating with ethanol, reducing ethanol consumption, and shortening extraction time. And (3) centrifugally spin-drying the obtained precipitate, drying for 6 hours in vacuum, crushing and weighing until the drying weight loss is 1.9 percent, so that the weight of the finished tremella polysaccharide product is 55.9kg, the yield is 25.4g/L, and the total sugar content (calculated by anhydrous glucose) is 85.8 percent.
The tremella strain selected in the fermentation has the advantages that the growth is fast in the seed culture period, the growth period is short, glucose and sucrose in a seed culture medium provide sufficient carbon sources for the strain proliferation, yeast extract is used as a main nitrogen source, the nutrition requirement of the strain proliferation is effectively met, the temperature is controlled to be 25 ℃, and the shake flask aeration culture is adopted, so that the strain can be rapidly proliferated in the seed culture period.
After the strain is transferred into a fermentation medium, glucose and sucrose are continuously used as carbon sources, and yeast extract, urea and corn steep liquor are used as nitrogen sources. The carbon source substance is the same as the seed culture medium, and the yeast extract is the same as the nitrogen source in the seed culture medium, so that the thallus transferred to the fermentation culture medium can adapt to a new culture medium as soon as possible, and the growth of the thallus and the synthesis of the tremella polysaccharide are accelerated. The strain in the embodiment 1 is adopted for fermentation, the fermentation temperature is ensured to be proper, air is introduced, the DO value is maintained at 45%, the time of a stable period in the fermentation is prolonged, and the synthesis of the tremella polysaccharide is promoted. After 68 hours, the dry weight of the thalli in the fermentation tank is measured to reach more than 26g/L, and the obtained tremella polysaccharide has high total sugar content and excellent quality.
Example 4
This example provides a method for preparing tremella polysaccharide by high-density submerged fermentation, and the employed strain is tremella (Tremellafuriformis) in example 1.
The specific steps of this example are as follows:
(1) transferring Tremella fuciformis to a PDA slant culture medium, controlling the temperature to be 20 ℃, and culturing for 5 days to obtain Tremella fuciformis slant strains;
(2) inoculating the tremella slant strains obtained in the step (1) into 4 bottles of 1000mL shake flask seed culture media respectively, wherein the ratio of the shake flask seed culture media is as follows: 12g/L of glucose, 30g/L of sucrose, 0.7g/L of monopotassium phosphate and 10g/L of yeast extract. After inoculation, placing on a constant temperature shaking table at the rotating speed of 180 rpm; controlling the temperature to be 20 ℃, and culturing for 2 days to obtain shake flask seed liquid;
(3) and (3) inoculating 4L of shake flask seed liquid in the step (2) into 100L of first-level seed culture medium, wherein the first-level seed culture medium is prepared from the following components in parts by weight: 12g/L of glucose, 30g/L of sucrose, 0.7g/L of monopotassium phosphate and 10g/L of yeast extract. Introducing sterile air after inoculation, wherein the ventilation rate is 0.75vvm, and the temperature is controlled to be 20 ℃, and culturing for 1 day to obtain first-grade seed liquid;
(4) inoculating 100L of the first-stage seed liquid obtained in the step (3) into 2000L of fermentation medium, wherein the fermentation medium comprises the following components in parts by weight: 45g/L of glucose, 5g/L of sucrose, 0.2g/L of monopotassium phosphate, 2.0g/L of yeast extract, 0.5g/L of urea and 20g/L of corn steep liquor. After inoculation, introducing sterile air for culture, wherein the ventilation rate is 0.8vvm, the stirring frequency is 23Hz, the DO value is maintained at 35%, the temperature is controlled at 20 ℃, and fermentation culture is carried out;
(5) after fermentation for 70 hours, the dry weight of the cells in the fermentor was found to be 26.5 g/L. Concentrating the fermentation broth to 500L, cooling to room temperature, adding 1000L of 99% ethanol, stirring for 2 hr, standing for layering, and reducing ethanol consumption and extraction time. And (3) centrifugally drying the precipitate for 5 hours in vacuum, wherein the drying weight loss is 2.6%, crushing and weighing to obtain 57.6kg of tremella polysaccharide finished product, the yield is 26.2g/L, and the total sugar content (calculated by anhydrous glucose) is 85.2%.
The tremella strain selected in the fermentation has the advantages of fast growth and short growth period in the seed culture period. After the strain is transferred into a fermentation medium, glucose and sucrose are used as carbon sources, and yeast extract, urea and corn steep liquor are used as nitrogen sources. Wherein corn steep liquor is used as a main nitrogen source, the dosage is further increased compared with the dosage of the examples 2 and 3, and the dosage of other nitrogen sources is relatively less. The DO value is maintained at 35% in the fermentation process, and after fermentation for 70 hours, the dry weight of the thallus reaches more than 26 g/L. Compared with the prior art, the method not only greatly improves the production efficiency and the yield, but also has the advantage of low cost.
Example 5
This example provides a method for preparing tremella polysaccharide by high-density submerged fermentation, and the employed strain is tremella (Tremellafuriformis) in example 1.
The specific steps of this example are as follows:
(1) transferring Tremella fuciformis to a PDA slant culture medium, controlling the temperature to be 25 ℃, and culturing for 6 days to obtain Tremella fuciformis slant strains;
(2) inoculating the tremella slant strains in the step (1) into 6 bottles of shaking flask seed culture media of 5000mL each, wherein the ratio of the shaking flask seed culture media is as follows: 5g/L of glucose, 30g/L of sucrose, 0.1g/L of monopotassium phosphate and 8g/L of yeast extract. After inoculation, placing the mixture on a constant temperature shaking table, controlling the temperature to be 25 ℃ and the rotating speed to be 180rpm, and culturing for 1.5 days to obtain shake flask seed liquid;
(3) and (3) inoculating 30L of the shake flask seed liquid in the step (2) into 300L of first-level seed culture medium, wherein the first-level seed culture medium is prepared from the following components in parts by weight: 5g/L of glucose, 28g/L of sucrose, 0.1g/L of monopotassium phosphate and 8g/L of yeast extract. After inoculation, introducing sterile air, controlling the temperature at 25 ℃, stirring frequency at 25Hz and ventilation volume at 0.5vvm, and culturing for 1.5 days to obtain first-grade seed liquid;
(4) and (4) inoculating 300L of the primary seed liquid in the step (3) into 2000L of fermentation medium. The proportion of the fermentation medium is as follows: 20g/L of glucose, 30g/L of sucrose, 0.8g/L of monopotassium phosphate, 1.5g/L of yeast extract, 0.8g/L of urea and 20g/L of corn steep liquor. After inoculation, introducing sterile air for culture, wherein the ventilation rate is 0.5vvm, the stirring frequency is 20Hz, the DO value is maintained at 15%, and the temperature is controlled at 25 ℃ for fermentation culture;
(5) after 73 hours of fermentation, the dry weight of the cells in the fermentor was found to be 26.2 g/L. Concentrating the fermentation liquor to 460L, cooling to room temperature, adding 1200L of 98% ethanol, stirring for 1 hour, standing for layering, centrifuging and spin-drying the precipitate, vacuum drying for 6 hours, drying to lose weight by 6%, pulverizing, and weighing to obtain the final product of tremella polysaccharide with weight of 57.7kg, yield of 25.1g/L and total sugar content (calculated by anhydrous glucose) of 85.5%.
The tremella strain selected in the fermentation has the advantages of fast growth and short growth period in the seed culture period. After the strain is transferred into a fermentation medium, glucose and sucrose are used as carbon sources, and yeast extract, urea and corn steep liquor are used as nitrogen sources. Wherein, the yeast extract in the nitrogen source substance is the same as the nitrogen source in the seed culture medium, thus ensuring that the thalli transferred to the fermentation culture medium can adapt to a new culture medium as soon as possible and accelerating the growth of the thalli and the synthesis of the tremella polysaccharide. Sterile air is introduced to maintain the DO value of 15% in the fermentation process, so that a good fermentation environment is provided, and the time for the thalli to enter the decay period is delayed. After fermentation for 73 hours, the dry weight of the thalli reaches more than 26g/L, and compared with the prior art, the production efficiency is greatly improved, and the yield is improved. In addition, the fermentation medium takes corn steep liquor as a main nitrogen source substance, so that the production cost is greatly reduced.
Example 6
This example provides a method for preparing tremella polysaccharide by high-density submerged fermentation, and the employed strain is tremella (Tremellafuriformis) in example 1.
The specific steps of this example are as follows:
(1) transferring Tremella fuciformis to a PDA slant culture medium, controlling the temperature to be 20 ℃, and culturing for 7 days to obtain Tremella fuciformis slant strains;
(2) inoculating the tremella slant strains in the step (1) into 6 bottles of 1000mL shake flask seed culture media respectively, wherein the mix ratio of the shake flask seed culture media is as follows: 20g/L of glucose, 15g/L of sucrose, 1.0g/L of monopotassium phosphate and 12g/L of yeast extract. Placing on a constant temperature shaking table after inoculation, controlling the temperature at 25 ℃ and the rotating speed at 180rpm, and culturing for 1 day to obtain a shaking seed solution;
(3) and (3) inoculating 6L of the shake flask seed liquid obtained in the step (2) into 200L of first-level seed culture medium, wherein the first-level seed culture medium is prepared from the following components in parts by weight: 20g/L of glucose, 18g/L of sucrose, 1.0g/L of monopotassium phosphate and 12g/L of yeast extract. After inoculation, introducing sterile air, controlling the temperature to be 25 ℃, stirring frequency to be 23Hz and ventilation volume to be 1.5vvm, and culturing for 2 days to obtain first-grade seed liquid;
(4) and (4) inoculating 200L of the first-stage seed liquid obtained in the step (3) into 2000L of fermentation medium. The proportion of the fermentation medium is as follows: 50g/L of glucose, 10g/L of sucrose, 0.5g/L of monopotassium phosphate, 5.0g/L of yeast extract, 2.0g/L of urea and 5g/L of corn steep liquor. After inoculation, introducing sterile air for culture, wherein the ventilation rate is 1.0vvm, the stirring frequency is 25Hz, the DO value is maintained at 55%, and the temperature is controlled at 25 ℃ for fermentation culture;
(5) after fermentation for 72 hours, the dry weight of the cells in the fermentor was found to be 26.8 g/L. Concentrating the fermentation liquor to 1100L, cooling to room temperature, adding 2400L of 95% ethanol, stirring for 1 hour, standing for layering, centrifuging and spin-drying the precipitate, vacuum-drying for 6 hours, drying for 2.3% of weight loss, pulverizing, and weighing to obtain the final product of tremella polysaccharide, wherein the weight of the finished product is 56.3kg, the yield is 25.6g/L, and the total sugar content (calculated by anhydrous glucose) is 85.7%.
The tremella strain selected in the fermentation has the advantages of fast growth and short growth period in the seed culture period. After the strain is transferred into a fermentation culture medium, glucose and sucrose are continuously used as carbon sources, yeast extract, urea and corn steep liquor are used as nitrogen sources, the rapid growth of the strain is realized, and the mass synthesis of the tremella polysaccharide is promoted. After fermentation for 72 hours, the dry weight of the cells reached more than 26 g/L. The fermentation liquor is properly concentrated and then the tremella polysaccharide is extracted, and the dosage of ethanol is correspondingly reduced. Compared with the prior art, the method has the advantages of high yield and low cost.
What has been described above are merely some embodiments of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the inventive concept thereof, and these changes and modifications can be made without departing from the spirit and scope of the invention.
Sequence listing
<110> Jiangsu Yuanxianle pharmaceutical Co., Ltd
<120> Tremella fuciformis and application thereof
<130>2019.05.23
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>502
<212> rRNA Gene ITS1-5.8S-ITS2 region sequence
<213> Tremella (Tremella fuciformis)
<400>1
aggccctacctgatttgagg ccagagtgca aagtaaaggg ggttgtgagc ggcccacagt 60
cgacgcgtaa cttacgacgt ctgcgtgaaa ccactaacgc atttaaggcc agccagagag 120
gcagggccca aatccaacac cgccgggtca gaaacccagg gggttgagtc tacatgacac 180
tcaaacaggc atgcctttcg gaataccaaa aggcgcaagg tgcgttcaaa gattcgatga 240
ttcactgaat tctgcaattc acattacttt tcgcaattcg ctgcgttctt catcgatgcg 300
agagccaaga gatccgttgt tgaaagttgt ttcatgttat gatgcattac grrcttgaca 360
tatgtttgtg tgaaggcggc ccggcccggg ggcgcggtcc gatgtgcaca ggtgtttgga 420
agggcctcgt ggcccggtgt aatctcaaat gatccttccg caggttcacc tacggaaacc 480
ttgttacgac ttttacttcc ca 502
Claims (10)
1. A Tremella (Tremella fuciformis) is characterized in that the Tremella is preserved in China general microbiological culture collection center (CGMCC) in 2018, 5 months and 10 days, and the preservation number is CGMCC NO. 15684.
2. Use of a Tremella fungus according to claim 1 for the preparation of Tremella fuciformis sugar.
3. A method for preparing tremella polysaccharide by high-density submerged fermentation, which is characterized in that the tremella strain as claimed in claim 2 is used as a strain, and the method comprises the following steps:
(1) and (3) strain culture: inoculating Tremella fuciformis into a seed culture medium, and culturing to obtain a seed solution;
(2) fermentation production: transferring the seed liquid obtained in the step (1) into a fermentation culture medium for fermentation culture to obtain a fermentation liquid;
(3) extraction: after fermentation, the fermentation liquor is concentrated and then added with ethanol for precipitation, and the precipitate is obtained by centrifugation.
4. The method for preparing tremella polysaccharide by high-density submerged fermentation according to claim 3, wherein the seed culture medium comprises: 5-20 g/L of glucose, 15-30 g/L of sucrose, 0.1-1 g/L of monopotassium phosphate and 5-15 g/L of yeast extract; the proportion of the fermentation medium is as follows: 20-50 g/L of glucose, 5-30 g/L of sucrose, 0.1-0.8 g/L of monopotassium phosphate, 1.5-5.0 g/L of yeast extract, 0.5-2.0 g/L of urea and 5-20 g/L of corn steep liquor.
5. The method for preparing tremella polysaccharide by high-density submerged fermentation according to claim 3, wherein the seed liquid of step (1) is prepared by:
① transferring Tremella fuciformis to PDA slant culture medium, culturing at 18-25 deg.C for 4-7 days to obtain Tremella fuciformis slant strain;
② inoculating the slant strain obtained in ① to a seed culture medium, culturing at 18-25 deg.C for 1-2 days in a shake flask to obtain shake flask seed liquid;
③ inoculating the shake flask seed solution obtained from ② into a seed culture medium, culturing for 1-2 days at 18-25 deg.C and ventilation of 0.5-1.5 vvm to obtain the first-class seed solution.
6. The method for preparing tremella polysaccharide by high-density submerged fermentation as claimed in claim 5, wherein the first seed liquid is further expanded according to step ③.
7. The method for preparing tremella polysaccharide through high-density submerged fermentation according to claim 3, wherein the amount of the seed liquid in step (2) is 5% -15% of the volume of the fermentation medium, the culture conditions after inoculation are that the ventilation amount is 0.5-1.0 vvm, the stirring frequency is 20-25 Hz, the DO value is maintained at 15-55%, the temperature is 18-25 ℃, and the fermentation period is not more than 73 hours.
8. The method for preparing the tremella polysaccharide through the high-density submerged fermentation according to claim 3, wherein the ethanol concentration in the step (3) is 95% -99%, the ethanol dosage is 2-3 times of the volume of the concentrated fermentation liquid, the precipitate obtained in the step (3) is subjected to vacuum drying until the drying weight loss is below 6%, and the finished product of the tremella polysaccharide is obtained after crushing.
9. The method for preparing tremella polysaccharide by high-density submerged fermentation as claimed in claim 8, wherein the fermentation broth is concentrated under reduced pressure to 1/2-1/5 volume before the ethanol extraction.
10. The method according to any one of claims 3 to 9, wherein the yield of tremella sugar is 25g/L or more.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911283402.6A CN110964761B (en) | 2019-12-13 | 2019-12-13 | Tremella and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911283402.6A CN110964761B (en) | 2019-12-13 | 2019-12-13 | Tremella and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110964761A true CN110964761A (en) | 2020-04-07 |
| CN110964761B CN110964761B (en) | 2021-07-30 |
Family
ID=70034321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911283402.6A Active CN110964761B (en) | 2019-12-13 | 2019-12-13 | Tremella and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110964761B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108823109A (en) * | 2018-07-24 | 2018-11-16 | 江苏远大仙乐药业有限公司 | A kind of Mortierella alpine trichoderma strain of high-yield peanut tetraene acid lipid and its application |
| CN111920779A (en) * | 2020-07-20 | 2020-11-13 | 源合盛(吉林)药业有限公司 | Tremella fuciformis polysaccharide capsule medicament and preparation method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20080079962A (en) * | 2007-02-28 | 2008-09-02 | 윤종원 | Hypoglycemic exopolysaccharides from tremella fuciformis mycellium and a preparation method thereof |
| CN102041285A (en) * | 2009-10-20 | 2011-05-04 | 中国石油大学(华东) | Method for fermenting and producing Tremella polysaccharides by adopting constant pH feeding strategy |
| CN102559802A (en) * | 2012-01-09 | 2012-07-11 | 天津超然生物技术有限公司 | Method for preparing high-yield Tremella polysaccharide by adopting culture medium for fermenting |
| CN107446825A (en) * | 2017-09-11 | 2017-12-08 | 华熙福瑞达生物医药有限公司 | One plant of white fungus bacterial strain and its application |
| CN109234334A (en) * | 2018-11-02 | 2019-01-18 | 华熙福瑞达生物医药有限公司 | A kind of method of fermenting and producing tremella polysaccharides and fermentation medium used |
-
2019
- 2019-12-13 CN CN201911283402.6A patent/CN110964761B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20080079962A (en) * | 2007-02-28 | 2008-09-02 | 윤종원 | Hypoglycemic exopolysaccharides from tremella fuciformis mycellium and a preparation method thereof |
| CN102041285A (en) * | 2009-10-20 | 2011-05-04 | 中国石油大学(华东) | Method for fermenting and producing Tremella polysaccharides by adopting constant pH feeding strategy |
| CN102559802A (en) * | 2012-01-09 | 2012-07-11 | 天津超然生物技术有限公司 | Method for preparing high-yield Tremella polysaccharide by adopting culture medium for fermenting |
| CN107446825A (en) * | 2017-09-11 | 2017-12-08 | 华熙福瑞达生物医药有限公司 | One plant of white fungus bacterial strain and its application |
| CN109234334A (en) * | 2018-11-02 | 2019-01-18 | 华熙福瑞达生物医药有限公司 | A kind of method of fermenting and producing tremella polysaccharides and fermentation medium used |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108823109A (en) * | 2018-07-24 | 2018-11-16 | 江苏远大仙乐药业有限公司 | A kind of Mortierella alpine trichoderma strain of high-yield peanut tetraene acid lipid and its application |
| CN111920779A (en) * | 2020-07-20 | 2020-11-13 | 源合盛(吉林)药业有限公司 | Tremella fuciformis polysaccharide capsule medicament and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110964761B (en) | 2021-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108220175B (en) | High-density culture method and pH regulation and control method for saccharomyces cerevisiae | |
| CN100432212C (en) | Grifola frondosa strain, culture method and application thereof | |
| CN109198167B (en) | Feed yeast hydrolysate and preparation method and application thereof | |
| CN102409066A (en) | Fermentation method of citric acid | |
| CN110964761B (en) | Tremella and application thereof | |
| CN105361161A (en) | Making method of cordyceps militaris kiwi enzyme capable of enhancing immunity | |
| CN113498834A (en) | Integrated fermentation method of edible and medicinal fungus fermented beverage | |
| CN109504725B (en) | Method for preparing high-purity hericium erinaceus polysaccharide by fermenting hericium erinaceus and fermentation culture medium | |
| CN113046253B (en) | Culture method for improving heat resistance of kluyveromyces marxianus | |
| CN113502232A (en) | Efficient co-fermentation method for ganoderma lucidum mycelia and hericium erinaceus mycelia | |
| CN116496911B (en) | Ricasfungin intermediate FR901379 high-yield strain and application thereof | |
| CN105614022A (en) | Method for preparing feed additive rich in astaxanthin through co-culture | |
| CN1302101C (en) | Method for producing C. ophioglossouides using liquid submerged culture | |
| CN100335646C (en) | Comprehensive utilization production technology of high content of glossg ganoderma polysaccharide refined powder and its by product | |
| TWI385248B (en) | A formula of culturing medium for cordyceps spp. | |
| CN114276937B (en) | Method for fermenting paecilomyces hepialid by using Chinese yam as carbon source | |
| CN105476001A (en) | Manufacturing method of immunity-improving cordyceps militaris grape enzyme | |
| CN113604390B (en) | Corynebacterium glutamicum and application thereof in fermentation production of L-ornithine | |
| CN112094762B (en) | Corynebacteria vinifera strain and application thereof | |
| CN105433385A (en) | Preparation method of immunity-improving cordyceps militaris and tomato enzyme | |
| CN104498542A (en) | Method for preparing L-lactic acid employing continuous method in fermentation manner | |
| CN116396986B (en) | Application of kluyveromyces lactis in production of squalene | |
| CN111979279B (en) | Method for increasing yield of ganoderma lucidum extracellular polysaccharide | |
| CN105433377A (en) | Preparation method of immunity-improving cordyceps militaris and honey-dew melon enzyme | |
| CN115895957A (en) | Method for efficiently culturing nocardia rubra and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |