CN110951905A

CN110951905A - LAMP primer group, kit and detection method for candida auricula

Info

Publication number: CN110951905A
Application number: CN201911228264.1A
Authority: CN
Inventors: 赵秀英; 张岩; 陈燕旌; 边素莹
Original assignee: Beijing Tsinghua Changgeng Hospital
Current assignee: Beijing Tsinghua Changgeng Hospital
Priority date: 2019-12-04
Filing date: 2019-12-04
Publication date: 2020-04-03

Abstract

The invention relates to an LAMP primer group, a kit and a detection method for candida auricularia. The provided primer group comprises an outer primer, an inner primer and a ring primer, wherein the outer primer is SEQ ID NO. 1-SEQ ID NO. 2, the inner primer is SEQ ID NO. 3-SEQ ID NO. 4, and the ring primer is SEQ ID NO. 5-SEQ ID NO. 6. The provided kit comprises the primer group. The method for detecting the candida auricula comprises the steps of carrying out loop-mediated isothermal nucleic acid amplification reaction on a sample to be detected by utilizing the primer group, and determining whether the sample to be detected is infected with the candida auricula or not based on a reaction result. The primer group provided by the invention is used as LAMP constant temperature amplification primer, has high sensitivity, strong specificity and high repeatability, is applied to the detection of Candida auricular, and has short detection time and convenient detection.

Description

LAMP primer group, kit and detection method for candida auricula

Technical Field

The invention relates to the technical field of biology, in particular to an LAMP primer group, a kit and a detection method for candida auricula.

Background

Candida auricula is a new pathogenic fungus species discovered in 2009 in Japan, has the characteristics of multiple drug resistance, high lethality and the like, and has a great threat to human bodies. The common detection technology for pathogenic microorganisms is to use a fluorescent quantitative PCR instrument for detection, and the method adopts fluorescent dye or fluorescent probe and utilizes a pair of amplification primers to detect a target nucleic acid sequence in a sample. However, the nucleic acid amplification step used in the method needs frequent heating and cooling processes, the time consumed by light detection needs at least more than 1.5h, expensive equipment such as a fluorescent quantitative PCR instrument, an electrophoresis instrument, a sequencer and the like is needed for assisting in result judgment, and the method cannot adapt to simple experimental conditions or the requirement of on-site real-time detection. However, no detection scheme for candida auricula has appeared in China so far.

Loop-mediated isothermal amplification (LAMP) was not t. isothermal amplification was developed in 2000 by the principle of using a strand displacement DNA polymerase (Bst DNApolymerase) and multiple pairs of specific primers to specifically recognize 6 independent regions on a target sequence and complete the amplification reaction under isothermal conditions. In recent years, the technology is gradually applied to detection of pathogenic microorganisms, for example, the application number is 201210093342.6, Chinese patent application with the name of LAMP kit for detecting salmonella paratyphi A, and an LAMP primer combination for detecting salmonella paratyphi A is designed for detecting salmonella paratyphi A. At present, the method is not used for detecting the candida auricula, and a proper and efficient primer is not used for LAMP detection in the field.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, an object of the present invention is to provide a LAMP primer set, a kit and a detection method for detecting Candida auricular.

The invention designs an LAMP primer group applied to candida auricula based on loop-mediated isothermal amplification (LAMP), and the LAMP primer group is applied to the detection of the candida auricula, so that the LAMP primer group has the advantages of high accuracy, good specificity, short detection time and real-time observation of results, and only 1.5 hours are needed from sample treatment to report results, so that the LAMP primer group can be used for on-site real-time detection quickly, simply and later. The LAMP primer for the Candida auricula is verified through design and screening, and can be applied to the detection of the Candida auricula, so that the blank in the detection field at home and abroad can be filled.

Specifically, the invention provides the following technical scheme:

in a first aspect of the invention, the invention provides a primer set for candida auriculata, which comprises an outer primer, an inner primer and a loop primer, wherein the outer primer is SEQ ID NO. 1-SEQ ID NO. 2, the inner primer is SEQ ID NO. 3-SEQ ID NO. 4, and the loop primer is SEQ ID NO. 5-SEQ ID NO. 6. Wherein SEQ ID NO 1-6 are respectively as follows:

outer primer Cau 416-F3: 5'-CCATGCTAACCCTGAAACT-3' (SEQ ID NO:1)

Outer primer Cau 416-B3: 5'-CGAAGATACCACAACAACC-3' (SEQ ID NO:2)

Inner primer Cau 416-FIP:

5’-GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC-3’(SEQ ID NO:3)

inner primer Cau 416-BIP:

5'-CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG-3' (SEQ ID NO:4) Loop primer Cau416-LF 1: 5'-GCAAGCTCAGTAGCCTGGT-3' (SEQ ID NO:5)

The loop primer Cau416-LB 1-2: 5'-TTCCCATTTGCTCAAGAACACT-3' (SEQ ID NO:6)

The primer screened by the invention has high sensitivity and strong specificity, and has the advantages of high accuracy, short detection time, real-time observation of results and the like when being used for detecting the candida auricular.

In some embodiments of the invention, the primer set is used for specific amplification of a putative protein of the candida auriculae.

In some embodiments of the invention, the molar ratio of the outer primer, the inner primer and the loop primer is 5-40: 2000-3000: 300-500. Thus can be used for the specific amplification of the candida auriculae.

In some embodiments of the invention, the primer set comprises 0.12. mu.L each of 0.3. mu.M of the outer primer SEQ ID NO. 1 and 0.3. mu.M of the outer primer SEQ ID NO. 2; mu.L of each of 2.4. mu.M inner primer SEQ ID NO 3 and 2.4. mu.M inner primer SEQ ID NO 4; mu.L of each of 1. mu.M loop primer SEQ ID NO 5 and 1. mu.M loop primer SEQ ID NO 6. Under the concentration and the proportion of the primer, the method can be used for the specific amplification of the candida auricula, realizes the specific detection of the candida auricula and obtains high sensitivity.

In a second aspect of the invention, the invention provides a use of a primer group in preparation of a reagent or a kit for detecting candida auricula.

In a third aspect of the present invention, the present invention provides a reagent comprising the primer set according to the first aspect of the present invention.

In a fourth aspect of the present invention, there is provided a kit comprising a primer set according to the first aspect of the present invention.

According to an embodiment of the present invention, the kit described above may further comprise the following technical features:

in some embodiments of the invention, the kit further comprises a DNA polymerase, a LAMP reaction solution, a positive control, and a negative control.

In some embodiments of the invention, the LAMP reaction solution is a LAMP reaction solution commonly used in the field, and can provide a reaction environment for LAMP reaction. The LAMP reaction solution can be prepared by itself or can be directly purchased and obtained. For example, commercial products manufactured by boao organisms may be purchased.

In some embodiments of the invention, the DNA polymerase is Bst DNA polymerase.

In some embodiments of the invention, the positive control is a plasmid containing candida otic nucleic acid DNA. The Candida auricular nucleic acid DNA can be a putative protein gene from Candida auricular, and can be a sequence shown as SEQ ID NO. 7, for example. The Candida auricular nucleic acid DNA can be introduced into a plasmid by a technique commonly used in the art to obtain a plasmid containing the Candida auricular nucleic acid DNA.

In some embodiments of the invention, the negative control is sterilized water.

In a fifth aspect of the invention, the invention provides a method for detecting candida auricula, comprising: the primer group of the first aspect of the invention is utilized to carry out loop-mediated isothermal nucleic acid amplification reaction on a sample to be detected, and whether the sample to be detected is infected with the candida auricular is determined based on a reaction result. The primer group provided by the invention is used for carrying out loop-mediated isothermal nucleic acid amplification reaction on a sample to be detected, is simple to operate, has higher specificity than other PCR methods, and can complete detection within 1 hour.

In some embodiments of the present invention, the loop-mediated isothermal nucleic acid amplification reaction condition is a reaction at 65 ℃ for 50 minutes to 1 hour.

In some embodiments of the invention, the method further comprises: determining the reaction result through real-time fluorescence quantification, and determining whether the sample to be detected is infected with the candida auricula or not based on a Ct value, wherein the reaction result comprises the following steps: 1) if Ct is less than or equal to 30, judging that the sample to be detected is infected with candida auricular; 2) if Ct is more than 45, judging that the sample to be detected is not infected with candida auriculata; 3) if Ct is more than 30 and less than or equal to 45, performing loop-mediated isothermal nucleic acid amplification reaction, determining the Ct value through real-time fluorescence quantification, if Ct is less than or equal to 45, judging that the sample to be detected is infected with candida auricular, otherwise, judging that the sample to be detected is not infected with candida auricular. Therefore, whether the sample to be detected is infected with the candida auricular can be accurately judged. The method may be used for non-diagnostic purposes, for example, it may be used for scientific or other research purposes.

Drawings

FIG. 1 is a graph showing the results of fluorescence detection by primary screening using a first set of LAMP primers according to an embodiment of the present invention.

FIG. 2 is a graph showing the results of fluorescence detection by primary screening using a first set of LAMP primers according to an embodiment of the present invention.

FIG. 3 is a graph showing the results of fluorescence detection by primary screening using a first set of LAMP primers according to an embodiment of the present invention.

FIG. 4 is a graph showing the results of fluorescence detection by primary screening using a second set of LAMP primers according to the present invention.

FIG. 5 is a graph showing the results of fluorescence detection by primary screening using a third set of LAMP primers according to the present invention.

FIG. 6 is a graph showing the results of fluorescence detection by primary screening using a fourth set of LAMP primers according to the present invention.

FIG. 7 is a graph showing the results of fluorescence detection by primary screening using a fifth set of LAMP primers according to the present invention.

FIG. 8 is a graph showing the results of fluorescence detection by rescreening with the first set of LAMP primers according to the present invention.

FIG. 9 is a graph showing the results of fluorescence detection of the negative control provided in accordance with the embodiment of the present invention.

FIG. 10 is a graph showing the results of fluorescence detection of different strains using a first set of LAMP primers, provided in accordance with an embodiment of the present invention.

FIG. 11 is a graph showing the results of sensitivity detection using the first set of LAMP primers according to the embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. It should be noted that the described embodiments are exemplary and are intended to be illustrative of the invention, and should not be construed as limiting the invention.

The invention provides a primer group for candida auriculata, which comprises an outer primer, an inner primer and a ring primer, wherein the outer primer is SEQ ID NO. 1-SEQ ID NO. 2, the inner primer is SEQ ID NO. 3-SEQ ID NO. 4, and the ring primer is SEQ ID NO. 5-SEQ ID NO: 6. the provided primer set can be used for specific amplification of the putative protein in Candida auricular.

In at least some embodiments of the invention, SEQ ID NOs 1 to 6 of the primer set may be mixed in the following ratio: 0.3. mu.M of each of the outer primers Cau416-F3 and Cau416-B3, 0.12. mu.L; 2.4. mu.M of each of the inner primers Cau416-FIP and Cau416-BIP was 0.96. mu.L; mu.L of each of 1. mu.M loop primer Cau416-LF1 and loop primer Cau416-LB1-2 was 0.4. mu.L.

The invention also provides a kit, which comprises the primer group and a plurality of reagents matched with the primer group. Such as LAMP reaction solution (which may contain DNA polymerase), positive control (plasmid containing Candida auricular nucleic acid DNA), and/or negative control (sterilized water). These reagents may be prepared by themselves or may be obtained directly by purchasing commercially available reagents.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

Example 1 LAMP primers were designed for candida auriculata and the performance of the designed LAMP primers was verified. Common microorganisms, there are a large number of literature reports of genes that can be adapted for their detection; however, the research and detection of candida auricula are very few, and no reported detection gene suitable for candida auricula exists, which undoubtedly increases the difficulty of successful design of the primer for detecting candida auricula.

How to select a detection Gene capable of being used for candida auricula is to determine whether the Gene has basic conditions for detecting the Gene, namely to ensure that the selected Gene has good conservation degree (high coverage degree) in the species and also ensure that the Gene has no overhigh similarity (high specificity) with other species, the inventor finally determines the Gene of the LAMP Primer protected in the invention by searching candida auricular Gene sequences recorded in an NCBI Gene library, a Genemo library and an NT library, excluding sequences which are not thoroughly researched and have incomplete fragments and analyzing only sequences which are thoroughly researched and have complete fragments, designs the LAMP Primer in a Primer Explorer V4 according to the Gene and obtains the proper LAMP Primer by later-stage manual adjustment (partial sequence position).

The method specifically comprises the following steps:

1. determination of test genes and sequences

The gene for detecting the candida auricula is determined to be a hypothetical protein through literature research, the full length of the gene is about 3300bp, the conservation degree is high, the specificity is good, and the sequence similarity of the species with the highest similarity is only 81 percent after comparison.

The sequence of the putative protein gene is a collection sequence, which is recorded in the NT database of NCBI with the website of https:// www.ncbi.nlm.nih.gov/nucleotide/.

The partial sequence of the putative protein gene is shown in SEQ ID NO: 7:

GTATGTGGGCCATGCTAACCCTGAAACTGTTTTTGTCGCTTTTGGTGCTCACCAGGCTACTGAGCTTGCTGGTGTCATCTCCAAGGCCTCGGTTTCCTCTCCTGTTGGTTTGGTTAAGGTCAGGGTTCCTTTCCCATTTGCTCAAGAACACTTCGTGGCTTCTGTGCCTTCGTCTGCACGCAAGGTTGTTGTGGTATCTTCGGATGCTGGCTCAACCTTGAAGGCTGACGTTGCTGCTTCGTTGTTCCTCGCTGGCCGTTTCGGTTCTGTTTCTGTGGAGGAGTTTGTCCACCCAGCCAACTTTGTGTGGGCGCCAATCCCAGCATTAAAGGTGATTTCAGAGTATGAAGCATCCGTTGATCCTGCTGTAGTGTTGGCTTCAACTCCCGTGGAGCCACCTGCTCATGTCACCGCCAACACCTCCCCAGAAGGTTCCTACTTATTGTGGGCCCGTGACAACAGTAACCTTGTGAACACTGCTAGCAAGTTGGCTCTTTCTTTGTCTTTGGACGATACGAAAAAGGTCAGCCTCAGAAACAAGTTTGATACAACTGTCGCTGGTGGTATTTTGCAGTCTCAAG

2. LAMP primer design

LAMP primers were designed for the above sequence SEQ ID NO. 7 using Primer Explorer V4. Wherein the designed first set of LAMP primer sequences are as follows:

outer primer Cau 416-F3: 5'-CCATGCTAACCCTGAAACT-3' (SEQ ID NO:1)

Outer primer Cau 416-B3: 5'-CGAAGATACCACAACAACC-3' (SEQ ID NO:2)

Inner primer Cau 416-FIP: 5'-GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC-3' (SEQID NO:3)

Inner primer Cau 416-BIP: 5'-CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG-3' (SEQID NO:4)

Loop primer Cau416-LF 1: 5'-GCAAGCTCAGTAGCCTGGT-3' (SEQ ID NO:5)

The loop primer Cau416-LB 1-2: 5'-TTCCCATTTGCTCAAGAACACT-3' (SEQ ID NO: 6).

Meanwhile, other sets of LAMP primers are designed, wherein the LAMP primers are taken as examples and are shown in the following table 1:

TABLE 1 different LAMP primers

In Table 1, the primer numbers shown with "F3 and B3" represent outer primers, those with "FIP and BIP" represent inner primers, and those with "LF and LB" represent loop primers. The fifth set of primers differs from the first set of primers by only one of the loop primers.

3. The performance of the LAMP primer is verified:

(1) primary screening of LAMP primers

And (3) verifying the performance of the LAMP primer designed in the step (2). The method comprises the following steps:

preparation of primers: each designed primer sequence was synthesized by Biotech. Simultaneously preparing an LAMP detection system, specifically 0.12 mu L of each of 0.3 mu M outer primers F3 and B3; 2.4 mu M of each of the inner primers FIP and BIP is 0.96 mu L; 0.4. mu.L of each of 1. mu.M loop primers LF and LB; 10 mu L of LAMP reaction solution; mu.L of template DNA (the template DNA is plasmid DNA containing SEQ ID NO:7 sequence, and is obtained by introducing exogenous gene sequence SEQ ID NO:7 into plasmid by the conventional technology in the field), and adding sterilized purified water to 20. mu.L system. Wherein the LAMP reaction solution is commercially available and is a commercialized product manufactured by Boo organisms.

The sensitivity of the primers was examined by using the copy numbers of the template DNA of 1000 copies/. mu.L, 500 copies/. mu.L and 100 copies/. mu.L, respectively (3 times for each concentration), and the presence or absence of non-specific amplification of the primers was examined by using the nucleic acid-free water in place of the template DNA (3 times for repetition). And (3) reacting the detection system at 65 ℃ for 50min by using an ABI 7500 reaction instrument to obtain a fluorescence detection result.

Wherein FIGS. 1-3 are fluorescence measurements obtained using a first set of primers and different copy numbers of template DNA. Wherein FIG. 1 is a result of fluorescence detection obtained using 1000 copies/. mu.L of template DNA, FIG. 2 is a result of fluorescence detection obtained using 500 copies/. mu.L of template DNA, and FIG. 3 is a result of fluorescence detection obtained using 100 copies/. mu.L of template DNA.

FIG. 4 is a result of fluorescence detection obtained using a second set of primers and a template DNA having a copy number of 1000 copies/. mu.L, FIG. 5 is a result of fluorescence detection obtained using a third set of primers and a template DNA having a copy number of 1000 copies/. mu.L, FIG. 6 is a result of fluorescence detection obtained using a fourth set of primers and a template DNA having a copy number of 1000 copies/. mu.L, and FIG. 7 is a result of fluorescence detection obtained using a fifth set of primers and a template DNA having a copy number of 1000 copies/. mu.L.

The experimental result shows that the first set of primers can be used for obtaining a detection result with high sensitivity and good specificity.

Further performance verification is carried out on the screened primary screening primers (SEQ ID NO: 1-SEQ ID NO:6) with high sensitivity and good specificity.

(2) Double screening of LAMP primers

And (3) performing secondary screening on the first set of LAMP primers for the Candida auriculata obtained by primary screening, and determining the lower detection limit and whether non-specific amplification exists. The LAMP detection system used is the same as the preliminary screening step.

Using template DNA with the concentration of 500 copies/. mu.L to investigate the repeatability of the primer under detection, and repeating for 20 times; the primers were examined for the presence of non-specific amplification using water and repeated 12 times. The reaction temperature is 65 ℃, the reaction time is 50min, and the reaction apparatus is ABI 7500.

The results of the rescreening are shown in FIGS. 8 and 9. Wherein FIG. 8 shows the results of fluorescence detection obtained using 500 copies/. mu.L of template DNA, repeated 20 times. FIG. 9 shows the fluorescence detection results obtained with the negative control (i.e., sterilized water without nucleic acid instead of the template DNA) under the same detection system.

The experimental result shows that the LAMP primer is used for detecting the candida auricula, the specificity is good, the sensitivity is high, and non-specific amplification does not exist.

Example 2 specificity test

LAMP detection was performed on 1 strain of plasmid DNA containing a gene fragment to be detected of Candida auricular (SEQ ID NO:7), 1 strain of Candida auricular, and 6 other bacterial species using a first set of LAMP primers, as shown in Table 2.

The LAMP reaction result was judged as follows.

The phenomenon that the result is judged to be positive reaction is as follows: and (3) amplifying by adopting a real-time fluorescence PCR instrument, wherein the reaction time is 50min, and observing a real-time fluorescence curve and the peak-off time thereof. And (4) performing a negative control test by using the sterilized purified water, wherein the negative control test result is negative.

1) If the Ct is less than or equal to 30, judging that the LAMP test result is positive;

2) if Ct is more than 45, judging that the LAMP test result is negative;

3) if Ct is more than 30 and less than or equal to 45, the LAMP test result is judged to be suspicious, and a new experiment is needed;

4) and (4) after re-testing the suspicious result, if the Ct is less than or equal to 45, judging that the LAMP test result is positive, otherwise, judging that the LAMP test result is negative.

The results are shown in fig. 10 and table 2 below. No other Candida albicans was detected within 50min of the reaction (no real-time fluorescence curve), indicating a negative reaction. Wherein, in FIG. 10, the reference numeral 1 represents the fluorescence detection result of the plasmid DNA containing the gene fragment to be detected of Candida auriculae (SEQ ID NO:7), the reference numeral 2 represents the fluorescence detection result of Candida auriculae, and other curves which are basically identical to straight lines and are overlapped represent the fluorescence detection results of negative control and other strains.

TABLE 2 test strains and LAMP detection results

Note: ATCC (american ATCC deposit management center); CGMCC (China general microbiological culture Collection center); CMCC (China center for culture Collection of microorganisms); CICC (China center for preservation and management of industrial microbial strains)

EXAMPLE 3 sensitivity test

Inoculating plasmid bacterial liquid containing a gene fragment to be detected of candida auricula (SEQ ID NO:7) into an LB liquid culture medium containing ampicillin (concentration ratio is 1:1000), normally culturing for 16h, taking 1mL of the bacterial liquid containing the LB culture medium containing ampicillin, extracting plasmid DNA (Kangji plasmid DNA miniprep kit) according to a method of a kit specification, and determining the concentration and purity of the plasmid DNA by adopting a NanoDrop2000C ultramicro spectrophotometer. Meanwhile, the extracted nucleic acid DNA was quantified using an Invitrogen Qubit 2.0 fluorescence quantifier and an Invitrogen Qubit quantitative detection kit, and the copy number was calculated. Finally, the LAMP test method of the present invention is used to measure the DNA sample.

When the copy number of the plasmid DNA containing the gene fragment to be detected of Candida auricular is 500 copy/. mu.l, the reaction shows a positive result, and the interpretation time is less than 30min (the actually measured Ct value is 19.6min), as shown in FIG. 11.

Therefore, the detection sensitivity of the LAMP detection method qualitative test adopted by the invention can reach 500copy number/muL (DNA concentration).

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Beijing Qinghua Changheptyl Hospital

<120> LAMP primer group, kit and detection method for candida auriculata

<130>PIDC3194528

<160>26

<170>PatentIn version 3.5

<210>1

<211>19

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>1

ccatgctaac cctgaaact 19

<210>2

<211>19

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>2

cgaagatacc acaacaacc 19

<210>3

<211>40

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>3

ggccttggag atgacaccat ttttgtcgct tttggtgctc 40

<210>4

<211>42

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>4

ctcctgttgg tttggttaag gtcagttgcg tgcagacgaa gg 42

<210>5

<211>19

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>5

gcaagctcag tagcctggt 19

<210>6

<211>22

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>6

ttcccatttg ctcaagaaca ct 22

<210>7

<211>581

<212>DNA

<213>Artificial Sequence

<220>

<223> putative protein Gene

<400>7

gtatgtgggc catgctaacc ctgaaactgt ttttgtcgct tttggtgctc accaggctac 60

tgagcttgct ggtgtcatct ccaaggcctc ggtttcctct cctgttggtt tggttaaggt 120

cagggttcct ttcccatttg ctcaagaaca cttcgtggct tctgtgcctt cgtctgcacg 180

caaggttgtt gtggtatctt cggatgctgg ctcaaccttg aaggctgacg ttgctgcttc 240

gttgttcctc gctggccgtt tcggttctgt ttctgtggag gagtttgtcc acccagccaa 300

ctttgtgtgg gcgccaatcc cagcattaaa ggtgatttca gagtatgaag catccgttga 360

tcctgctgta gtgttggctt caactcccgt ggagccacct gctcatgtca ccgccaacac 420

ctccccagaa ggttcctact tattgtgggc ccgtgacaac agtaaccttg tgaacactgc 480

tagcaagttg gctctttctt tgtctttgga cgatacgaaa aaggtcagcc tcagaaacaa 540

gtttgataca actgtcgctg gtggtatttt gcagtctcaa g 581

<210>8

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>8

tttcttgggt aagcctcc 18

<210>9

<211>17

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>9

gccgaactgt ggtctgg 17

<210>10

<211>45

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>10

ggccaatttc tccaaagcag aacgaaagcg tttctacgaa tccct 45

<210>11

<211>41

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>11

agtgctgctg gtgctgaaga tggaactcct ccaagatgtc a 41

<210>12

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>12

tctgtggcat gctcagca 18

<210>13

<211>22

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>13

tgaagaagag acaagaggtc ga 22

<210>14

<211>17

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>14

agcctccaaa gcgtttc 17

<210>15

<211>17

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>15

gccgaactgt ggtctgg 17

<210>16

<211>42

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>16

ggccaatttc tccaaagcag aactacgaat cccttgctga gc 42

<210>17

<211>41

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>17

agtgctgctg gtgctgaaga tggaactcct ccaagatgtc a 41

<210>18

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>18

gctccttttc gtctgtggca t 21

<210>19

<211>23

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>19

gttgaagaag agacaagagg tcg 23

<210>20

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>20

gagttttacg gtgttgatgg 20

<210>21

<211>17

<212>DNA

<213>Artificial Sequence

<220>

<223> outer primer

<400>21

ctccaaagca gaacgct 17

<210>22

<211>44

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>22

cctgtctagc agatctaatc tccaagactc attggtcgag gtca 44

<210>23

<211>44

<212>DNA

<213>Artificial Sequence

<220>

<223> inner primer

<400>23

tgactgagaa tgttgatttc ttgggccttt tcgtctgtgg catg 44

<210>24

<211>19

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>24

tcttctctgg ctggtcacg 19

<210>25

<211>23

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>25

gggttccttc tacttgtgtg gtc 23

<210>26

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223> Loop primer

<400>26

ggttcctttc ccatttgctc a 21

Claims

1. A primer group for Candida auricular is characterized by comprising an outer primer, an inner primer and a loop primer, wherein the outer primer is SEQ ID NO. 1-SEQ ID NO. 2, the inner primer is SEQ ID NO. 3-SEQ ID NO. 4, and the loop primer is SEQ ID NO. 5-SEQ ID NO. 6.

2. The primer set of claim 1, wherein the primer set is used for specific amplification of a putative protein of Candida auricular.

3. The primer set according to claim 1, wherein the molar ratio of the outer primer, the inner primer and the loop primer is 5-40: 2000-3000: 300-500.

4. The primer set according to claim 1, wherein the primer set comprises:

0.3. mu.M of each of SEQ ID NO 1 and SEQ ID NO 2 in an amount of 0.12. mu.L;

2.4 μ M of SEQ ID NO 3 and SEQ ID NO:4 each 0.96 mu L; and

mu.L of each of SEQ ID NO 5 and SEQ ID NO 6 at 1. mu.M.

5. Use of the primer set of any one of claims 1 to 4 in preparation of a reagent or a kit for detecting Candida auricular.

6. A reagent comprising the primer set according to any one of claims 1 to 4.

7. A kit comprising the primer set according to any one of claims 1 to 4.

8. The kit according to claim 7, wherein the kit further comprises a DNA polymerase, a LAMP reaction solution, a positive control and a negative control;

optionally, the DNA polymerase is Bst DNA polymerase;

the positive control substance is a plasmid containing candida auricula nucleic acid DNA;

the negative control substance is sterilized water.

9. A method of detecting candida auricula, comprising:

performing a loop-mediated isothermal nucleic acid amplification reaction on a sample to be detected by using the primer set according to any one of claims 1-3, and determining whether the sample to be detected is infected with the candida auricular bacteria or not based on the reaction result;

optionally, the loop-mediated isothermal nucleic acid amplification reaction condition is that the reaction is carried out at 65 ℃ for 50 minutes to 1 hour.

10. The method of claim 9, further comprising: determining the reaction result through real-time fluorescence quantification, and determining whether the sample to be detected is infected with the candida auricula or not based on a Ct value, wherein the reaction result comprises the following steps:

1) if Ct is less than or equal to 30, judging that the sample to be detected is infected with candida auricular;

2) if Ct is more than 45, judging that the sample to be detected is not infected with candida auriculata;

3) if Ct is more than 30 and less than or equal to 45, performing loop-mediated isothermal nucleic acid amplification reaction, determining the Ct value through real-time fluorescence quantification, if Ct is less than or equal to 45, judging that the sample to be detected is infected with candida auricular, otherwise, judging that the sample to be detected is not infected with candida auricular.