CN112961846A - Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof - Google Patents
Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof Download PDFInfo
- Publication number
- CN112961846A CN112961846A CN202110157570.1A CN202110157570A CN112961846A CN 112961846 A CN112961846 A CN 112961846A CN 202110157570 A CN202110157570 A CN 202110157570A CN 112961846 A CN112961846 A CN 112961846A
- Authority
- CN
- China
- Prior art keywords
- degrading enzyme
- zearalenone degrading
- zearalenone
- enzyme mutant
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a zearalenone degrading enzyme mutant with improved enzyme activity, and a coding gene and application thereof. The invention uses error-prone PCR methodClonostachys roseaAnd transforming the zearalenone degrading enzyme gene, and screening to obtain zearalenone degrading enzyme mutants YMDS01, YMDS02 and YMDS 03. The zearalenone degrading enzyme mutant provided by the invention has the advantages that the zearalenone degrading capability is obviously improved, and the zearalenone degrading enzyme mutant has good market application prospect and industrial value.
Description
Technical Field
The invention belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a zearalenone degrading enzyme mutant with improved enzyme activity, and a coding gene and application thereof.
Background
Zearalenone (Zearalenone), also known as F-2 toxin, was originally isolated from moldy corn, and non-steroidal estrogenic mycotoxins, mainly produced by Fusarium, are widely found in corn, barley, wheat, sorghum, and other grains and by-products thereof. Zearalenone enters a food chain through polluted grain agricultural and sideline products and feed, and after being absorbed by animals, the zearalenone causes the estrogen comprehensive symptoms of livestock, causes the phenomena of infertility, abortion, dead fetus and teratogenesis in the livestock, has strong carcinogenicity, and seriously harms the health of the livestock and human beings. The main methods for detoxifying zearalenone at present are a physical method, a chemical method and a biological method. The detoxification efficiency by a physical method is low, and the nutritional ingredients of the grains are damaged, so that the taste of the food is influenced; the chemical method can effectively detoxify, but how to remove chemical components for detoxification from grain food is difficult, and secondary pollution is easy to cause. Therefore, the biological technology for degrading zearalenone and derivatives thereof is a main method for solving the problem in the future. The zearalenone degrading enzyme can catalyze the ester bond cleavage of zearalenone to form a non-toxic product. However, the engineering strain of the zearalenone degrading enzyme at present has lower enzyme production level, lower catalytic activity and narrow substrate application range, and has considerable resistance in large-scale popularization and application.
The error-prone PCR technology is that when DNA polymerase is used for PCR reaction amplification of a target fragment, mutation frequency in the amplification process is increased by adjusting reaction conditions, so that mutation is randomly introduced into a target gene at a certain frequency, a mutant library is constructed, and a required forward mutant is screened. The error-prone PCR technique can be well applied to molecular modification of proteins.
Disclosure of Invention
The invention provides a zearalenone degrading enzyme mutant with improved enzyme activity, and a coding gene and application thereof. The invention relates to a method for constructing a mutant library and performing directional screeningClonostachys roseaThe zearalenone degrading enzyme gene is improved, and the mutant with improved enzyme activity is obtained by screening, so that the mutant has important application value for efficiently degrading zearalenone.
In order to achieve the purpose of the invention, the invention is realized by adopting the following technical scheme:
the invention provides a zearalenone degrading enzyme mutant YMDS01 with improved enzyme activity, wherein the amino acid sequence of the zearalenone degrading enzyme mutant YMDS01 is shown as SEQ ID NO: 5 is shown in the specification; the zearalenone degrading enzyme mutant YMDS01 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to the amino acid sequence of isoleucine at position 3 of the zearalenone degrading enzyme to lysine.
The invention also provides an encoding gene of the zearalenone degrading enzyme mutant YMDS01, wherein the nucleotide sequence of the encoding gene of the zearalenone degrading enzyme mutant YMDS01 is shown as SEQ ID NO: and 6.
The invention also provides a zearalenone degrading enzyme mutant YMDS02 with improved enzyme activity, wherein the amino acid sequence of the zearalenone degrading enzyme mutant YMDS02 is shown as SEQ ID NO: 7 is shown in the specification; the zearalenone degrading enzyme mutant YMDS02 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to glutamic acid into glycine at position 23 of the zearalenone degrading enzyme.
The invention also provides an encoding gene of the zearalenone degrading enzyme mutant YMDS02, wherein the nucleotide sequence of the encoding gene of the zearalenone degrading enzyme mutant YMDS02 is shown as SEQ ID NO: shown in fig. 8.
The invention also provides a zearalenone degrading enzyme mutant YMDS03 with improved enzyme activity, wherein the amino acid sequence of the zearalenone degrading enzyme mutant YMDS03 is shown as SEQ ID NO: 9 is shown in the figure; the zearalenone degrading enzyme mutant YMDS03 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to the 251 th valine of the zearalenone degrading enzyme into alanine.
The invention also provides an encoding gene of the zearalenone degrading enzyme mutant YMDS03, wherein the nucleotide sequence of the encoding gene of the zearalenone degrading enzyme mutant YMDS03 is shown as SEQ ID NO: shown at 10.
The invention also provides a recombinant strain containing the coding gene of the zearalenone degrading enzyme mutant YMDS01, or containing the coding gene of the zearalenone degrading enzyme mutant YMDS02, or containing the coding gene of the zearalenone degrading enzyme mutant YMDS 03.
The invention also provides application of the zearalenone degrading enzyme mutant YMDS01, or the zearalenone degrading enzyme mutant YMDS02, or the zearalenone degrading enzyme mutant YMDS03 in preparation of a biological preparation for degrading zearalenone.
Further, the reaction temperature of the zearalenone degrading enzyme mutant YMDS01, the zearalenone degrading enzyme mutant YMDS02 and the zearalenone degrading enzyme mutant YMDS03 is 35-50 ℃.
Further, the reaction pH of the zearalenone degrading enzyme mutant YMDS01, the zearalenone degrading enzyme mutant YMDS02 and the zearalenone degrading enzyme mutant YMDS03 is 6-9.
Compared with the prior art, the invention has the advantages and the technical effects that: the invention is provided byClonostachys roseaThe zearalenone degrading enzyme gene is used as a basis, an error-prone PCR method is used for modifying the zearalenone degrading enzyme gene, and enzyme activity detection and screening are used for obtaining a mutant YMDS01 containing I3K, a mutant YMDS02 containing G23E and a mutant YMDS03 containing V251A. The enzyme activities of the mutants YMDS01, YMDS02 and YMDS03 modified by the invention are respectively improved by 35.5%, 22.4% and 18.5% compared with the original zearalenone degrading enzyme, and the capability of the mutants for degrading zearalenone is also shown to be obtainedThe improvement is obvious. Therefore, the zearalenone degrading enzyme mutant obtained by the technical scheme of the invention has greatly improved zearalenone degrading efficiency compared with that of a wild type, so that the mutant has good application potential in the fields of feed, food and the like, and has good market application prospect.
Drawings
FIG. 1 shows the enzyme activity data of zearalenone degrading enzyme mutants of the present invention in a 30L fermentor.
FIG. 2 shows the results of the zearalenone degrading enzyme mutant of the present invention.
FIG. 3 shows the results of DDGS degradation by zearalenone degrading enzyme mutants of the present invention.
FIG. 4 shows the results of the test of the zearalenone degrading enzyme mutant degrading yeast culture in the present invention.
Detailed Description
In order to facilitate understanding of the invention, the invention will be described in more detail below with reference to the accompanying drawings and examples, but the scope of the invention is not limited to the following specific examples. The molecular biological experimental methods not specifically described in the following examples can be carried out by referring to specific methods listed in molecular cloning experimental Manual (third edition) written by J. Sambruka (Sambrook) et al, or according to kits and product instructions; reagents and biomaterials used in specific examples are commercially available without specific recitation.
1. Strains and vectors
Pichia pastoris GS115, plasmid pPIC9K, E.coli DH5 α, E.coli BL21, plasmid pET 21a (+) from Invitrogen; the optimized gene is synthesized by Shanghai Czeri bioengineering GmbH.
2. Reagents and culture media
Plasmid extraction kit, fragment purification recovery kit, restriction enzyme and the like are purchased from precious bioengineering (Dalian) Co., Ltd; the GeneMorph II random mutation PCR kit was purchased from Stratagene; ampicillin, IPTG, etc. were purchased from Biotechnology engineering (Shanghai) Co., Ltd; protein Marker: blue Plus II Protein Marker (14-120 kDa) was purchased from Beijing Quanjin Biotechnology, Inc.
LB culture medium: 1% tryptone, 0.5% yeast extract, 1% NaCl.
MD culture medium: 1.34% YNB, 0.4mg/L biotin, 2% glucose;
YPD medium: 1% yeast extract, 2% peptone, 2% glucose;
BMGY medium: 1% yeast extract, 2% peptone, 100mmol/L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4mg/L biotin, 1% glycerol;
BMMY medium: 1% yeast extract, 2% peptone, 100mmol/L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4mg/L biotin, 1% methanol;
BSM medium: 26.7mL of 85% phosphoric acid, 0.93g of calcium sulfate dihydrate, 14.9g of magnesium sulfate dihydrate, 4.13g of potassium hydroxide, 18.2g of potassium sulfate, 40g of glycerol, and 4.0mL of PMT 1.
When the culture medium is solid, 2% agar powder is added.
3. Experimental methods
The strain culture conditions are as follows: escherichia coli was cultured at 37 ℃ and yeast was cultured at 30 ℃. The rotation speed of the shaker during liquid culture is 200 rpm.
The transformation method of pichia pastoris GS115 comprises the following steps:
inoculating activated Pichia pastoris GS115 into a YPD liquid culture medium containing 20mL, carrying out shake-flask culture at 30 ℃ until OD600 is 1.2-1.5, then carrying out low-temperature centrifugation to collect thalli, sequentially washing the thalli with 20mL of ice-cold sterile water and 5mL of ice-cold sorbitol solution with the concentration of 1mol/L, and finally carrying out heavy suspension on the thalli with 1mL of sorbitol solution to prepare yeast competent suspension. 100 mu L of yeast competence and 10 mu L of linearized vector are uniformly mixed and transferred into a precooled electric rotating cup for electric shock conversion, and the condition of electric conversion is 1.5kV and 6 msec. After the shock, 1mL of sorbitol solution was added and transferred to a 1.5mL centrifuge tube and incubated at 30 ℃ for 1 h. Centrifuging at 5000rpm for 5min, collecting thallus, coating onto MD screening plate, and culturing upside down until positive monoclonal antibody grows out.
Detecting the activity of the zearalenone degrading enzyme:
definition of enzyme activity by HPLC: the amount of enzyme required to degrade 1. mu.g of zearalenone per minute is one unit U.
The method comprises the following steps: mu.L of enzyme supernatant + 50. mu.L of buffer (0.2 mol/LTris-HCl, pH 8.5) was mixed well.
Step two: mu.L of the mixture obtained in the above step (containing 25. mu.L of the enzyme supernatant) was added with 430. mu.L of buffer (0.2 mol/L Tris-HCl, pH 8.5) and 20. mu.L of zearalenone (500. mu.g/mL), reacted at 45 ℃ for 5min, and then 500. mu.L of acetonitrile was added to terminate the reaction.
Step three: and detecting the residual content of zearalenone by HPLC.
The reference conditions for high performance liquid chromatography were as follows:
a) a chromatographic column: a C18 column with a length of 150mm, an inner diameter of 4.6mm, a particle size of 4 μm, or an equivalent column;
b) mobile phase: acetonitrile-water-methanol (46: 46: 8, volume ratio);
c) flow rate: 1.0 mL/min;
d) detection wavelength: an excitation wavelength of 274nm and an emission wavelength of 440 nm;
e) sample introduction amount: 100 mu L of the solution;
f) temperature injection: 40 deg.C
Example 1: error-prone PCR (polymerase chain reaction) construction of zearalenone degrading enzyme mutant library and screening
Reference toClonostachys roseaThe amino acid sequence (SEQ ID NO: 1) and the optimized DNA sequence (SEQ ID NO: 2) of the zearalenone degrading enzyme are artificially synthesized, and an EcoR I restriction site is designed at the 5 'end and a Not I restriction site is designed at the 3' end. And carrying out double enzyme digestion on the synthesized gene fragment by using EcoR I and Not I, cutting and recovering glue, connecting the obtained product to a pET-21a (+) vector, transforming Escherichia coli DH5 alpha, screening positive clones by using an ampicillin-resistant LB plate, and carrying out sequencing verification to obtain a recombinant vector pET-YMDS 0 and a recombinant bacterium BL21-YMDS 0.
The PCR was performed using GeneMorph II random mutation PCR kit with SEQ ID NO: 2 as template, and carrying out random mutation by using the following primer sequences:
YMDS-F：AGAATTCATGCGCATTCGCAGCACAAT（SEQ ID NO：3）；
YMDS-R：AGCGGCCGCTCAAAGATACTTCTGCGTAG（SEQ ID NO：4）；
the EcoR I and Not I cleavage sites are underlined, respectively.
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 60s and extension at 72 ℃ for 5min for 30 cycles.
And carrying out double enzyme digestion on the amplified PCR product by using EcoR I and Not I, purifying and recycling the product, connecting the product to a pET-21a (+) vector, transforming escherichia coli BL21-DE3, coating the product on an ampicillin-resistant LB flat plate, screening positive clones to obtain a plurality of recombinant vectors pET-YMDSx and recombinant strains BL21-YMDSx, and numbering the vectors respectively.
The single colony of the positive recombinant strain BL21-YMDSx obtained by screening is inoculated to a 96-hole deep-well plate, and the single colony of 2 recombinant strains BL21-YMDS0 (expressing YMDS 0) is inoculated to each plate at the same time to serve as a control. Loading 300 mu L of LB liquid culture medium (containing 100 mu g/mL ampicillin) into each hole, carrying out shake culture at 37 ℃ and 200rpm for 4 hours, transferring 50 mu L of bacterial liquid to a new 96-hole plate for seed preservation, adding 200 mu L of LB-Amp culture medium containing IPTG into the residual bacterial liquid of the plate to ensure that the final concentration of IPTG is 1mM and the final concentration of ampicillin is 100 mu g/mL, and carrying out shake culture at 37 ℃ and 200rpm for 10 hours to induce and express zearalenone degrading enzyme; and (3) repeatedly freezing and thawing the induced bacterial liquid for crushing, centrifuging the crushed cell liquid, and taking supernatant, namely the crude enzyme liquid for later use.
The activity of the zearalenone degrading enzyme is measured by an HPLC method, and the enzyme activity of 3 zearalenone degrading enzyme mutants is obviously improved. The mutants were subjected to gene sequencing to obtain mutants each containing a single mutation of I3K, G23E or V251A, and designated as YMDS01, YMDS02 or YMDS03 in this order, using YMDS0 as a starting template. The amino acid sequence of YMDS01 is shown in SEQ ID NO: 5, the nucleotide sequence of the coding gene is shown as SEQ ID NO: 6 is shown in the specification; the amino acid sequence of YMDS02 is shown in SEQ ID NO: 7, the nucleotide sequence of the coding gene is shown as SEQ ID NO: 8 is shown in the specification; the amino acid sequence of YMDS03 is shown in SEQ ID NO: 9, the nucleotide sequence of the coding gene is shown as SEQ ID NO: shown at 10.
Example 2: expression of zearalenone degrading enzyme mutant in pichia pastoris GS115
Constructing artificially synthesized gene YMDS0 and zearalenone degrading enzyme mutants YMDS01, YMDS02 and YMDS03 screened in example 1 on pPIC9K plasmid to obtain expression vectors pPIC-YMDS0, pPIC-YMDS01, pPIC-YMDS02 and pPIC-YMDS03 of each mutant in pichia pastoris; the expression vector of each mutant is cut and linearized by Sal I and then is electrically transferred into Pichia pastoris GS115, and transformants of each mutant expression strain are obtained by screening an MD plate and are transferred into a YPD plate for activation.
The activated transformant is selected and inoculated in a BMGY culture medium, and after shaking culture at 30 ℃ for 18h, the thalli are obtained by centrifugation. Transferring a proper amount of thallus into a BMMY culture medium to enable the thallus concentration to reach OD600=1, continuing shaking culture, and adding methanol with the culture volume of 1% every 24 h. After the culture solution is induced and expressed for 96 hours, the culture solution is centrifuged to obtain a supernatant, each mutant is subjected to SDS-PAGE, transformants with higher protein expression amount, namely deeper bands are selected, and the transformants with higher enzyme activity can be considered to be the transformants with higher enzyme activity, and are subjected to strain preservation and 30L tank fermentation.
Example 3: fermentation and preparation of zearalenone degrading enzyme mutant in 30L fermentation tank
And (3) streaking the pichia pastoris preserved in a glycerol tube on a YPD plate, carrying out inverted culture at 30 ℃ for 3 days to grow a single colony, selecting the well-grown single colony, continuing streaking and culturing on the YPD plate, so as to activate the third generation to obtain the pichia pastoris single colony, inoculating the pichia pastoris single colony in 50mL of BMGY culture medium, and culturing at 30 ℃ and 200rpm for 24 hours. The seed solution was inoculated into 1000mL of BMGY medium at an inoculum size of 2%, cultured at 30 ℃ and 200rpm to an OD600 of 5, and used as a seed solution inoculation fermenter.
The fermentation production process comprises the following steps: BSM medium, pH4.8, temperature 30 ℃, stirring speed 500 rpm, ventilation 1.5(v/v), dissolved oxygen control in more than 20%.
The fermentation process is divided into three stages: (1) and (3) a thallus culture stage: inoculating the seed solution according to the proportion of 8%, and culturing at 30 ℃ for 20-24 h to exhaust the glycerol in the fermentation liquor; (2) a starvation stage: after the carbon source glycerol is exhausted, temporarily not supplementing any carbon source, and ending the starvation stage when the dissolved oxygen rises to 80%; (3) and (3) induction expression stage: adjusting the pH value to a required value by using ammonia water or phosphoric acid, adding methanol for induction, and keeping the dissolved oxygen at more than 20% for 160-200 h; after the fermentation is finished, the fermentation liquor is processed by a plate-and-frame filter to obtain a crude enzyme solution which is used for testing enzyme activity, enzymology property and application.
The enzyme activity measurement results are shown in figure 1: the enzyme activities of the mutants YMDS01, YMDS02 and YMDS03 are respectively improved by 35.5%, 22.4% and 18.5% compared with the original zearalenone degrading enzyme, and the obvious improvement of the degrading capability of the mutants on zearalenone is also shown.
Example 4: evaluation of enzymatic Properties of zearalenone degrading enzyme mutants
The crude enzyme solutions of the respective mutants obtained in example 3 were subjected to enzymatic characterization by a conventional method.
(1) Optimum reaction temperature: respectively reacting at 20 deg.C, 30 deg.C, 40 deg.C, 45 deg.C, 50 deg.C, 60 deg.C, and detecting enzyme activity by HPLC;
(2) optimum reaction pH: respectively reacting at pH 2.0, pH 3.0, pH 4.0, pH 5.0, pH6.0, pH7.0, pH 7.5, pH8.0, pH8.5, pH 9.0, pH 10.0, and detecting enzyme activity by HPLC method;
(3) pH tolerance experiment: respectively treating the crude enzyme solutions at 37 deg.C for 120min under different pH, and detecting residual enzyme activity;
(4) thermal stability: treating the crude enzyme solutions at 50 deg.C, 55 deg.C and 60 deg.C for 1min, and detecting residual enzyme activity;
(5) trypsin tolerance: respectively processing at 37 ℃ for 4h under the conditions of pH6.8 buffer and pH6.8 buffer plus trypsin, and then detecting the residual enzyme activity.
The results show that: the enzymatic properties of the mutants YMDS01, YMDS02, YMDS03 and the original gene YMDS0 are basically consistent; the optimal reaction temperature is 45 ℃, and the relative enzyme activity is more than 80 percent within the range of 35-50 ℃; optimum reaction pH8.0-8.5; the pH tolerance is high, the higher enzyme activity can be kept at the pH of 6-9, the enzyme activity is sharply reduced when the pH is less than 6, and the enzyme activity is reduced to below 50 percent when the pH is more than 10; heat stability, the residual enzyme activity is 83% after 1min of treatment at 50 ℃, and the residual enzyme activity is 30% after 1min of treatment at 60 ℃; after 4h of trypsin treatment, the inactivated enzyme is completely inactivated, which indicates that the enzyme can be completely digested in animals without residue.
Example 5: application experiment of zearalenone degrading enzyme mutant YMDS01
1. Degrading corn bran powder by using zearalenone degrading enzyme:
the experimental conditions are as follows: adding 20mL of water into 25g of corn bran powder, adding 5mL of enzyme solution (enzyme activity is 40U/mL) sodium hydroxide buffer solution, adjusting the pH value to 8.0, treating at 37 ℃ for different times, and detecting the residual content of Zearalenone (ZEN) by HPLC.
The result is shown in figure 2, the zearalenone degrading enzyme treats the corn bran powder for 3h, the zearalenone content is reduced to 258ppb from 2142ppb, the zearalenone residual content is only 113ppb after the treatment for 3h, and the zearalenone degrading enzyme has a remarkable ZEN degrading effect.
2. Degradation of DDGS (distillers dried grains with solubles) by zearalenone degrading enzyme:
50g of starting material (DDGS) were treated with 1400U of enzyme at pH8.0 and 37 ℃ for various times and the residual ZEN content was determined by HPLC.
The results are shown in FIG. 3: the ZEN content of untreated DDGS was 316ug/kg (0.316 ug/mL); adding enzyme, treating at 37 deg.C and pH7.0 for 24 hr to reduce ZEN to 92ug/kg, which is lower than 200ug/kg standard, and degrade at 70.89%; after 48h the ZEN content was slightly unchanged from that after 24 h.
3. Yeast culture for degrading zearalenone degrading enzyme
The yeast culture raw material composition is as follows: saccharomyces cerevisiae, corn steep liquor dry powder, corn germ meal, cane molasses and the like.
Adding 800U zearalenone degrading enzyme into 25g of raw material (adding 20mL of enzyme solution into 25g of raw material), treating at pH8.0 and 37 ℃ for different times, and detecting the residual content of ZEN by HPLC.
The results are shown in FIG. 4: treating for 0h, wherein the ZEN content is 3732 ug/kg; treating for 48 hours, wherein the ZEN content is 416ug/kg, and the degradation rate is 88.86%; treating for 72 hours, wherein the ZEN content is 111.6ug/kg, and the degradation rate is 97%; the treatment time is 96 hours, the ZEN content is 100ug/kg, and the degradation rate is 97.32%.
The enzymatic activity of the zearalenone degrading enzyme mutant obtained by the technical scheme of the invention is greatly improved compared with that of a wild type, and the mutant has a remarkable degrading effect on zearalenone, so that the mutant has good application potential in the fields of feed, food and the like, and has good market application prospect.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao root Biotechnology group Co., Ltd
<120> zearalenone degrading enzyme mutant with improved enzyme activity and encoding gene and application thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 264
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Arg Ile Arg Ser Thr Ile Ser Thr Pro Asn Gly Ile Thr Trp Tyr
1 5 10 15
Tyr Glu Gln Glu Gly Thr Gly Pro Asp Val Val Leu Val Pro Asp Gly
20 25 30
Leu Gly Glu Cys Gln Met Phe Asp Arg Ser Val Ser Gln Ile Ala Ala
35 40 45
Gln Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met Ser Arg Ser
50 55 60
Val Lys Ala Pro Pro Glu Thr Tyr Thr Glu Val Thr Ala Gln Lys Leu
65 70 75 80
Ala Ser Tyr Val Ile Ser Val Leu Asp Ala Leu Asp Ile Lys His Ala
85 90 95
Thr Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Val Ala Leu Leu
100 105 110
Leu Gly Tyr Pro Asp Arg Ile Arg Asn Ala Met Cys His Glu Leu Pro
115 120 125
Thr Lys Leu Leu Asp His Leu Ser Asn Thr Ala Val Leu Glu Asp Glu
130 135 140
Glu Ile Ser Lys Ile Leu Ala Asn Val Met Leu Asn Asp Val Ser Gly
145 150 155 160
Gly Ser Glu Ala Trp Gln Ala Met Gly Asp Glu Val His Ala Arg Leu
165 170 175
His Lys Asn Tyr Pro Val Trp Ala Arg Gly Tyr Pro Arg Thr Ile Pro
180 185 190
Pro Ser Ala Pro Val Lys Asp Leu Glu Ala Leu Arg Gly Lys Pro Leu
195 200 205
Asp Trp Thr Val Gly Ala Ala Thr Pro Thr Glu Ser Phe Phe Asp Asn
210 215 220
Ile Val Thr Ala Thr Lys Ala Gly Val Asn Ile Gly Leu Leu Pro Gly
225 230 235 240
Met His Phe Pro Tyr Val Ser His Pro Asp Val Phe Ala Lys Tyr Val
245 250 255
Val Glu Thr Thr Gln Lys Tyr Leu
260
<210> 2
<211> 795
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgcgcattc gcagcacaat ctcgaccccg aatggcatca cctggtacta tgagcaggag 60
ggtaccggac ccgacgttgt cctcgtccct gatgggctcg gagaatgcca gatgtttgac 120
cgctccgtgt cgcagattgc tgctcaaggc ttcagggtca ctacgtttga tatgcccgga 180
atgtcccggt ctgtgaaggc accacccgag acctacactg aggtcacggc ccagaagctg 240
gcttcctatg tcatctccgt cctggatgct cttgacatca agcacgctac tgtctggggc 300
tgcagctcag gagcttccac cgtcgtggcg ctgttgctcg gttaccccga caggatacgc 360
aacgccatgt gccacgaact gccaacaaag ctactggacc acctttcaaa caccgctgtg 420
ctcgaagacg aggaaatctc aaagatcctg gccaatgtaa tgttgaacga cgtgtctgga 480
ggctcggagg cgtggcaagc catgggggac gaggtgcacg cgagactgca caagaactac 540
ccggtttggg ctcgaggata ccctcgcact attcctccct cagctccggt taaggatctg 600
gaggctctgc gtgggaagcc cctggactgg actgtcggcg ctgcgacacc aaccgagtct 660
ttctttgaca acattgttac cgctaccaag gctggtgtca acattgggtt gcttccaggg 720
atgcatttcc cttatgtttc ccacccggac gttttcgcta aatatgttgt ggaaactacg 780
cagaagtatc tttga 795
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agaattcatg cgcnnncgca gcacaat 27
<210> 4
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agcggccgct caaagatact tctgcgtag 29
<210> 5
<211> 264
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Arg Lys Arg Ser Thr Ile Ser Thr Pro Asn Gly Ile Thr Trp Tyr
1 5 10 15
Tyr Glu Gln Glu Gly Thr Gly Pro Asp Val Val Leu Val Pro Asp Gly
20 25 30
Leu Gly Glu Cys Gln Met Phe Asp Arg Ser Val Ser Gln Ile Ala Ala
35 40 45
Gln Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met Ser Arg Ser
50 55 60
Val Lys Ala Pro Pro Glu Thr Tyr Thr Glu Val Thr Ala Gln Lys Leu
65 70 75 80
Ala Ser Tyr Val Ile Ser Val Leu Asp Ala Leu Asp Ile Lys His Ala
85 90 95
Thr Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Val Ala Leu Leu
100 105 110
Leu Gly Tyr Pro Asp Arg Ile Arg Asn Ala Met Cys His Glu Leu Pro
115 120 125
Thr Lys Leu Leu Asp His Leu Ser Asn Thr Ala Val Leu Glu Asp Glu
130 135 140
Glu Ile Ser Lys Ile Leu Ala Asn Val Met Leu Asn Asp Val Ser Gly
145 150 155 160
Gly Ser Glu Ala Trp Gln Ala Met Gly Asp Glu Val His Ala Arg Leu
165 170 175
His Lys Asn Tyr Pro Val Trp Ala Arg Gly Tyr Pro Arg Thr Ile Pro
180 185 190
Pro Ser Ala Pro Val Lys Asp Leu Glu Ala Leu Arg Gly Lys Pro Leu
195 200 205
Asp Trp Thr Val Gly Ala Ala Thr Pro Thr Glu Ser Phe Phe Asp Asn
210 215 220
Ile Val Thr Ala Thr Lys Ala Gly Val Asn Ile Gly Leu Leu Pro Gly
225 230 235 240
Met His Phe Pro Tyr Val Ser His Pro Asp Val Phe Ala Lys Tyr Val
245 250 255
Val Glu Thr Thr Gln Lys Tyr Leu
260
<210> 6
<211> 795
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atgcgcaaac gcagcacaat ctcgaccccg aatggcatca cctggtacta tgagcaggag 60
ggtaccggac ccgacgttgt cctcgtccct gatgggctcg gagaatgcca gatgtttgac 120
cgctccgtgt cgcagattgc tgctcaaggc ttcagggtca ctacgtttga tatgcccgga 180
atgtcccggt ctgtgaaggc accacccgag acctacactg aggtcacggc ccagaagctg 240
gcttcctatg tcatctccgt cctggatgct cttgacatca agcacgctac tgtctggggc 300
tgcagctcag gagcttccac cgtcgtggcg ctgttgctcg gttaccccga caggatacgc 360
aacgccatgt gccacgaact gccaacaaag ctactggacc acctttcaaa caccgctgtg 420
ctcgaagacg aggaaatctc aaagatcctg gccaatgtaa tgttgaacga cgtgtctgga 480
ggctcggagg cgtggcaagc catgggggac gaggtgcacg cgagactgca caagaactac 540
ccggtttggg ctcgaggata ccctcgcact attcctccct cagctccggt taaggatctg 600
gaggctctgc gtgggaagcc cctggactgg actgtcggcg ctgcgacacc aaccgagtct 660
ttctttgaca acattgttac cgctaccaag gctggtgtca acattgggtt gcttccaggg 720
atgcatttcc cttatgtttc ccacccggac gttttcgcta aatatgttgt ggaaactacg 780
cagaagtatc tttga 795
<210> 7
<211> 264
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Met Arg Ile Arg Ser Thr Ile Ser Thr Pro Asn Gly Ile Thr Trp Tyr
1 5 10 15
Tyr Glu Gln Glu Gly Thr Glu Pro Asp Val Val Leu Val Pro Asp Gly
20 25 30
Leu Gly Glu Cys Gln Met Phe Asp Arg Ser Val Ser Gln Ile Ala Ala
35 40 45
Gln Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met Ser Arg Ser
50 55 60
Val Lys Ala Pro Pro Glu Thr Tyr Thr Glu Val Thr Ala Gln Lys Leu
65 70 75 80
Ala Ser Tyr Val Ile Ser Val Leu Asp Ala Leu Asp Ile Lys His Ala
85 90 95
Thr Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Val Ala Leu Leu
100 105 110
Leu Gly Tyr Pro Asp Arg Ile Arg Asn Ala Met Cys His Glu Leu Pro
115 120 125
Thr Lys Leu Leu Asp His Leu Ser Asn Thr Ala Val Leu Glu Asp Glu
130 135 140
Glu Ile Ser Lys Ile Leu Ala Asn Val Met Leu Asn Asp Val Ser Gly
145 150 155 160
Gly Ser Glu Ala Trp Gln Ala Met Gly Asp Glu Val His Ala Arg Leu
165 170 175
His Lys Asn Tyr Pro Val Trp Ala Arg Gly Tyr Pro Arg Thr Ile Pro
180 185 190
Pro Ser Ala Pro Val Lys Asp Leu Glu Ala Leu Arg Gly Lys Pro Leu
195 200 205
Asp Trp Thr Val Gly Ala Ala Thr Pro Thr Glu Ser Phe Phe Asp Asn
210 215 220
Ile Val Thr Ala Thr Lys Ala Gly Val Asn Ile Gly Leu Leu Pro Gly
225 230 235 240
Met His Phe Pro Tyr Val Ser His Pro Asp Val Phe Ala Lys Tyr Val
245 250 255
Val Glu Thr Thr Gln Lys Tyr Leu
260
<210> 8
<211> 795
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atgcgcattc gcagcacaat ctcgaccccg aatggcatca cctggtacta tgagcaggag 60
ggtaccgaac ccgacgttgt cctcgtccct gatgggctcg gagaatgcca gatgtttgac 120
cgctccgtgt cgcagattgc tgctcaaggc ttcagggtca ctacgtttga tatgcccgga 180
atgtcccggt ctgtgaaggc accacccgag acctacactg aggtcacggc ccagaagctg 240
gcttcctatg tcatctccgt cctggatgct cttgacatca agcacgctac tgtctggggc 300
tgcagctcag gagcttccac cgtcgtggcg ctgttgctcg gttaccccga caggatacgc 360
aacgccatgt gccacgaact gccaacaaag ctactggacc acctttcaaa caccgctgtg 420
ctcgaagacg aggaaatctc aaagatcctg gccaatgtaa tgttgaacga cgtgtctgga 480
ggctcggagg cgtggcaagc catgggggac gaggtgcacg cgagactgca caagaactac 540
ccggtttggg ctcgaggata ccctcgcact attcctccct cagctccggt taaggatctg 600
gaggctctgc gtgggaagcc cctggactgg actgtcggcg ctgcgacacc aaccgagtct 660
ttctttgaca acattgttac cgctaccaag gctggtgtca acattgggtt gcttccaggg 720
atgcatttcc cttatgtttc ccacccggac gttttcgcta aatatgttgt ggaaactacg 780
cagaagtatc tttga 795
<210> 9
<211> 264
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 9
Met Arg Ile Arg Ser Thr Ile Ser Thr Pro Asn Gly Ile Thr Trp Tyr
1 5 10 15
Tyr Glu Gln Glu Gly Thr Gly Pro Asp Val Val Leu Val Pro Asp Gly
20 25 30
Leu Gly Glu Cys Gln Met Phe Asp Arg Ser Val Ser Gln Ile Ala Ala
35 40 45
Gln Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met Ser Arg Ser
50 55 60
Val Lys Ala Pro Pro Glu Thr Tyr Thr Glu Val Thr Ala Gln Lys Leu
65 70 75 80
Ala Ser Tyr Val Ile Ser Val Leu Asp Ala Leu Asp Ile Lys His Ala
85 90 95
Thr Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Val Ala Leu Leu
100 105 110
Leu Gly Tyr Pro Asp Arg Ile Arg Asn Ala Met Cys His Glu Leu Pro
115 120 125
Thr Lys Leu Leu Asp His Leu Ser Asn Thr Ala Val Leu Glu Asp Glu
130 135 140
Glu Ile Ser Lys Ile Leu Ala Asn Val Met Leu Asn Asp Val Ser Gly
145 150 155 160
Gly Ser Glu Ala Trp Gln Ala Met Gly Asp Glu Val His Ala Arg Leu
165 170 175
His Lys Asn Tyr Pro Val Trp Ala Arg Gly Tyr Pro Arg Thr Ile Pro
180 185 190
Pro Ser Ala Pro Val Lys Asp Leu Glu Ala Leu Arg Gly Lys Pro Leu
195 200 205
Asp Trp Thr Val Gly Ala Ala Thr Pro Thr Glu Ser Phe Phe Asp Asn
210 215 220
Ile Val Thr Ala Thr Lys Ala Gly Val Asn Ile Gly Leu Leu Pro Gly
225 230 235 240
Met His Phe Pro Tyr Val Ser His Pro Asp Ala Phe Ala Lys Tyr Val
245 250 255
Val Glu Thr Thr Gln Lys Tyr Leu
260
<210> 10
<211> 795
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atgcgcattc gcagcacaat ctcgaccccg aatggcatca cctggtacta tgagcaggag 60
ggtaccggac ccgacgttgt cctcgtccct gatgggctcg gagaatgcca gatgtttgac 120
cgctccgtgt cgcagattgc tgctcaaggc ttcagggtca ctacgtttga tatgcccgga 180
atgtcccggt ctgtgaaggc accacccgag acctacactg aggtcacggc ccagaagctg 240
gcttcctatg tcatctccgt cctggatgct cttgacatca agcacgctac tgtctggggc 300
tgcagctcag gagcttccac cgtcgtggcg ctgttgctcg gttaccccga caggatacgc 360
aacgccatgt gccacgaact gccaacaaag ctactggacc acctttcaaa caccgctgtg 420
ctcgaagacg aggaaatctc aaagatcctg gccaatgtaa tgttgaacga cgtgtctgga 480
ggctcggagg cgtggcaagc catgggggac gaggtgcacg cgagactgca caagaactac 540
ccggtttggg ctcgaggata ccctcgcact attcctccct cagctccggt taaggatctg 600
gaggctctgc gtgggaagcc cctggactgg actgtcggcg ctgcgacacc aaccgagtct 660
ttctttgaca acattgttac cgctaccaag gctggtgtca acattgggtt gcttccaggg 720
atgcatttcc cttatgtttc ccacccggac gctttcgcta aatatgttgt ggaaactacg 780
cagaagtatc tttga 795
Claims (10)
1. The zearalenone degrading enzyme mutant YMDS01 with improved enzyme activity is characterized in that the amino acid sequence of the zearalenone degrading enzyme mutant YMDS01 is shown as SEQ ID NO: 5 is shown in the specification; the zearalenone degrading enzyme mutant YMDS01 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to the amino acid sequence of isoleucine at position 3 of the zearalenone degrading enzyme to lysine.
2. The gene encoding zearalenone degrading enzyme mutant YMDS01 according to claim 1, wherein the nucleotide sequence of the gene encoding zearalenone degrading enzyme mutant YMDS01 is as shown in SEQ ID NO: and 6.
3. The zearalenone degrading enzyme mutant YMDS02 with improved enzyme activity is characterized in that the amino acid sequence of the zearalenone degrading enzyme mutant YMDS02 is shown as SEQ ID NO: 7 is shown in the specification; the zearalenone degrading enzyme mutant YMDS02 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to glutamic acid into glycine at position 23 of the zearalenone degrading enzyme.
4. The gene encoding zearalenone degrading enzyme mutant YMDS02 of claim 3, wherein the nucleotide sequence of the gene encoding zearalenone degrading enzyme mutant YMDS02 is as shown in SEQ ID NO: shown in fig. 8.
5. The zearalenone degrading enzyme mutant YMDS03 with improved enzyme activity is characterized in that the amino acid sequence of the zearalenone degrading enzyme mutant YMDS03 is shown as SEQ ID NO: 9 is shown in the figure; the zearalenone degrading enzyme mutant YMDS03 is prepared by a polypeptide with an amino acid sequence of SEQ ID NO: 1 to the 251 th valine of the zearalenone degrading enzyme into alanine.
6. The gene encoding zearalenone degrading enzyme mutant YMDS03 according to claim 5, wherein the nucleotide sequence of the gene encoding zearalenone degrading enzyme mutant YMDS03 is as shown in SEQ ID NO: shown at 10.
7. A recombinant strain comprising the gene encoding zearalenone degrading enzyme mutant YMDS01 according to claim 2, the gene encoding zearalenone degrading enzyme mutant YMDS02 according to claim 4, or the gene encoding zearalenone degrading enzyme mutant YMDS03 according to claim 6.
8. Use of zearalenone degrading enzyme mutant YMDS01 as claimed in claim 1, or zearalenone degrading enzyme mutant YMDS02 as claimed in claim 3, or zearalenone degrading enzyme mutant YMDS03 as claimed in claim 5 for the preparation of a biological agent for degrading zearalenone.
9. Use according to claim 8, characterized in that: the reaction temperature of the zearalenone degrading enzyme mutant YMDS01, the zearalenone degrading enzyme mutant YMDS02 and the zearalenone degrading enzyme mutant YMDS03 is 35-50 ℃.
10. Use according to claim 8, characterized in that: the reaction pH of the zearalenone degrading enzyme mutant YMDS01, the zearalenone degrading enzyme mutant YMDS02 and the zearalenone degrading enzyme mutant YMDS03 is 6-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110157570.1A CN112961846B (en) | 2021-02-05 | 2021-02-05 | Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110157570.1A CN112961846B (en) | 2021-02-05 | 2021-02-05 | Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112961846A true CN112961846A (en) | 2021-06-15 |
| CN112961846B CN112961846B (en) | 2022-03-01 |
Family
ID=76274144
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110157570.1A Active CN112961846B (en) | 2021-02-05 | 2021-02-05 | Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112961846B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113308449A (en) * | 2021-06-24 | 2021-08-27 | 江南大学 | Mutant S162P of zearalenone lactone hydrolase with improved thermal stability and application thereof |
| CN113563481A (en) * | 2021-07-13 | 2021-10-29 | 江南大学 | Aflatoxin B capable of being degraded simultaneously1Construction method and application of mutant of zearalenone fusion enzyme |
| CN113564143A (en) * | 2021-07-13 | 2021-10-29 | 江南大学 | Construction method and application of mutant of hydrolase capable of degrading zearalenone |
| CN113755468A (en) * | 2021-09-08 | 2021-12-07 | 暨南大学 | Zearalenone hydrolase with improved resistance to trypsin |
| CN114774386A (en) * | 2022-03-11 | 2022-07-22 | 暨南大学 | Zearalenone hydrolase with improved resistance to pepsin |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085306A (en) * | 2018-01-05 | 2018-05-29 | 湖北大学 | A kind of zearalenone degrading enzyme mutants and its encoding gene and application |
| CN108251398A (en) * | 2016-12-29 | 2018-07-06 | 中粮营养健康研究院有限公司 | A kind of zearalenone degrading enzyme and its gene and preparation method and application and the method for degrading zearalenone |
| CN110054702A (en) * | 2019-04-20 | 2019-07-26 | 中国农业科学院饲料研究所 | Zearalenone degradation enzyme fusion proteins and its encoding gene and application |
| CN110564707A (en) * | 2019-09-02 | 2019-12-13 | 中国农业科学院饲料研究所 | Zearalenone hydrolase mutant ZHDM1 and coding gene and application thereof |
| CN110669745A (en) * | 2019-10-25 | 2020-01-10 | 江南大学 | Zearalenone degrading enzyme mutant with improved thermal stability and application thereof |
-
2021
- 2021-02-05 CN CN202110157570.1A patent/CN112961846B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251398A (en) * | 2016-12-29 | 2018-07-06 | 中粮营养健康研究院有限公司 | A kind of zearalenone degrading enzyme and its gene and preparation method and application and the method for degrading zearalenone |
| CN108085306A (en) * | 2018-01-05 | 2018-05-29 | 湖北大学 | A kind of zearalenone degrading enzyme mutants and its encoding gene and application |
| CN110054702A (en) * | 2019-04-20 | 2019-07-26 | 中国农业科学院饲料研究所 | Zearalenone degradation enzyme fusion proteins and its encoding gene and application |
| CN110564707A (en) * | 2019-09-02 | 2019-12-13 | 中国农业科学院饲料研究所 | Zearalenone hydrolase mutant ZHDM1 and coding gene and application thereof |
| CN110669745A (en) * | 2019-10-25 | 2020-01-10 | 江南大学 | Zearalenone degrading enzyme mutant with improved thermal stability and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| MIN LIN ET AL.: "Computational design of enhanced detoxification activity of a zearalenone lactonase from Clonostachys rosea in acidic medium", 《ROYAL SOCIETY OF CHEMISTRY》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113308449A (en) * | 2021-06-24 | 2021-08-27 | 江南大学 | Mutant S162P of zearalenone lactone hydrolase with improved thermal stability and application thereof |
| CN113308449B (en) * | 2021-06-24 | 2022-09-27 | 江南大学 | Mutant S162P of zearalenone lactone hydrolase with improved thermal stability and application thereof |
| CN113563481A (en) * | 2021-07-13 | 2021-10-29 | 江南大学 | Aflatoxin B capable of being degraded simultaneously1Construction method and application of mutant of zearalenone fusion enzyme |
| CN113564143A (en) * | 2021-07-13 | 2021-10-29 | 江南大学 | Construction method and application of mutant of hydrolase capable of degrading zearalenone |
| CN113563481B (en) * | 2021-07-13 | 2023-04-28 | 江南大学 | Can simultaneously degrade aflatoxin B 1 Construction method and application of mutant of fusion enzyme with zearalenone |
| CN113564143B (en) * | 2021-07-13 | 2023-08-25 | 江南大学 | Construction method and application of mutant of hydrolase capable of degrading zearalenone |
| CN113755468A (en) * | 2021-09-08 | 2021-12-07 | 暨南大学 | Zearalenone hydrolase with improved resistance to trypsin |
| CN113755468B (en) * | 2021-09-08 | 2023-06-30 | 暨南大学 | Zearalenone hydrolase with improved resistance to trypsin |
| CN114774386A (en) * | 2022-03-11 | 2022-07-22 | 暨南大学 | Zearalenone hydrolase with improved resistance to pepsin |
| CN114774386B (en) * | 2022-03-11 | 2024-02-02 | 暨南大学 | Zearalenone hydrolase with improved pepsin resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112961846B (en) | 2022-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112961846B (en) | Zearalenone degrading enzyme mutant with improved enzyme activity and coding gene and application thereof | |
| CN112646792B (en) | Low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application | |
| CN110042092B (en) | Xylanase mutant with improved stability and coding gene and application thereof | |
| CN107099521B (en) | Acid-resistant zearalenone detoxifying enzyme and coding gene and application thereof | |
| CN111549018B (en) | Protease mutant with improved thermal stability as well as coding gene and application thereof | |
| CN113563481B (en) | Can simultaneously degrade aflatoxin B 1 Construction method and application of mutant of fusion enzyme with zearalenone | |
| CN111394326B (en) | Vomitoxin degrading enzyme DDH and application thereof in detoxification of trichothecene toxins | |
| CN110684754B (en) | Mycotoxin ZEN degrading enzyme mutant and application thereof | |
| CN114164193B (en) | Phytase mutant with improved thermal stability and protease resistance as well as preparation method and application thereof | |
| CN114107266B (en) | Protease mutant with improved heat resistance, encoding gene and application thereof | |
| CN113801240B (en) | D-psicose-3-epimerase activity aggregate and preparation method and application thereof | |
| CN107858364B (en) | High-temperature-resistant high-specific-activity bacterial phytase gene suitable for methanol yeast expression | |
| CN109997970B (en) | Acidic xylanase mutant with improved enzyme activity and heat resistance, and coding gene and application thereof | |
| CN116064492B (en) | Recombinant amidohydrolase with high activity, encoding gene, recombinant vector and application thereof | |
| CN109337845B (en) | Acinetobacter Y-3L-asparaginase gene and expression and application thereof | |
| CN116790564A (en) | Heat-resistant protease mutant and encoding gene and application thereof | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN112430611A (en) | Optimized zearalenone degrading enzyme ZHD-P encoding gene, recombinant thallus, surface display system and application | |
| CN114958893A (en) | Construction method of lactase required by preparation of high-temperature creep feed for porkets | |
| CN110951716B (en) | Circumscribed alginate lyase VsAly7D, recombinant strain thereof and application thereof | |
| CN111549007A (en) | Transaminase TSTA, preparation method and application | |
| US20020068349A1 (en) | Gene encoding recombinant trehalose phosphorylase, vector containing the gene, transformant transformed by the gene, and method for producing recombinant trehalose phosphorylase with the use of transformant | |
| CN115851787B (en) | Leucine aminopeptidase producing gene, bacillus subtilis, construction method and application | |
| CN115161307B (en) | Specific carboxypeptidase for preparing high F value oligopeptide from aspergillus oryzae | |
| CN115044565B (en) | Biliverdin reductase mutant and encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |