CN110951808B

CN110951808B - Method for preparing high-F-value oligopeptide by using chlorella powder as raw material

Info

Publication number: CN110951808B
Application number: CN201911248946.9A
Authority: CN
Inventors: 熊科; 柳佳芸; 邓蕾; 裴鹏钢
Original assignee: Beijing Technology and Business University
Current assignee: Beijing Technology and Business University
Priority date: 2019-12-09
Filing date: 2019-12-09
Publication date: 2020-06-30
Anticipated expiration: 2039-12-09
Also published as: CN110951808A

Abstract

The invention provides a method for preparing high F value oligopeptide by using chlorella powder as a raw material, which comprises the following steps: adding trypsin into chlorella protein at pH 8-10 and temperature 27-52 ℃ according to 70000 and 90000U/mg protein to carry out first-step enzymolysis; then, carrying out further enzymolysis by using recombinant carboxypeptidase derived from aspergillus niger under the conditions of: pH 6.5-7.5, enzyme adding amount is 3% -7% of protein amount; the enzymolysis temperature is 27-40 ℃; and then adjusting the pH value to 4.5, adding activated carbon according to the solid-to-liquid ratio of 1:10 to remove impurities, and filtering to obtain the oligopeptide solution with the high F value. The method for preparing the oligopeptide with the high F value, which is provided by the invention, takes the chlorella as a raw material, has high protein content, low cost and high yield. The method is favorable for improving the F value of the product, reducing the production cost of an enzyme method, reducing the energy consumption in the later purification process, reducing the environmental pollution and realizing the industrial production application of efficiently preparing the high-F value oligopeptide.

Description

Method for preparing high-F-value oligopeptide by using chlorella powder as raw material

Technical Field

The invention belongs to the field of protein preparation, and particularly relates to a method for preparing high-F-value oligopeptide.

Background

Chlorella, the most productive of the world's microalgae industry (c)Chlorella vulgaris) The marine organism biomass-rich protein has the characteristics of wide distribution, large biomass, easy acquisition and the like, is a high-protein marine organism, and has various high-benefit use values which are not developed yet. Common Chlorella vulgaris in China (C.vulgaris) Chlorella pyrenoidosa (C. pyrenoidosa) ((C. pyrenoidosa))Chlorella pyrenidosa) Chlorella ellipsoidea (I)C.ellipsoidea) And the like. The protein content of the chlorella pyrenoidosa powder is as high as 63.36% -63.98%. Contains 8 Essential Amino Acids (EAA), the content of the EAA reaches 23.35%, the Amino Acid Score (AAS) is 64.3, and the EAA is superior to that of a common vegetable protein source; the average food intake rate of the microorganism reaches the FAO/WHO standard, and can completely meet the protein mode required by the growth of human and animals, and the chlorella powder is a high-quality single-cell protein source with rich nutrition and comprehensiveness. According to the regulations of the food safety law of the people's republic of China and the new resource food management method (No. 19 of the ministry of health bulletin 2012), the chlorella pyrenoidosa has been approved as a new resource food in 2012.

The protein-based chlorella powder has the characteristics of high protein content, low cost, high yield and the like, and can be considered to be developed and used for preparing bioactive peptides with specific functions. Wherein the oligopeptide with high F value is a small peptide system consisting of high branched chain amino acid content and low aromatic amino acid content. It has received a high degree of attention from the food and medical community because of its unique amino acid composition and physiological function.

The high F value oligopeptide is a mixed small peptide system mainly composed of 2 to 10 amino acids, and the F value (the molar ratio of branched chain amino acid to aromatic amino acid content) of the high F value oligopeptide is generally more than 20. Due to the unique amino acid composition, the high F value oligopeptide has various physiological effects. It has the physiological functions of resisting oxidation, preventing senility, protecting liver, treating hepatic encephalopathy and treating phenylketonuria. Has good conditioning effect on sub-health state of chronic fatigue syndrome. At present, the methods for preparing functional polypeptide at home and abroad include separation and extraction of natural active peptide, chemical synthesis and other methods. The method for separating and extracting the natural active peptide has the characteristics of high efficiency, low toxicity, no pollution and the like, but the content of the biological active peptide in an organism is generally trace, and the cost and the process for separating and purifying the active peptide from the natural organism are higher and not complete at present. As a new preparation method of bioactive peptides, the chemical synthesis method is immature in current research, and has the defects of short synthetic sequence, low efficiency, low purity, high cost, high toxicity and the like. The researchers also propose a gene recombination method to prepare the active peptide, but the method is still imperfect, and has the disadvantages of difficult modification after translation, easy formation of inclusion bodies and the like.

Disclosure of Invention

Aiming at the problems existing in the preparation of high F value oligopeptide by an enzyme method, the invention provides a method for preparing the high F value oligopeptide by using chlorella as a raw material, and the method has the advantages of mild production conditions, high peptide product safety and high function specificity.

In order to achieve the purpose, the invention adopts the following technical scheme.

A method for preparing high F value oligopeptide by using chlorella as a raw material comprises the following steps:

(1) hydrolyzing chlorella protein with endopeptidase to obtain enzymolysis solution I;

(2) carrying out enzymolysis on the enzymolysis liquid I by using carboxypeptidase, adsorbing and removing impurities by using activated carbon to obtain a high-F-value oligopeptide solution, and drying to obtain high-F-value oligopeptide;

the amino acid sequence of the carboxypeptidase is shown in

SEQ ID NO

1 or 2.

In the step (1), the chlorella protein extraction step comprises: adding water into Chlorella powder to obtain suspension, adding NaOH, ultrasonic extracting, adjusting the extractive solution to neutrality, performing solid-liquid separation to obtain protein solution, and precipitating with ethanol to obtain Chlorella protein. Preferably, the ratio of the mass of the chlorella powder in the suspension to the volume of water is 1: 30-50. NaOH is added into the chlorella suspension with the mass accounting for 1-7% of the volume of the chlorella suspension; more preferably 3% to 6%. For the convenience of the process, NaOH and water in the suspension can be prepared into NaOH solution, and chlorella can be directly added to prepare the suspension. The extraction temperature is 20-70 deg.C; more preferably 20-40 deg.c. The extraction time is 30-75 min. More preferably, the chlorella suspension is swollen for 12-24h and then extracted.

In the step (1), the endopeptidase is trypsin. The amount of enzyme added was 70000-90000U/mg protein. Preferably, the enzymolysis conditions are as follows: the pH value is 8-10; the temperature is 27-52 ℃, preferably 42-52 ℃.

In the step (2), the enzymolysis conditions of the carboxypeptidase are as follows: pH 6.5-7.5, enzyme adding amount is 3% -7% of chlorella protein amount; the enzymolysis temperature is 27-40 ℃.

The invention has the following advantages:

the method for preparing the oligopeptide with the high F value, which is provided by the invention, takes the chlorella as a raw material, has high protein content, low cost and high yield. The chlorella protein extracted by sequentially hydrolyzing the crude enzyme liquid of the trypsin and the carboxypeptidase expressed by prokaryotic recombination has the advantages of mild production conditions, high safety, good solubility, stability, functional specificity and the like. The method is beneficial to improving the F value of the product, reducing the production cost of an enzyme method, reducing the energy consumption in the later purification process, reducing the environmental pollution and realizing the industrial production application of efficiently preparing the high-F value oligopeptide.

Biological preservation information

Aspergillus nigerAspergillus niger) In 2019, 11 and 06 monthsThe general microbiological culture Collection center (CGMCC) has a preservation address of No. 3 Xilu No. 1 of Beijing, Chaozhou, Chaoyang, China and a preservation number of CGMCC number 18828.

Drawings

FIG. 1 is a gel electrophoresis picture of PCR products of CPA gene;

FIG. 2 is an agarose gel electrophoresis image of the procedure for constructing the Y206S and S135G mutants;

FIG. 3 is a SDS-PAGE electrophoresis of a crude recombinase enzyme solution;

FIG. 4 shows the protein extraction rate at different feed-to-liquid ratios;

FIG. 5 shows the protein extraction yields for different amounts of sodium hydroxide added;

FIG. 6 shows the protein extraction at different temperatures;

FIG. 7 shows the protein extraction yield at different extraction temperatures;

FIG. 8 is a graph of the degree of hydrolysis of trypsin and alkaline proteolytic Chlorella protein;

FIG. 9 shows the degree of hydrolysis of chlorella protein at various pH;

FIG. 10 shows the degree of hydrolysis of chlorella protein at different temperatures;

FIG. 11 shows the degree of hydrolysis of chlorella protein at different times;

FIG. 12 shows the degree of hydrolysis of chlorella protein at different enzyme additions;

FIG. 13 shows F values of the oligopeptide products formed after different enzyme treatments.

Detailed Description

The present invention will be further described with reference to the following examples and drawings, but the present invention is not limited to the following examples.

Example 1 obtaining of recombinant Carboxypeptidase (CPA)

1. Cloning of Aspergillus niger M00988CPA and construction of expression vector

Two pairs of primers CPA-F/CPA-R are designed according to the sequence of carboxypeptidase gene of NCBI Aspergillus niger origin, and the sequences are shown in Table 1.

TABLE 1 carboxypeptidase Gene cloning primer sequences

The DNA extracted from Aspergillus niger M00988 (CGMCC number 18828) is used as a template, and the sequence is shown as SEQ ID NO. 6. Performing PCR amplification by using CPA-F/CPA-R primers to obtain a target gene segment CPA. The PCR amplification conditions were: pre-denaturation at 94 ℃ for 5min, then denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 1min, extension at 72 ℃ for 1min, 35 cycles, extension at 72 ℃ for 10min to obtain a fragment of about 1500bp, and agarose electrophoresis detection is shown in FIG. 1.

The obtained target gene segment CPA is used as a template, a primer CPA-Nde I-F/CPA-Eco I-R (shown in table 2) of an enzyme cutting site is used for PCR amplification to obtain a target gene segment CPA of the enzyme cutting site, the target gene segment CPA is connected with a cloning vector PMD18-T and is transformed into escherichia coli DH5 α competent cells, the escherichia coli DH5 α competent cells are screened by an ampicillin resistance plate, positive transformants are selected, the recombinant plasmids are named as T-CPA and are sent to Huada gene companies for sequencing, the sequencing results are compared on NCBI, the correct recombinant plasmids T-CPA are verified by sequencing, and are connected to Pcoled TF which is cut by the same enzyme after being cut by Nde I and EcoI, so that an expression vector Pcoled TF-CPA is constructed.

TABLE 2 cloning primer sequences for carboxypeptidase genes with cleavage sites

2. Construction of M00988CPA mutant

Several sites on the M00988CPA substrate binding pocket were selected for site-directed mutagenesis, tyrosine at position 206 and serine at position 135, respectively. Site-directed mutant mutants were constructed by overlap extension PCR method, and primers were designed, respectively, as shown in Table 3.

TABLE 3 overlap extension of PCR primer sequences

The site-directed mutagenesis was performed by two rounds of PCR by overlap extension PCR using successfully constructed Pcoled TF-CPA plasmid as the raw material for mutagenesis. The first round of PCR was performed using successfully constructed Pcoled TF-CPA plasmid as template and CPA-Nde I-F, Y206S-R and Y206S-F, CPA-Eco I-R or CPA-Nde I-F, S135G-R and S135G-F, CPA-Eco I-R as primers to obtain the front and back sequences containing the mutation site, respectively. The second round of PCR was performed using the first and second PCR products as templates and CPA-Nde I-F, CPA-Eco I-R as primers to obtain the full sequence of the mutant.

The tyrosine at the 206 site is mutated into serine or the serine at the 135 site is mutated into glycine, so as to construct an expression vector of the Pcoled TF-CPA-Y206S or Pcoled TF-CPA-S135G mutant. The mutant sequence is obtained after the tyrosine at the position 206 is successfully mutated into the serine or the serine at the position 135 is successfully mutated into the glycine. FIG. 2 is an agarose gel electrophoresis image of the process of constructing the Y206S and S135G mutants. FIG. 2 (A) is an electrophoretogram of the Y206S mutant, wherein

lanes

1 and 2 are the front section,

lanes

3 and 4 are the rear section, and

lanes

5 and 6 are the second round PCR products; FIG. 2 (B) is the electrophoretogram of the S135G mutant, in which

lanes

1 and 2 are the later stages,

lanes

3 and 4 are the former stages, and

lanes

5 and 6 are the second round PCR products.

The Pcold TF and the mutant sequence are subjected to double enzyme digestion respectively, then the mutant sequence subjected to double enzyme digestion is connected with the Pcold TF by adopting T4 DNA ligase, recombinant plasmids Pcold TF-CPA-Y206S and Pcold TF-CPA-S135G are obtained, and the target gene nucleic acid sequences are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 5.

3. Prokaryotic expression of M00988CPA and mutant thereof

The constructed Pcool TF-CPA and the expression vector of the mutant are respectively transformed into the competent cells of the escherichia coli BL 21. Positive recombinants were screened on ampicillin resistant plates and verified by colony PCR followed by sequencing. Inoculating the Pcool TF-CPA/BL21 and the mutant recombinant bacteria which are proved to be correct to 5mL of liquid LB culture medium containing the aminobenzyl resistance, culturing at 37 ℃ overnight, then transferring the strain to 100mL of liquid LB culture medium containing the aminobenzyl resistance by 1 percent of inoculum size, and culturing at 37 ℃ to OD₆₀₀Between 0.6 and 0.8, IPTG was added to a final concentration of 0.5mM, and the cells were cultured at 15 ℃ for 18 hours. The fermentation liquor is centrifuged for 10min at the temperature of 4 ℃ of 8000r/min, and thalli are collected. Resuspending the bacteria in 0.2M phosphate buffer (pH 7.5)Crushing cells by an ultrasonic cell crushing method, centrifuging for 10min at 8000r/min4 ℃, and obtaining supernatant which is crude enzyme liquid. The SDS-PAGE electrophoresis (figure 3) of the crude enzyme solution shows that a protein band exists at about 100kDa, which is close to the predicted CPA protein amount of 98kDa, and the constructed prokaryotic expression system can correctly express the carboxypeptidase. The amino acid sequence of the M00988CPA protein is shown as SEQ ID NO. 3, and the amino acid sequences of the two mutants are shown as SEQ ID NO. 1 and SEQ ID NO. 2.

Example 2 preparation of high F-value oligopeptide

1. Chlorella protein extraction

Accurately weighing a certain amount of chlorella powder, placing the chlorella powder into a 250mL conical flask, adding deionized water according to a proper material-liquid ratio g/mL, placing the mixture into a shaking table after stirring, and swelling the mixture for 12 hours at 200rpm at room temperature. Adding a proper amount of sodium hydroxide solid into the swelled chlorella suspension, and slowly adding while continuously stirring. After completion, sonication is carried out at a temperature and for a time. Then, pH =7 was adjusted with 0.1mol/L sodium hydroxide solution and hydrochloric acid solution, centrifugation was performed at 5000rpm at 25 ℃ for 10min, the supernatant was taken, the volume was measured using a measuring cylinder and recorded, 10mL of the supernatant was taken out therefrom in an erlenmeyer flask, 95% ethanol solution at 4 ℃ was added at a ratio of 1:4 (V/V), and stirring was performed for 1min, followed by thorough mixing. The mixture was centrifuged at 5000rpm at 25 ℃ for 10 minutes, and the supernatant was discarded. The resulting precipitate was washed with a small amount of deionized water, after removal of surface alcohol, the precipitate was redissolved with 30mL of 0.1mol/L PBS solution pH =6 and shaken until it was completely dissolved.

The protein concentration of the obtained sample was measured using a Bradford protein concentration measurement kit according to the instructions of the specification, and the protein extraction rate was calculated from the obtained protein concentration. The protein extraction rate calculation formula is as follows:

in the formula:

R-Chlorella protein extraction rate,%;

c is the concentration of protein in the extracting solution, mg/mL;

v-volume of solution, mL;

M-Chlorella powder mass, g;

X-Chlorella protein content,%.

(1) Selection of different feed-liquid ratios

The gradient of the material-liquid ratio (m/V) is set as eight gradients of 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, and the like. Respectively taking 1g Chlorella powder, preparing the above 8 kinds of suspension, and swelling at 25 deg.C for 12 hr at 200 r/min. Adding 1% solid sodium hydroxide, and performing ultrasonic treatment at 25 deg.C and 40W for 30 min. After extraction, the pH =7,5000rpm, centrifuged at 25 ℃ for 10min, the supernatant was removed and the recording volume was measured. 10mL of the supernatant was added to a 95% ethanol solution at a ratio of 1:4 (V/V) at 4 ℃ and stirred for 1min to mix thoroughly. Centrifuging at 25 deg.C and 5000rpm for 10min, removing supernatant, washing precipitate with deionized water to remove residual alcohol, and dissolving precipitate with 30mL of PBS solution with pH = 6. The protein content of the extract was measured and the protein extraction rate was calculated, and the results are shown in fig. 4, where the feed-to-liquid ratio from 1:10 to 1:40 showed a positive correlation with the protein extraction rate, and the protein extraction rate increased with the increase of the feed-to-liquid ratio. However, when the feed-liquid ratio is increased again, the protein extraction rate is reduced, and at 1:40, the protein extraction rate reaches up to 9.17%.

(2) Selection of different sodium hydroxide addition

Collecting 1g Chlorella powder, preparing suspension at a ratio of material to liquid (m/V) of 1:40, and swelling at 25 deg.C for 12 hr at 200 r/min. Adding sodium hydroxide solids with different masses respectively until the concentration of the sodium hydroxide in the sample solution is 1%, 2%, 3%, 4%, 5%, 6% and 7%, and performing ultrasonic treatment at 25 ℃ and 40W for 30 min. After extraction, the pH =7, the supernatant was centrifuged at 5000rpm and 25 ℃ for 10min, and the volume of the supernatant was measured. 10mL of the supernatant was added to a 95% ethanol solution at a ratio of 1:4 (V/V) at 4 ℃ and stirred for 1min to mix thoroughly. Centrifuging at 25 deg.C and 5000rpm for 10min, removing supernatant, washing precipitate with deionized water to remove residual alcohol, and dissolving precipitate with 30mL of PBS solution with pH = 6. The results of measuring the protein content of the extract and calculating the protein extraction rate are shown in FIG. 5: when the addition amount of the sodium hydroxide is 1% -5%, the protein extraction rate is in an increasing trend, the peak value is 5%, and the extraction rate between 4% -5% is obviously improved. As the amount of sodium hydroxide added continues to increase, the protein extraction rate shows a downward trend.

(3) Selection of different extraction temperatures

Collecting 1g Chlorella powder, preparing suspension at a ratio of material to liquid (m/V) of 1:40, and swelling at 25 deg.C for 12 hr at 200 r/min. Adding 5% solid sodium hydroxide, and performing ultrasonic treatment at 20 deg.C, 30 deg.C, 40 deg.C, 50 deg.C, 60 deg.C, and 70 deg.C for 30min at 40W. After the extraction, the pH =7, the supernatant was centrifuged at 25 ℃ for 10min at 5000rpm, and the recording volume was measured. 10mL of the supernatant was added to a 95% ethanol solution at a ratio of 1:4 (V/V) at 4 ℃ and stirred for 1min to mix thoroughly. Centrifuging at 25 deg.C and 5000rpm for 10min, removing supernatant, washing precipitate with deionized water to remove residual alcohol, and dissolving precipitate with 30mL of PBS solution with pH = 6. And (4) measuring the protein content of the extract and calculating the protein extraction rate. The results are shown in FIG. 6: when the extraction temperature is 20-70 ℃, the tendency of increasing first and then decreasing is shown, and a peak value appears at 40 ℃.

(4) Selection of different extraction times

Collecting 1g Chlorella powder, preparing suspension at a ratio of material to liquid (m/V) of 1:40, and swelling at 25 deg.C for 12 hr at 200 r/min. Adding 5% solid sodium hydroxide, and performing ultrasonic treatment at 40 deg.C and 40W for 15min, 30min, 45min, 60min, and 75 min. After the extraction, the pH =7, the supernatant was centrifuged at 25 ℃ for 10min at 5000rpm, and the recording volume was measured. 10mL of the supernatant was added to a 95% ethanol solution at a ratio of 1:4 (V/V) at 4 ℃ and stirred for 1min to mix thoroughly. Centrifuging at 25 deg.C and 5000rpm for 10min, removing supernatant, washing precipitate with deionized water to remove residual alcohol, and dissolving precipitate with 30mL of PBS solution with pH = 6. And (4) measuring the protein content of the extract and calculating the protein extraction rate. The results are shown in FIG. 7: the extraction time is 30-75min, and the maximum value of protein extraction rate is 60 min.

2. Endopeptidase enzymatic hydrolysis condition optimization

Performing response surface optimization on chlorella protein extraction conditions, extracting chlorella protein according to obtained results: accurately weighing a certain amount of chlorella powder, adding deionized water according to a feed-liquid ratio of 1:48 (m/V), stirring, and then oscillating for 12 hours at room temperature for swelling. 5.37% sodium hydroxide solids were added to the chlorella suspension, with slow addition taking care during the addition and stirring continuously. After completion, sonication was carried out at 43 ℃ for 60 min. Subsequently, the pH =7 was adjusted with 0.1mol/L sodium hydroxide solution and hydrochloric acid solution, centrifugation was performed at 5000rpm at 25 ℃ for 10min, and 95% ethanol solution at 4 ℃ was added to the supernatant at a ratio of 1:4 (V/V), and the mixture was stirred for 1min and mixed thoroughly. The mixture was centrifuged at 5000rpm at 25 ℃ for 10 minutes, and the supernatant was discarded. Washing the obtained precipitate with a small amount of deionized water, removing surface alcohol, and dissolving the precipitate with 0.1mol/L PBS solution with pH =6 to obtain Chlorella protein extract.

Mixing 1mL of the above extractive solution with 4mL of PBS buffer solution with pH =6, and treating in water bath at optimum enzyme reaction pH and temperature for 20 min. Adding a proper amount of enzyme into the extracting solution to start hydrolysis, titrating with 0.1mol/L standard sodium hydroxide solution every 1h to measure the hydrolysis degree, wherein the calculation formula of the hydrolysis degree is as follows:

the hydrolysis degree adopts a pH-stat method:

DH= V_NaOH×N_NaOH/（α×M_p×H_tot）×100%

in the formula:

V_NaOHtitration of the volume of base consumed, mL;

N_NaOH-titration of the consumed base normality, mol/L;

M_p-total amount of protein involved in proteolysis, g;

H_tot-equivalent constant of peptide bonds per gram of protein, 9.2 mmol/g;

α -average degree of dissociation of amino acids;

α=10^pH-pk/（1+10^pH-pk）

pK=7.8+2400×（298-T）/298T

T=273.15+t

t-temperature of the reaction environment, deg.C;

pH-the pH at which the reaction takes place.

(1) Degree of hydrolysis of different classes of enzymes

Collecting 1mL Chlorella protein extract, adding 4mL of PBS buffer solution with pH =6, mixing, and treating at constant temperature in water bath at pH =8 and 37 deg.C and pH =10.5 and 40 deg.C for 20 min. Adding 2500U of each enzyme solution of trypsin and alkaline protease to start hydrolysis, wherein the trypsin is at the temperature of 37 ℃ and the pH value is 8; the alkaline protease is used for measuring the hydrolysis degree by titration with 0.1mol/L standard sodium hydroxide solution at 40 ℃ and pH of 10.5 every 1h, recording data, and hydrolyzing for 4 hours in total, calculating the total hydrolysis degree, and determining the most suitable enzyme type, and the result is shown in FIG. 8: the degree of hydrolysis of trypsin is better than the degree of alkaline proteolysis.

(2) Degree of hydrolysis at different pH

Mixing 1mL Chlorella protein extract with 4mL of PBS buffer solution with pH =6, adjusting pH to 6, 7, 8, 9, and 10 respectively, and treating in water bath at 37 deg.C for 20 min. The hydrolysis was started by adding 7500U of trypsin solution, and every 1h, the degree of hydrolysis was measured by titration with 0.1mol/L of standard sodium hydroxide solution and the data was recorded, and the total degree of hydrolysis was calculated for 4 hours, and the results are shown in FIG. 9: the hydrolysis degree of the pH from 6 to 8 as a whole tends to increase and decrease, and the hydrolysis degree tends to decrease from the stage of pH8 to pH9, with a peak at pH 8.

(3) Degree of hydrolysis at different temperatures

Mixing 1m Chlorella protein extract with 4mL of PBS buffer solution with pH =6, adjusting pH to 8, and treating in water bath at 27 deg.C, 32 deg.C, 37 deg.C, 42 deg.C, 47 deg.C, and 52 deg.C for 20 min. The hydrolysis was started by adding 7500U of trypsin solution, and every 1h, the degree of hydrolysis was measured by titration with 0.1mol/L of standard sodium hydroxide solution and the data was recorded, and the total degree of hydrolysis was calculated for 4 hours, and the results are shown in FIG. 10: the degree of hydrolysis is, overall, positively correlated with the temperature from 27 ℃ to 42 ℃ and the higher the temperature, the maximum peak in degree of hydrolysis occurs up to 42 ℃. The temperature then varies inversely with the degree of hydrolysis, which decreases with increasing temperature.

(4) Degree of hydrolysis at different times

Mixing 1mL Chlorella protein extract with 4mL of PBS buffer solution with pH =6, adjusting pH to 8, and treating in water bath at 42 deg.C for 20 min. The hydrolysis was started by adding 7500U of trypsin solution, and the total hydrolysis was calculated by titrating the hydrolysis with 0.1mol/L standard sodium hydroxide solution at 0.5h, 1h, 1.5h, 2h, 2.5h, 3h, 3.5h, 4h, 4.5h, and 5h and recording the data, as shown in FIG. 11: the hydrolysis degree and the enzymolysis time show positive correlation trend on the whole. The hydrolysis degree is increased along with the increase of time within 0-3.5h, and is stable within 3.5h, the hydrolysis degree is not changed along with the time any more, and the enzymolysis reaction is complete.

(5) Degree of hydrolysis at different enzyme addition levels

Collecting 1mL Chlorella protein extract, adding 4mL PBS buffer solution with pH =6, mixing, adjusting pH to 8, and treating in water bath at 42 deg.C for 20 min. Adding trypsin solutions of 10000U/mg protein, 30000U/mg protein, 50000U/mg protein, 70000U/mg protein and 90000U/mg protein respectively to start hydrolysis, titrating with 0.1mol/L standard sodium hydroxide solution every 1h to measure the hydrolysis degree and record data, hydrolyzing for 4 hours, and calculating the total hydrolysis degree, wherein the results are shown in FIG. 12: the hydrolysis degree and the enzyme addition amount are in a positive correlation trend on the whole, and the increase of the hydrolysis degree gradually becomes gentle along with the increase of the enzyme addition amount. It was observed that the degree of hydrolysis increased almost horizontally from the addition of 70000U/mg protein to the enzyme to the subsequent time.

3. Enzymolysis with carboxypeptidase

Accurately weighing a certain amount of chlorella powder, adding deionized water according to a feed-liquid ratio of 1:48 (m/V), stirring, and then oscillating for 12 hours at room temperature for swelling. 5.37% sodium hydroxide solids were added to the chlorella suspension, with slow addition taking care during the addition and stirring continuously. After completion, sonication was carried out at 43 ℃ for 60 min. Subsequently, the pH =7 was adjusted with 0.1mol/L sodium hydroxide solution and hydrochloric acid solution, centrifugation was performed at 5000rpm at 25 ℃ for 10min, and 95% ethanol solution at 4 ℃ was added to the supernatant at a ratio of 1:4 (V/V), and the mixture was stirred for 1min and mixed thoroughly. The mixture was centrifuged at 5000rpm at 25 ℃ for 10 minutes, and the supernatant was discarded. Washing the obtained precipitate with a small amount of deionized water, removing surface alcohol, and dissolving the precipitate with 0.1mol/L PBS solution with pH =6 to obtain Chlorella protein extract.

Carrying out response surface optimization on endopeptidase enzymolysis conditions, and carrying out endopeptidase enzymolysis on chlorella protein according to obtained results: adjusting pH of the extracted Chlorella protein solution to 8, adding trypsin according to enzyme dosage of 80361.64U/mg Chlorella protein, performing enzymolysis for 3.5 hr in water bath at 37 deg.C, boiling for 5min to inactivate enzyme activity, and obtaining endopeptidase enzymolysis solution.

Taking 1mL of the endopeptidase enzymolysis solution, adjusting the pH value to 7.5, and adding crude enzyme solutions of prokaryotic expression CPA, CPA-Y124G and CPA-S135G mutants according to the enzyme adding amount of 5 percent, wherein the crude enzyme solutions are marked as CPA, Y124G and S135G respectively. Performing enzymolysis for 4 hr in 40 deg.C water bath, and boiling for 5min to inactivate enzyme.

The pH of the endopeptidase hydrolysate was further adjusted to 7.0, and flavourzyme (equivalent to 4% of the amount added) was added to the hydrolysate at a concentration of 1U/mg protein, and the product was designated as Fla. Performing enzymolysis for 4 hr in 45 deg.C water bath, boiling for 5min to inactivate enzyme;

then the endopeptidase hydrolysate is taken to adjust the pH value to 6.5, and papain (equivalent to 4 percent of the addition amount) is added according to 30U/mg of protein and is marked as Pap. Performing enzymolysis for 4 hr in water bath at 60 deg.C, and boiling for 5min to inactivate enzyme.

4. Aromatic amino acid adsorbed by activated carbon

Adjusting the pH value of the sample after the enzymolysis by the exopeptidase to 4.5, adding activated carbon according to the solid-to-liquid ratio of 1:10, and adsorbing at 25 ℃ for 12 hours. Filtering to remove the activated carbon to obtain the oligopeptide solution with high F value. Hydrolyzing the oligopeptide into free amino acid by an acid hydrolysis method, and measuring the amino acid composition and the content of the oligopeptide solution by a high performance liquid phase, wherein the contents of aromatic amino acid and branched chain amino acid in the oligopeptide product solution are shown in Table 4.

TABLE 4 branched-chain amino acid and aromatic amino acid content

FIG. 13 is a bar graph of F-values in solutions of oligopeptide products formed after different enzyme treatments. From the test results, it can be seen that the sample prepared with CPA proenzyme has an F value of 13.11, failing to reach high F value levels (F value > 20); the F values of the oligopeptides prepared with mutants Y206S and S135G were 34.33 and 33.42, respectively, and the F values of the oligopeptides prepared with mutants Y206S and S135G were significantly increased by about 2.62 and 2.55 times, respectively, to the level of high F value, compared to the proenzyme. Meanwhile, the F value of the oligopeptide product prepared by specifically modified enzyme mutants Y206S and S135G is obviously superior to that of flavourzyme and papain commonly used for preparing the oligopeptide in the current market.

Sequence listing

<110> Beijing university of Industrial and commercial

<120> method for preparing high F value oligopeptide by using chlorella powder as raw material

<130>20191106

<160>14

<170>PatentIn version 3.5

<210>1

<211>480

<212>PRT

<213>Aspergillus niger

<400>1

Met Val Arg Arg Ile Ala Ser Ala Thr Pro Met Val Gln Ser Pro Met

1 5 10 15

Ser Pro Leu Gly Thr Thr Tyr Cys Val Arg Pro Asn Pro Val Ser Leu

20 25 30

Asn Leu Gln Arg Arg Pro Leu Val Ile Ala Ser Thr Asp Glu Ala Lys

35 40 45

Val Thr Ile Ile Tyr Ala Gly Leu Leu Ile Pro Gly Asp Gly Glu Pro

50 55 60

Leu Arg Asn Ala Ala Leu Val Ile Ser Asp Lys Ile Ile Ala PheVal

65 70 75 80

Gly Ser Glu Ala Asp Ile Pro Lys Lys Tyr Leu Arg Ser Thr Gln Ser

85 90 95

Thr His Arg Val Pro Val Leu Met Pro Gly Leu Trp Asp Cys His Met

100 105 110

His Phe Gly Gly Asp Asp Asp Tyr Tyr Asn Asp Tyr Thr Ser Gly Leu

115 120 125

Ala Thr His Pro Ala Ser Ser Gly Ala Arg Leu Ala Arg Gly Cys Trp

130 135 140

Glu Ala Leu Gln Asn Gly Tyr Thr Ser Tyr Arg Asp Leu Ala Gly Tyr

145 150 155 160

Gly Cys Glu Val Ala Lys Ala Ile Asn Asp Gly Thr Ile Val Gly Pro

165 170 175

Asn Val Tyr Ser Ser Gly Ala Ala Leu Ser Gln Thr Ala Gly His Gly

180 185 190

Asp Ile Phe Ala Leu Pro Ala Gly Glu Val Leu Gly Ser Ser Gly Val

195 200 205

Met Asn Pro Arg Pro Gly Tyr Trp Gly Ala Gly Pro Leu Cys Ile Ala

210 215 220

Asp Gly Val Glu Glu Val Arg Arg Ala Val Arg Leu Gln Ile Arg Arg

225 230 235 240

Gly Ala Lys Val Ile Lys Val Met Ala Ser Gly Gly Val Met Ser Arg

245 250 255

Asp Asp Asn Pro Asn Phe Ala Gln Phe Ser Pro Glu Glu Leu Lys Val

260 265 270

Ile Val Glu Glu Ala Ala Arg Gln Asn Arg Ile Val Ser Ala His Val

275 280 285

His Gly Lys Ala Gly Ile Met Ala Ala Ile Lys Ala Gly Cys Lys Ser

290 295 300

Leu Glu His Val Ser Tyr Ala Asp Glu Glu Val Trp Glu Leu Met Lys

305 310 315 320

Glu Lys Gly Ile Leu Tyr Val Ala Thr Arg Ser Val Ile Glu Ile Phe

325 330 335

Leu Ala Ser Asn Gly Glu Gly Leu Val Lys Glu Ser Trp Ala Lys Leu

340 345 350

Gln Ala Leu Ala Asp Ser His Leu Lys Ala Tyr Gln Gly Ala Ile Lys

355 360 365

Ala Gly Val Thr Ile Ala Leu Gly Thr Asp Thr Ala Pro Gly Gly Pro

370 375 380

Thr Ala Leu Glu Leu Gln Phe Ala Val Glu Arg Gly Gly Met Thr Pro

385 390 395 400

Leu Glu Ala Ile Lys Ala Ala Thr Ala Asn Ala Pro Leu Ser Val Gly

405 410 415

Pro Gln Ala Pro Leu Thr Gly Gln Leu Arg Glu Gly Tyr Glu Ala Asp

420 425 430

Val Ile Ala Leu Glu Glu Asn Pro Leu Glu Asp Ile Lys Val Phe Gln

435 440 445

Glu Pro Lys Ala Val Thr His Val Trp Lys Gly Gly Lys Leu Phe Lys

450 455 460

Gly Pro Gly Ile Gly Pro Trp Gly Glu Asp Ala Arg Asn Pro Phe Leu

465 470 475 480

<210>2

<211>480

<212>PRT

<213>Aspergillus niger

<400>2

Met Val Arg Arg Ile Ala Ser Ala Thr Pro Met Val Gln Ser Pro Met

1 5 10 15

Ser Pro Leu Gly Thr Thr Tyr Cys Val Arg Pro Asn Pro Val Ser Leu

20 25 30

Asn Leu Gln Arg Arg Pro Leu Val Ile Ala Ser Thr Asp Glu Ala Lys

35 40 45

Val Thr Ile Ile Tyr Ala Gly Leu Leu Ile Pro Gly Asp Gly Glu Pro

50 55 60

Leu Arg Asn Ala Ala Leu Val Ile Ser Asp Lys Ile Ile Ala Phe Val

65 70 75 80

Gly Ser Glu Ala Asp Ile Pro Lys Lys Tyr Leu Arg Ser Thr Gln Ser

85 90 95

Thr His Arg Val Pro Val Leu Met Pro Gly Leu Trp Asp Cys His Met

100 105 110

His Phe Gly Gly Asp Asp Asp Tyr Tyr Asn Asp Tyr Thr Ser Gly Leu

115 120 125

Ala Thr His Pro Ala Ser Gly Gly Ala Arg Leu Ala Arg Gly Cys Trp

130 135 140

Glu Ala Leu Gln Asn Gly Tyr Thr Ser Tyr Arg Asp Leu Ala Gly Tyr

145 150 155 160

Gly Cys Glu Val Ala Lys Ala Ile Asn Asp Gly Thr Ile Val Gly Pro

165 170 175

Asn Val Tyr Ser Ser Gly Ala Ala Leu Ser Gln Thr Ala Gly His Gly

180 185 190

Asp Ile Phe Ala Leu Pro Ala Gly Glu Val Leu Gly Ser Tyr Gly Val

195 200 205

Met Asn Pro Arg Pro Gly Tyr Trp Gly Ala Gly Pro Leu Cys Ile Ala

210 215 220

Asp Gly Val Glu Glu Val Arg Arg Ala Val Arg Leu Gln Ile Arg Arg

225 230 235 240

Gly Ala Lys Val Ile Lys Val Met Ala Ser Gly Gly Val Met Ser Arg

245 250 255

Asp Asp Asn Pro Asn Phe Ala Gln Phe Ser Pro Glu Glu Leu Lys Val

260 265 270

Ile Val Glu Glu Ala Ala Arg Gln Asn Arg Ile Val Ser Ala His Val

275 280 285

His Gly Lys Ala Gly Ile Met Ala Ala Ile Lys Ala Gly Cys Lys Ser

290 295 300

Leu Glu His Val Ser Tyr Ala Asp Glu Glu Val Trp Glu Leu Met Lys

305 310 315 320

Glu Lys Gly Ile Leu Tyr Val Ala Thr Arg Ser Val Ile Glu Ile Phe

325 330 335

Leu Ala Ser Asn Gly Glu Gly Leu Val Lys Glu Ser Trp Ala Lys Leu

340 345 350

Gln Ala Leu Ala Asp Ser His Leu Lys Ala Tyr Gln Gly Ala Ile Lys

355 360 365

Ala Gly Val Thr Ile Ala Leu Gly Thr Asp Thr Ala Pro Gly Gly Pro

370 375 380

Thr Ala Leu Glu Leu Gln Phe Ala Val Glu Arg Gly Gly Met Thr Pro

385 390 395 400

Leu Glu Ala Ile Lys Ala Ala Thr Ala Asn Ala Pro Leu Ser Val Gly

405 410 415

Pro Gln Ala Pro Leu Thr Gly Gln Leu Arg Glu Gly Tyr Glu Ala Asp

420 425 430

Val Ile Ala Leu Glu Glu Asn Pro Leu Glu Asp Ile Lys Val Phe Gln

435 440 445

Glu Pro Lys Ala Val Thr His Val Trp Lys Gly Gly Lys Leu Phe Lys

450 455 460

Gly Pro Gly Ile Gly Pro Trp Gly Glu Asp Ala Arg Asn Pro Phe Leu

465 470 475 480

<210>3

<211>480

<212>PRT

<213>Aspergillus niger

<400>3

Met Val Arg Arg Ile Ala Ser Ala Thr Pro Met Val Gln Ser Pro Met

1 5 10 15

Ser Pro Leu Gly Thr Thr Tyr Cys Val Arg Pro Asn Pro Val Ser Leu

20 25 30

Asn Leu Gln Arg Arg Pro Leu Val Ile Ala Ser Thr Asp Glu Ala Lys

35 40 45

Val Thr Ile Ile Tyr Ala Gly Leu Leu Ile Pro Gly Asp Gly Glu Pro

50 55 60

Leu Arg Asn Ala Ala Leu Val Ile Ser Asp Lys Ile Ile Ala Phe Val

65 70 75 80

Gly Ser Glu Ala Asp Ile Pro Lys Lys Tyr Leu Arg Ser Thr Gln Ser

85 90 95

Thr His Arg Val Pro Val Leu Met Pro Gly Leu Trp Asp Cys His Met

100 105 110

His Phe Gly Gly Asp Asp Asp Tyr Tyr Asn Asp Tyr Thr Ser Gly Leu

115 120 125

Ala Thr His Pro Ala Ser Ser Gly Ala Arg Leu Ala Arg Gly Cys Trp

130 135 140

Glu Ala Leu Gln Asn Gly Tyr Thr Ser Tyr Arg Asp Leu Ala Gly Tyr

145 150 155 160

Gly Cys Glu Val Ala Lys Ala Ile Asn Asp Gly Thr Ile Val Gly Pro

165 170 175

Asn Val Tyr Ser Ser Gly Ala Ala Leu Ser Gln Thr Ala Gly His Gly

180 185 190

Asp Ile Phe Ala Leu Pro Ala Gly Glu Val Leu Gly Ser Tyr Gly Val

195 200 205

Met Asn Pro Arg Pro Gly Tyr Trp Gly Ala Gly Pro Leu Cys Ile Ala

210 215 220

Asp Gly Val Glu Glu Val Arg Arg Ala Val Arg Leu Gln Ile Arg Arg

225 230 235 240

Gly Ala Lys Val Ile Lys Val Met Ala Ser Gly Gly Val Met Ser Arg

245 250 255

Asp Asp Asn Pro Asn Phe Ala Gln Phe Ser Pro Glu Glu Leu Lys Val

260 265 270

Ile Val Glu Glu Ala Ala Arg Gln Asn Arg Ile Val Ser Ala His Val

275 280 285

His Gly Lys Ala Gly Ile Met Ala Ala Ile Lys Ala Gly Cys Lys Ser

290 295 300

Leu Glu His Val Ser Tyr Ala Asp Glu Glu Val Trp Glu Leu Met Lys

305 310 315 320

Glu Lys Gly Ile Leu Tyr Val Ala Thr Arg Ser Val Ile Glu Ile Phe

325 330 335

Leu Ala Ser Asn Gly Glu Gly Leu Val Lys Glu Ser Trp Ala Lys Leu

340345 350

Gln Ala Leu Ala Asp Ser His Leu Lys Ala Tyr Gln Gly Ala Ile Lys

355 360 365

Ala Gly Val Thr Ile Ala Leu Gly Thr Asp Thr Ala Pro Gly Gly Pro

370 375 380

Thr Ala Leu Glu Leu Gln Phe Ala Val Glu Arg Gly Gly Met Thr Pro

385 390 395 400

Leu Glu Ala Ile Lys Ala Ala Thr Ala Asn Ala Pro Leu Ser Val Gly

405 410 415

Pro Gln Ala Pro Leu Thr Gly Gln Leu Arg Glu Gly Tyr Glu Ala Asp

420 425 430

Val Ile Ala Leu Glu Glu Asn Pro Leu Glu Asp Ile Lys Val Phe Gln

435 440 445

Glu Pro Lys Ala Val Thr His Val Trp Lys Gly Gly Lys Leu Phe Lys

450 455 460

Gly Pro Gly Ile Gly Pro Trp Gly Glu Asp Ala Arg Asn Pro Phe Leu

465 470 475 480

<210>4

<211>1443

<212>DNA

<213>Aspergillus niger

<400>4

atggtccgcc gaattgcttc agctacacct atggtgcaat cgcccatgtc gccattgggc 60

acaacatact gcgtccgtcc taatcctgtt tcactgaatc ttcaaagaag acctctcgtg 120

atcgcatcaa cagacgaggc caaggtcact ataatatatg ccggactatt aatccctggc 180

gacggagaac ctctgcgcaa tgctgcccta gtcatcagcg ataagatcat cgcgttcgtt 240

ggatccgaag ccgacatccc taagaaatac ctccggtcca cgcagtctac tcatcgtgtc 300

cccgtgctca tgcctggttt gtgggattgc cacatgcatt ttggcgggga tgacgattat 360

tacaacgatt atacatctgg tctggccact catccagcat catcaggtgc tcgactagcc 420

cgtggttgct gggaagcatt gcagaatggg tatacatcct accgcgacct agccggatac 480

gggtgcgagg tcgcaaaggc gatcaatgat ggcactatcg ttggtccaaa cgtgtactcg 540

tctggcgctg cactcagtca gacagctgga cacggcgata tcttcgctct tccagcaggc 600

gaagtactgg ggagttctgg agtaatgaac ccacgccctg ggtactgggg ggcagggccg 660

ctatgtatcg ccgatggcgt agaggaggtc cgacgagcag tgaggttgca gatccgtcgc 720

ggtgcaaagg ttatcaaagt gatggcctct gggggtgtca tgtcgcgaga cgacaatccc 780

aactttgcac agttctctcc agaagaactg aaggtgatag tggaagaggc ggctcgacag 840

aaccggatcg tttctgcaca tgtgcatggc aaggcgggga ttatggctgc tatcaaagca 900

ggctgcaaga gtctggagca tgtgtcttac gctgacgagg aggtctggga gctcatgaaa 960

gagaagggaa ttttgtatgt ggccacacgc tcggttattg aaatctttct ggctagtaat 1020

ggagaggggt tggtgaaaga gtcgtgggcc aagttgcagg cccttgccga ttcgcatttg 1080

aaagcttatc agggagctat taaggcgggt gttaccattg cgttgggaac ggataccgcc1140

cccggtggtc ctaccgcact tgagttgcag tttgccgtcg agagaggagg tatgacgccg 1200

ttggaggcca tcaaagccgc aactgcgaac gctcccctgt cagttggtcc acaagcaccg 1260

ttgacgggtc agcttcgcga ggggtatgag gcagatgtga ttgcgttgga ggagaatcca 1320

ttggaggaca tcaaagtctt tcaggagccg aaggcagtta cccacgtctg gaagggaggg 1380

aaactgttca aaggtccagg tattggtccg tggggagaag atgcacgtaa tccttttctg 1440

tag 1443

<210>5

<211>1443

<212>DNA

<213>Aspergillus niger

<400>5

atggtccgcc gaattgcttc agctacacct atggtgcaat cgcccatgtc gccattgggc 60

acaacatact gcgtccgtcc taatcctgtt tcactgaatc ttcaaagaag acctctcgtg 120

atcgcatcaa cagacgaggc caaggtcact ataatatatg ccggactatt aatccctggc 180

gacggagaac ctctgcgcaa tgctgcccta gtcatcagcg ataagatcat cgcgttcgtt 240

ggatccgaag ccgacatccc taagaaatac ctccggtcca cgcagtctac tcatcgtgtc 300

cccgtgctca tgcctggttt gtgggattgc cacatgcatt ttggcgggga tgacgattat 360

tacaacgatt atacatctgg tctggccact catccagcat caggaggtgc tcgactagcc 420

cgtggttgct gggaagcatt gcagaatggg tatacatcct accgcgacct agccggatac 480

gggtgcgagg tcgcaaaggc gatcaatgat ggcactatcg ttggtccaaa cgtgtactcg 540

tctggcgctgcactcagtca gacagctgga cacggcgata tcttcgctct tccagcaggc 600

gaagtactgg ggagttatgg agtaatgaac ccacgccctg ggtactgggg ggcagggccg 660

ctatgtatcg ccgatggcgt agaggaggtc cgacgagcag tgaggttgca gatccgtcgc 720

ggtgcaaagg ttatcaaagt gatggcctct gggggtgtca tgtcgcgaga cgacaatccc 780

aactttgcac agttctctcc agaagaactg aaggtgatag tggaagaggc ggctcgacag 840

aaccggatcg tttctgcaca tgtgcatggc aaggcgggga ttatggctgc tatcaaagca 900

ggctgcaaga gtctggagca tgtgtcttac gctgacgagg aggtctggga gctcatgaaa 960

gagaagggaa ttttgtatgt ggccacacgc tcggttattg aaatctttct ggctagtaat 1020

ggagaggggt tggtgaaaga gtcgtgggcc aagttgcagg cccttgccga ttcgcatttg 1080

aaagcttatc agggagctat taaggcgggt gttaccattg cgttgggaac ggataccgcc 1140

cccggtggtc ctaccgcact tgagttgcag tttgccgtcg agagaggagg tatgacgccg 1200

ttggaggcca tcaaagccgc aactgcgaac gctcccctgt cagttggtcc acaagcaccg 1260

ttgacgggtc agcttcgcga ggggtatgag gcagatgtga ttgcgttgga ggagaatcca 1320

ttggaggaca tcaaagtctt tcaggagccg aaggcagtta cccacgtctg gaagggaggg 1380

aaactgttca aaggtccagg tattggtccg tggggagaag atgcacgtaa tccttttctg 1440

tag 1443

<210>6

<211>1443

<212>DNA

<213>Aspergillus niger

<400>6

atggtccgcc gaattgcttc agctacacct atggtgcaat cgcccatgtc gccattgggc 60

acaacatact gcgtccgtcc taatcctgtt tcactgaatc ttcaaagaag acctctcgtg 120

atcgcatcaa cagacgaggc caaggtcact ataatatatg ccggactatt aatccctggc 180

gacggagaac ctctgcgcaa tgctgcccta gtcatcagcg ataagatcat cgcgttcgtt 240

ggatccgaag ccgacatccc taagaaatac ctccggtcca cgcagtctac tcatcgtgtc 300

cccgtgctca tgcctggttt gtgggattgc cacatgcatt ttggcgggga tgacgattat 360

tacaacgatt atacatctgg tctggccact catccagcat catcaggtgc tcgactagcc 420

cgtggttgct gggaagcatt gcagaatggg tatacatcct accgcgacct agccggatac 480

gggtgcgagg tcgcaaaggc gatcaatgat ggcactatcg ttggtccaaa cgtgtactcg 540

tctggcgctg cactcagtca gacagctgga cacggcgata tcttcgctct tccagcaggc 600

gaagtactgg ggagttatgg agtaatgaac ccacgccctg ggtactgggg ggcagggccg 660

ctatgtatcg ccgatggcgt agaggaggtc cgacgagcag tgaggttgca gatccgtcgc 720

ggtgcaaagg ttatcaaagt gatggcctct gggggtgtca tgtcgcgaga cgacaatccc 780

aactttgcac agttctctcc agaagaactg aaggtgatag tggaagaggc ggctcgacag 840

aaccggatcg tttctgcaca tgtgcatggc aaggcgggga ttatggctgc tatcaaagca 900

ggctgcaaga gtctggagca tgtgtcttac gctgacgagg aggtctggga gctcatgaaa 960

gagaagggaa ttttgtatgt ggccacacgc tcggttattg aaatctttct ggctagtaat 1020

ggagaggggt tggtgaaaga gtcgtgggcc aagttgcagg cccttgccga ttcgcatttg 1080

aaagcttatc agggagctat taaggcgggt gttaccattg cgttgggaac ggataccgcc 1140

cccggtggtc ctaccgcact tgagttgcag tttgccgtcg agagaggagg tatgacgccg 1200

ttggaggcca tcaaagccgc aactgcgaac gctcccctgt cagttggtcc acaagcaccg 1260

ttgacgggtc agcttcgcga ggggtatgag gcagatgtga ttgcgttgga ggagaatcca 1320

ttggaggaca tcaaagtctt tcaggagccg aaggcagtta cccacgtctg gaagggaggg 1380

aaactgttca aaggtccagg tattggtccg tggggagaag atgcacgtaa tccttttctg 1440

tag 1443

<210>7

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223>CPA-F

<400>7

atggtccgcc gaattgct 18

<210>8

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223>CPA-R

<400>8

ctacagaaaa ggattacgtg c 21

<210>9

<211>25

<212>DNA

<213>Artificial Sequence

<220>

<223>CPA-Nde I-F

<400>9

ggaattcatg gtccgccgaa ttgct 25

<210>10

<211>34

<212>DNA

<213>Artificial Sequence

<220>

<223>CPA-Eco I-R

<400>10

cggaattcct acagaaaagg attacgtgca tctt 34

<210>11

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>Y206S-F

<400>11

ggggagttct ggagtaatga acccacgccc tgg 33

<210>12

<211>33

<212>DNA

<213>Artificial Sequence

<220>

<223>Y206S-R

<400>12

ccagggcgtg ggttcattac tccagaactc ccc 33

<210>13

<211>30

<212>DNA

<213>Artificial Sequence

<220>

<223>S135G-F

<400>13

gcatcaggag gtgctcgact agcccgtggt 30

<210>14

<211>30

<212>DNA

<213>Artificial Sequence

<220>

<223>S135G-R

<400>14

accacgggct agtcgagcac ctcctgatgc 30

Claims

1. A method for preparing high F value oligopeptide by using chlorella as a raw material is characterized by comprising the following steps:

the amino acid sequence of the carboxypeptidase is shown as SEQ ID NO 1 or 2;

in the step (1), the endopeptidase is trypsin.

2. The method according to claim 1, wherein in the step (1), the chlorella protein extraction step is: adding water into Chlorella powder to obtain suspension, adding NaOH, ultrasonic extracting, adjusting the extractive solution to neutrality, performing solid-liquid separation to obtain protein solution, and precipitating with ethanol to obtain Chlorella protein.

3. The method of claim 2, wherein the ratio of the mass of chlorella powder to the volume of water in the suspension is 1: 30-50; NaOH is added into the chlorella suspension with the mass accounting for 1-7% of the volume of the chlorella suspension; the extraction temperature is 20-70 deg.C; the extraction time is 30-75 min.

4. The method of claim 2, wherein the NaOH is added in an amount of 3-6% by weight based on the volume of the chlorella suspension; the extraction temperature is 20-40 deg.C.

5. The method of claim 2, further comprising the step of swelling the chlorella suspension for 12-24 hours prior to the ultrasonic extraction.

6. The method as claimed in claim 1, wherein the amount of endopeptidase added is 70000-90000U/mg protein.

7. The method of claim 1, wherein the endopeptidase hydrolysis conditions are: the pH value is 8-10; the temperature is 27-52 ℃.

8. The method of claim 1, wherein in step (2), the amount of enzyme added is 3% to 7% of the amount of protein.

9. The method according to claim 1, wherein in step (2), the enzymolysis conditions of the carboxypeptidase are as follows: the pH value is 6.5-7.5, and the temperature is 27-40 ℃.