CN110938679B - Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency - Google Patents
Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency Download PDFInfo
- Publication number
- CN110938679B CN110938679B CN201911106923.4A CN201911106923A CN110938679B CN 110938679 B CN110938679 B CN 110938679B CN 201911106923 A CN201911106923 A CN 201911106923A CN 110938679 B CN110938679 B CN 110938679B
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- seq
- yeast
- pac2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
A kind ofA method for quantitatively detecting the recombination of telomeres of different chromosomes of yeast with high sensitivity and high efficiency belongs to the technical field of bioengineering. The method specifically comprises the following steps: carrying out multiple sequence alignment analysis on DNA sequences of 19Y' elements positioned in a subtelomere region in a yeast database to determine fragments of a consensus sequence; designing a real-time quantitative PCR analysis primer by utilizing the fragments of the consensus sequence, and designing a primer as an internal reference by utilizing a gene sequence close to the centromere; carrying out real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer; by 2 －ΔΔCT The method determines the copy number of the Y' element in the mutant cell relative to the wild-type cell. The method has the advantages of extremely high sensitivity, quantification, simple operation, short required time, particular suitability for trace genome DNA samples, high-throughput analysis and the like.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a method for quantitatively detecting different chromosome telomere recombinations of yeast (Quantitative sub-temporal amplification assisted chromosome chromosomes by PCR, qSACH for short) with high sensitivity and high efficiency, and more particularly relates to a method for quantitatively analyzing the copy number of Y' elements in subtelomere regions in a yeast genome with high sensitivity and high efficiency.
Background
Saccharomyces cerevisiae (Saccharomyces cerevisiae) is the yeast most widely related to human beings, and is used as a eukaryotic model organism in fundamental disciplines such as modern molecular and cell biology, and the action and the position of the yeast are equivalent to prokaryotic model organism Escherichia coli.
At present, the widely used method for detecting yeast subtelomere region recombination is to digest genomic DNA by using restriction enzymes XhoI or PstI and then to use isotope 32 P, digoxin, fluorescein or biotin labeled telomere DNA TG 1-3 Or probes specific for the Y' element for nucleic acid imprinting analysis. The method needs a large amount of genome DNA (generally, at least microgram-grade genome DNA), is complex to operate, consumes long time, cannot realize high throughput, and has high quantitative analysis difficulty.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to design and provide a technical scheme of a method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency.
The invention is realized by the following technical scheme:
the method for quantitatively detecting the recombination of the telomeres of different chromosomes of the yeast with high sensitivity and high efficiency is characterized by comprising the following steps of:
1) Multiple Sequence Alignment analysis (Multiple Sequence Alignment) was performed on the DNA sequences of 19Y' elements located in the subtelomeric region in the yeast database (Saccharomyces genome database, www.yeastgenome.org) to determine fragments of consensus sequences;
2) Designing a real-time quantitative PCR analysis primer by using the fragment of the consensus sequence obtained in the step 1), and designing a primer as an internal reference by using a gene sequence close to a centromere (far away from a subtelomere region);
3) Carrying out real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer obtained in the step 2);
4) By 2 －ΔΔCT The method utilizes the following equation to determine the copy number of the Y' element in the mutant cell relative to the wild-type cell:
2 [ - (CT (wild type gene near centromere) -CT (wild type Y ')) - (CT (mutant gene near centromere) -CT (mutant Y')) ], wherein CT represents the cycle number at which half the maximum amplification of the PCR amplification occurs.
The method for quantitatively detecting the recombination of different chromosome telomeres of the yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR analysis primers in the step 2) comprise Y '#1, Y' #2, Y '#3, Y' #4, Y '#5, Y' #6, Y '#7, Y' #8, Y '#9 and Y' #10, wherein the sequence of the Y '#1 u F primer is shown as SEQ ID No.1, the sequence of the Y' #1 u R primer is shown as SEQ ID No.2, the sequence of the Y '#2 u F primer is shown as SEQ ID No.3, the sequence of the Y' #2 u R primer is shown as SEQ ID No.4, the sequence of the Y '#3 u F primer is shown as SEQ ID No.5, the sequence of the Y' #3 u R primer is shown as SEQ ID No.6, and the sequence of the Y '#4 u F primer is shown as SEQ ID No.7, the sequence of the Y' #4 \_R primer is shown as SEQ ID No.8, the sequence of the Y '#5 \uF primer is shown as SEQ ID No.9, the sequence of the Y' #5 \uR primer is shown as SEQ ID No.10, the sequence of the Y '#6 \uF primer is shown as SEQ ID No.11, the sequence of the Y' #6 \uR primer is shown as SEQ ID No.12, the sequence of the Y '#7 \uF primer is shown as SEQ ID No.13, the sequence of the Y' #7 \uR primer is shown as SEQ ID No.14, the sequence of the Y '#8 \uF primer is shown as SEQ ID No.15, the sequence of the Y' #8 \uR primer is shown as SEQ ID No.16, the sequence of the Y '#9 \uF primer is shown as SEQ ID No.17, the sequence of the Y' #9 _Rprimer is shown as SEQ ID No.18, the sequence of the Y '# 10 _Fprimer is shown as SEQ ID No.19, and the sequence of the Y' # 10 _Ris shown as SEQ ID No. 20.
The method for quantitatively detecting the recombination of different chromosome telomeres of the yeast with high sensitivity and high efficiency is characterized in that a gene sequence close to the centromere in the step 2) is a gene PAC2 sequence, internal reference primers are PAC2-F and PAC2-R, the PAC2-F primer sequence is shown as SEQ ID No.21, and the PAC2-R primer sequence is shown as SEQ ID No. 22.
The method for quantitatively detecting the recombination of the telomeres of different chromosomes of the yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR conditions in the step 3) are as follows: one cycle at 95 ℃ for 3 minutes; following 40 PCR cycles: denaturation at 95 ℃ for 5 seconds, annealing at 55 ℃ for 30 seconds, and elongation at 72 ℃ for 20 seconds; melting curves of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
The PCR primer for quantitatively detecting the recombination of different chromosome telomeres of yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR analysis primer in the step 2) comprises Y '#1, Y' #2, Y '#3, Y' #4, Y '#5, Y' #6, Y '#7, Y' #8, Y '#9 and Y' #10, wherein the sequence of the Y '#1 u F primer is shown as SEQ ID No.1, the sequence of the Y' #1 u R primer is shown as SEQ ID No.2, the sequence of the Y '#2 u F primer is shown as SEQ ID No.3, the sequence of the Y' #2 u R primer is shown as SEQ ID No.4, the sequence of the Y '#3 u F primer is shown as SEQ ID No.5, the sequence of the Y' #3 u R primer is shown as SEQ ID No.6, and the sequence of the Y '#4 u F primer is shown as SEQ ID No.7, the sequence of the Y' #4 \_R primer is shown as SEQ ID No.8, the sequence of the Y '#5 \uF primer is shown as SEQ ID No.9, the sequence of the Y' #5 \uR primer is shown as SEQ ID No.10, the sequence of the Y '#6 \uF primer is shown as SEQ ID No.11, the sequence of the Y' #6 \uR primer is shown as SEQ ID No.12, the sequence of the Y '#7 \uF primer is shown as SEQ ID No.13, the sequence of the Y' #7 \uR primer is shown as SEQ ID No.14, the sequence of the Y '#8 \uF primer is shown as SEQ ID No.15, the sequence of the Y' #8 \uR primer is shown as SEQ ID No.16, the sequence of the Y '#9 \uF primer is shown as SEQ ID No.17, the sequence of the Y' #9 \uR primer is shown as SEQ ID No.18, the sequence of the Y '# 10 _Fprimer is shown as SEQ ID No.19, and the sequence of the Y' #10 _Rprimer is shown as SEQ ID No. 20.
The high-sensitivity high-efficiency quantitative detection method for yeast different chromosome telomere recombination is applied to various fields of biology, medicine, biomedicine and various categories contained in the biomedicine, such as genetics, forensic medicine and the like, for example, (1) the method is used for monitoring the aging degree of saccharomyces cerevisiae and the like, and for example, (2) the method is modified and used for other organisms and the like on the basis of the method.
The method for quantitatively detecting the recombination of different chromosome telomeres of the yeast with high sensitivity and high efficiency has the advantages of extremely high sensitivity, high quantification, simple operation, short required time, particular suitability for trace genome DNA samples, high-throughput analysis and the like. The method can analyze the DNA recombination level of the subtelomere region only by pg-ng level genome DNA.
Drawings
FIG. 1 is a graph comparing conventional Southern blot (Southern blot) with a novel method for detecting subtelomeric region recombination.
After 6 serial passages of WT (wild type) and YKU 80. DELTA. MRE 11. DELTA. (YKU 80 and MRE11 knock-out) strains on YPD (1% yeast extract, 2% peptone, 2% glucose and 2% agar powder) solid medium, the cells were harvested to extract genomic DNA. In FIG. 1, (A) there are 19Y' elements in 17 out of 32 telomeres of 16 chromosomes in yeast, and we found 12 longer consensus sequences (but not limited to) by multiple sequence alignment. (B) The principle schematic diagram of the new method for detecting the subtelomeric region recombination method. 17 chromosomes have 19Y' elements in total, 12 segments of common sequences are found through multiple sequence alignment, and 10 pairs of primers for real-time quantitative analysis of subtelomere region recombination are designed from the common sequences. (C) About 2. Mu.g of genomic DNA was digested with restriction enzyme XhoI overnight, separated on a 1.2% agarose gel and Southern Blot, digoxigenin-labeled TG 1-3 The probe detects subtelomere recombination. (D) The genomic DNA samples (diluted 30-fold) in the 10-pair primer set (C) in the newly created cube method were analyzed, and the amount of the analyzed genomic DNA was reduced to about several nanograms. Statistical analysis by two-tailed student's t-test, p<0.05。
FIG. 2 shows the dissolution curves of real-time quantitative PCR amplification products for PAC2-F & PAC2-R, Y '#1-F & Y' #1-R, Y '#3-F & Y' #3-R, Y '#4-F & Y' #4-R, Y '#5-F & Y' #5-RY '#10-F & Y' # 10-R.
FIG. 3 shows the dissolution curves of real-time PCR amplification products for PAC2-F & PAC2-R, Y '#2-F & Y' #2-R, Y '#6-F & Y' #6-R, Y '#7-F & Y' #7-R, Y '#8-F & Y' #8-R, and Y '#9-F & Y' # 9-R.
Detailed Description
The present invention is further described below in conjunction with specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. These examples are merely illustrative and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and substitutions are intended to be within the scope of the invention.
Example 1: design of real-time quantitative PCR analysis primers
By multiple sequence alignment analysis of DNA sequences of 19Y' elements (from www.yeastgenome. Org) in the genome of Saccharomyces cerevisiae (Saccharomyces cerevisiae) (not limited to the S288C background, including other background species) the following 12 longer consensus fragments were obtained (not limited to these 12 consensus fragments, but there are also a number of consensus fragments not listed):
#1 (91 bases)
ACAAAAACGACTTGGTACATTGTCCCTCAATAACTTTATTTGAATCGATCCCCACGGAAGTGCGGTCATTCTACGAAGACGAAAAGTCTGG
#2 (106 bases)
TGATGGTCTACACGTTGTTTCAAGTGCATACTTTGAAATTCAATAGAAAGGATTACGATACCCTTTCTCTTTTTTACCTCAACAGAGGATACTATAATGAGTTGAG
#3 (73 bases)
CAAGCAAGTTTACCTGGCGAAAAGAAAGTCGACACAGAGCGGCTGAAGCGTGATCTATGCCCACGTAAACCCA
#4 (97 bases)
ATGAAATATACATGGCAGACACACCCTCTGTGGCAGTACAGGCCCCACCGGGCTATGGTAAGACGGAGTTATTTCATCTCCCCTTGATAGCACTGGC
#5 (147 bases)
CGATGGCGTTACTGATTTATACGTGGGGATCTACGATGATCTTGCTAGCACTAATTTCACAGACAGGATAGCTGCGTGGGAGAATATTGTTGAGTGCACCTTTAGGACCAACAACGTAAAATTGGGTTACCTCATTGTAGATGAGTT
#6 (101 bases)
CACAACTTTGAAACGGAGGTCTACCGGCAGTCGCAATTTGGGGGCATAACTAACCTTGATTTTGACGCTTTTGAGAAAGCAATCTTTTTGAGCGGCACAGC
#7 (96 bases)
TCGATGGACATCAACGAGCTCAAACGGTCGGAAGATCTCAGCAGAGGTCTATCCAGCTATCCAACACGGATGTTTAATCTAATCAAGGAGAAATCC
#8 (107 bases)
TGAACCAGAGTCGAAGGCCATTGTAGTTGCAAGCACAACCAACGAAGTGGAAGAATTGGCCTGCTCTTGGAGAAAGTATTTTAGGGTGGTATGGATACACGGGAAGC
#9 (89 bases)
AAATTAGTGACTGAAGGAATTGACATTAAGCAATTGATGATGGTGATCATGCTTGATAATAGACTTAATATTATTGAGCTCATTCAAGG
#10 (117 bases)
CTAGAGAGAAAGAAACTGAAAGCACAATTTCCCAATACTTCCGAGAATATGAATGTCTTACAGTTTCTTGGATTTCGGTCTGACGAAATTAAACATCTTTTCCTCTATGGTATTGAC
#11 (150 bases)
GAGAGATCTACTCTCAGATACAGAGAAATTATGCTTGGTACCTGGCCATTACTAGAAGAAGAGAAACAATTAGTGTATTGGATTCGACAAGAGGCAAGCAAGGGAGCCAAGTTTTCCGCATGTCTGGAAGGCAGATCAAAGAGTTGTATT
#12 (114 bases)
TGGAGTTTTTCAGCGTTTGCGTTCCATGACGAGCGCTGGACTGCAGGGTCCGCAGTACGTCAAGCTGCAGTTTAGCAGGCATCATCGACAGTTGAGGAGCAGATATGAATTAAG
Using this longer 12 consensus fragments (not limited), we designed 10 primers that could be used for real-time quantitative PCR analysis (Table 1). Primers were designed as internal references using the PAC2 sequence of the gene close to the centromere (not limited to PAC2, but other genes close to the centromere can be used).
Table 1: primers for real-time quantitative analysis of 19Y' element consensus copy number
| Name of primer | Primer sequence information |
| Y’#1_F | TTGCAAGCACAACCAACGAA (shown as SEQ ID No. 1) |
| Y’#1_R | CCGTGTATCCATACCCCTC (shown as SEQ ID No. 2) |
| Y’#2_F | CAACGCTAGTGCCAAGGAG (shown as SEQ ID No. 3) |
| Y’#2_R | AATGTCGGTGACTGGATGGA (shown as SEQ ID No. 4) |
| Y’#3_F | GGGATCTACGATCTGATCGCTTGCT (shown in SEQ ID No. 5) |
| Y’#3_R | TGGTCCTAAAGGTGCACTCA (shown as SEQ ID No. 6) |
| Y’#4_F | TGGACATCAACGAGCTCAAA (shown as SEQ ID No. 7) |
| Y’#4_R | ATCCGTGTTGGATAGCTGGA (shown as SEQ ID No. 8) |
| Y’#5_F | ACGTTGTTTCAAGTGCATAC (shown as SEQ ID No. 9) |
| Y’#5_R | AGTATCCTCTGAGGTAAA (shown as SEQ ID No. 10) |
| Y’#6_F | CCAGAGTCGAAGGCCATTGT (shown as SEQ ID No. 11) |
| Y’#6_R | CTCCAAGAGCAGGCCAATTC (shown as SEQ ID No. 12) |
| Y’#7_F | ACTGAAAGCACAATTCCCA (shown as SEQ ID No. 13) |
| Y’#7_R | GTCAGACCGAAATCCAAGAA (shown as SEQ ID No. 14) |
| Y’#8_F | TGCTTGGTACCTGGCCATT (shown as SEQ ID No. 15) |
| Y’#8_R | GATCTGCCTTCCAGACATGC (shown as SEQ ID No. 16) |
| Y’#9_F | TTTCAGCGTTTGCGTTCCAT (shown as SEQ ID No. 17) |
| Y’#9_R | AACTGCAGCTTGACGTACTG (shown as SEQ ID No. 18) |
| Y’#10_F | AGCAAGTTTACTGGCGAAA (shown as SEQ ID No. 19) |
| Y’#10_R | TGGGTTTACGTGGGGCATAGA (shown as SEQ ID No. 20) |
FIG. 2 shows the dissolution curves of PCR amplified products using 5 pairs of primers for different genomic DNA samples, including PAC2-F & PAC2-R, Y '#1-F & Y' #1-R, Y '#3-F & Y' #3-R, Y '#4-F & Y' #4-R, Y '#5-F & Y' #5-RY '#10-F & Y' # 10-R. The results show that the PCR products are specific peak curves, and therefore, all PCR products are primer-specific amplifications.
As shown in FIG. 3, the dissolution curves of the amplification products for the different genomic DNA samples using 5 pairs of primers, including PAC2-F & PAC2-R, Y '#2-F & Y' #2-R, Y '#6-F & Y' #6-R, Y '#7-F & Y' #7-R, Y '#8-F & Y' #8-R, and Y '#9-F & Y' #9-R, were shown. The results show that the PCR products are all specific peak curves, and therefore, all PCR products are primer-specific amplifications.
Example 2: real-time quantitative PCR analysis method
The internal reference used to quantify the copy number of the Y' element in the genome using the newly established real-time quantitative PCR method was the PAC2 gene, which is located on chromosome 5 near the centromere. The sequences of primers used for amplifying the PAC2 gene were:
PAC2-F ACGTCGAAGAACAGGCTACT (shown as SEQ ID No. 21)
PAC2-R ACATCTCAGCCTCTCTTCTTGT (shown as SEQ ID No. 22)
Genomic DNA was extracted from yeast cells according to the reported methods.
In this example, the kit (not limited to the kit, but any of the same types) and ABI Quantstudio 7Real-Time PCR System Real-Time quantitative PCR analyzer (Thermo Fisher) were used for analysis, and the kit was manufactured using Talent qPCR PreMix (SYBR Green) (manufactured by Tiangen Biochemical technology, beijing, ltd., product number: FP 209-02).
The conditions for real-time quantitative PCR analysis were as follows:
real-time quantitative PCR is 20 microliter system amplification, the using amount of genome DNA is 15-50ng, and the final concentration of each primer in the 20 microliter amplification system is 0.3 mu M (micromole per liter).
One cycle at 95 ℃ for 3 minutes;
following 40 PCR cycles: denaturation 95 ℃ for 5 seconds, annealing 55 ℃ for 30 seconds, and elongation 72 ℃ for 20 seconds.
Melting curves (melt curves) of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
Data analysis in Microsoft Excel with 2 －ΔΔCT Method, the copy number of the Y' element in the mutant cell relative to the wild-type cell is calculated using the following formula:
2 [ - (CT (wild-type PAC 2) -CT (wild-type Y ')) - (CT (mutant PAC 2) -CT (mutant Y')) ] (CT represents the cycle number at which half the maximum amplification of PCR amplification is achieved).
All samples were 4 biological replicates and the results are expressed as mean plus error bars (SEM). Statistical analysis using a two-tailed student's t-test, p <0.05 was assigned as significantly different.
Analysis of
As shown in FIG. 1, the conventional Southern blot method was compared with the novel method to detect the subtelomeric region recombination. As shown in fig. 1C, YKU80 and MRE11 gene knockouts increased significantly with cell division of subtelomeric DNA recombination as detected by conventional Southern blot, consistent with reported results. However, there are many other DNA bands in the genomic DNA of Wild Type (WT) cells at positions with similar molecular weights to those of the Y 'element bands, and these similar DNA bands make it very difficult and inaccurate to quantify the amount of the Y' element by the conventional Southern blot method (FIG. 1C). Analysis of the same DNA samples using the method of the invention (this example requires 1/200 reduction in DNA samples) showed that YKU80 and MRE11 gene knockouts significantly increased the level of subtelomeric recombination (p < 0.05) (FIG. 1D). Because the novel method of the invention is to design the primer of the specific amplification consensus sequence fragment by using the DNA sequence shared by all Y ' elements, the method is not influenced by other DNA bands with similar molecular weights of the Y ' elements, and the extremely sensitive real-time quantitative PCR technology is used for realizing the very specific quantitative analysis of the copy number of the Y ' elements. Therefore, the method is an effective method for simply and quickly detecting the recombination of the yeast subtelomere region with high sensitivity and efficiency.
Sequence listing
<110> Hangzhou university
<120> method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> primer (primer)
<400> 1
ttgcaagcac aaccaacgaa 20
<210> 2
<211> 20
<212> DNA
<213> primer (primer)
<400> 2
ccgtgtatcc ataccaccct 20
<210> 3
<211> 19
<212> DNA
<213> primer (primer)
<400> 3
caacgctagt gccaaggag 19
<210> 4
<211> 20
<212> DNA
<213> primer (primer)
<400> 4
aatgtcggtg actggatgga 20
<210> 5
<211> 21
<212> DNA
<213> primer (primer)
<400> 5
gggatctacg atgatcttgc t 21
<210> 6
<211> 20
<212> DNA
<213> primer (primer)
<400> 6
tggtcctaaa ggtgcactca 20
<210> 7
<211> 20
<212> DNA
<213> primer (primer)
<400> 7
tggacatcaa cgagctcaaa 20
<210> 8
<211> 20
<212> DNA
<213> primer (primer)
<400> 8
atccgtgttg gatagctgga 20
<210> 9
<211> 20
<212> DNA
<213> primer (primer)
<400> 9
acgttgtttc aagtgcatac 20
<210> 10
<211> 21
<212> DNA
<213> primer (primer)
<400> 10
agtatcctct gttgaggtaa a 21
<210> 11
<211> 20
<212> DNA
<213> primer (primer)
<400> 11
ccagagtcga aggccattgt 20
<210> 12
<211> 20
<212> DNA
<213> primer (primer)
<400> 12
ctccaagagc aggccaattc 20
<210> 13
<211> 20
<212> DNA
<213> primer (primer)
<400> 13
actgaaagca caatttccca 20
<210> 14
<211> 20
<212> DNA
<213> primer (primer)
<400> 14
gtcagaccga aatccaagaa 20
<210> 15
<211> 19
<212> DNA
<213> primer (primer)
<400> 15
tgcttggtac ctggccatt 19
<210> 16
<211> 20
<212> DNA
<213> primer (primer)
<400> 16
gatctgcctt ccagacatgc 20
<210> 17
<211> 20
<212> DNA
<213> primer (primer)
<400> 17
tttcagcgtt tgcgttccat 20
<210> 18
<211> 20
<212> DNA
<213> primer (primer)
<400> 18
aactgcagct tgacgtactg 20
<210> 19
<211> 20
<212> DNA
<213> primer (primer)
<400> 19
agcaagttta cctggcgaaa 20
<210> 20
<211> 20
<212> DNA
<213> primer (primer)
<400> 20
tgggtttacg tgggcataga 20
<210> 21
<211> 20
<212> DNA
<213> primer (primer)
<400> 21
acgtcgaaga acaggctact 20
<210> 22
<211> 22
<212> DNA
<213> primer (primer)
<400> 22
acatctcagc ctctcttctt gt 22
Claims (5)
1. A method for quantitatively detecting telomere recombination of different chromosomes of yeast is characterized by comprising the following steps:
1) Carrying out multiple sequence alignment analysis on DNA sequences of 19Y' elements positioned in a subtelomere region in a yeast database to determine fragments of a consensus sequence;
2) Designing a real-time quantitative PCR analysis primer by using the segment of the consensus sequence obtained in the step 1), and designing a primer as an internal reference by using a gene sequence close to centromere;
3) Performing real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer obtained in the step 2);
4) By 2 －ΔΔCT The method utilizes the following equation to determine the copy number of the Y' element in the mutant cell relative to the wild-type cell:
2 [ - ((CT wild-type gene near centromere-CT wild-type Y ') - (CT mutant gene near centromere-CT mutant Y')) ], wherein CT represents the cycle number at which half the maximum amplification of the PCR amplification occurs;
the gene close to the centromere is PAC2 gene;
the real-time quantitative PCR analysis primer in the step 2) comprises Y '#1, Y' #2, Y '#3, Y' #4, Y '#5, Y' #6, Y '#7, Y' #8, Y '#9 and Y' #10, wherein the sequence of the Y '#1 \\ F primer is shown as SEQ ID No.1, the sequence of the Y' #1 \\ R primer is shown as SEQ ID No.2, the sequence of the Y '#2 \\ F primer is shown as SEQ ID No.3, the sequence of the Y' #2 \\ R primer is shown as SEQ ID No.4, the sequence of the Y '#3 \\ F primer is shown as SEQ ID No.5, the sequence of the Y' #3 \\ R primer is shown as SEQ ID No.6, the sequence of the Y '#4 \ F primer is shown as SEQ ID No.7, and the sequence of the Y' #4 \\ R primer is shown as SEQ ID No.8, the sequence of the Y '#5 \_F primer is shown as SEQ ID No.9, the sequence of the Y' #5 \uR primer is shown as SEQ ID No.10, the sequence of the Y '#6 \uF primer is shown as SEQ ID No.11, the sequence of the Y' #6 \uR primer is shown as SEQ ID No.12, the sequence of the Y '#7 \uF primer is shown as SEQ ID No.13, the sequence of the Y' #7 \uR primer is shown as SEQ ID No.14, the sequence of the Y '#8 \uF primer is shown as SEQ ID No.15, the sequence of the Y' #8 \uR primer is shown as SEQ ID No.16, the sequence of the Y '#9 \uF primer is shown as SEQ ID No.17, the sequence of the Y' #9 \uR primer is shown as SEQ ID No.18, the sequence of the Y '#10 \uF primer is shown as SEQ ID No.19, and the sequence of the Y' #10 \uR primer is shown as SEQ ID No. 20.
2. The method for quantitatively detecting the recombination of the telomeres of different chromosomes of the yeast as claimed in claim 1, wherein the gene sequence close to the centromere in the step 2) is a gene PAC2 sequence, internal reference primers are PAC2-F and PAC2-R, the PAC2-F primer sequence is shown as SEQ ID No.21, and the PAC2-R primer sequence is shown as SEQ ID No. 22.
3. The method for quantitatively detecting the telomere recombination of different chromosomes of the yeast as claimed in claim 1, wherein the real-time quantitative PCR conditions in the step 3) are as follows: one cycle at 95 ℃ for 3 minutes; following 40 PCR cycles: denaturation at 95 ℃ for 5 seconds, annealing at 55 ℃ for 30 seconds, and elongation at 72 ℃ for 20 seconds; melting curves of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
4. A PCR primer combination for quantitatively detecting different chromosome telomere recombination of yeast is characterized by comprising primers Y '#1, Y' #2, Y '#3, Y' #4, Y '#5, Y' #6, Y '#7, Y' #8, Y '#9 and Y' #10, wherein the sequence of the Y '#1 \\ F primer is shown as SEQ ID No.1, the sequence of the Y' #1 \\ R primer is shown as SEQ ID No.2, the sequence of the Y '#2 \ F primer is shown as SEQ ID No.3, the sequence of the Y' #2 \\ R primer is shown as SEQ ID No.4, the sequence of the Y '#3 \\ F primer is shown as SEQ ID No.5, the sequence of the Y' #3 \\ R primer is shown as SEQ ID No.6, the sequence of the Y '#4 \\ F primer is shown as SEQ ID No.7, and the sequence of the Y' #4 \\\ U R primer is shown as SEQ ID No.8, the sequence of the Y '#5 \uF primer is shown as SEQ ID No.9, the sequence of the Y' #5 _Rprimer is shown as SEQ ID No.10, the sequence of the Y '#6 _Fprimer is shown as SEQ ID No.11, the sequence of the Y' #6 _Rprimer is shown as SEQ ID No.12, the sequence of the Y '#7 _Fprimer is shown as SEQ ID No.13, the sequence of the Y' #7 _Rprimer is shown as SEQ ID No.14, the sequence of the Y '#8 _Fprimer is shown as SEQ ID No.15, the sequence of the Y' #8 _Rprimer is shown as SEQ ID No.16, the sequence of the Y '#9 _Fprimer is shown as SEQ ID No.17, the sequence of the Y' #9 _Rprimer is shown as SEQ ID No.18, the sequence of the Y '#10 _Fprimer is shown as SEQ ID No.19, and the sequence of the Y' #10 _Rprimer is shown as SEQ ID No. 20.
5. Use of the primer combination of claim 4 for detecting recombination of telomeric DNA of yeast chromosomes or chromosomes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911106923.4A CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911106923.4A CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110938679A CN110938679A (en) | 2020-03-31 |
| CN110938679B true CN110938679B (en) | 2022-11-04 |
Family
ID=69906819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911106923.4A Active CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110938679B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296113A (en) * | 2011-08-12 | 2011-12-28 | 杨楠 | Method for measuring absolute length of chromosome telomere by monochrome multiplex quantitative PCR method |
| CN105624306B (en) * | 2016-02-23 | 2020-06-12 | 天津大学 | Method for detecting repeated position of large segments of saccharomyces cerevisiae chromosome |
-
2019
- 2019-11-13 CN CN201911106923.4A patent/CN110938679B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110938679A (en) | 2020-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lujan et al. | Heterogeneous polymerase fidelity and mismatch repair bias genome variation and composition | |
| Lyne et al. | Whole-genome microarrays of fission yeast: characteristics, accuracy, reproducibility, and processing of array data | |
| CN108588236B (en) | SNP rapid detection method for monitoring genetic quality of inbred line, SNP locus and primer thereof | |
| US7985546B2 (en) | Genomic library construction | |
| US11837325B2 (en) | Method for identifying balanced translocation break points and carrying state for balanced translocations in embryos | |
| Vermulst et al. | Quantification of random mutations in the mitochondrial genome | |
| US20110091900A1 (en) | Method for determining dna copy number by competitive pcr | |
| EP2971087B1 (en) | Assessing dna quality using real-time pcr and ct values | |
| EP3378948A1 (en) | Method for quantifying target nucleic acid and kit therefor | |
| CN110938679B (en) | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency | |
| CN104830992A (en) | Primer and kit for detecting methylenetetrahydrofolate reductase C677T polymorphic sites and PCR (polymerase chain reaction) method of primer and kit | |
| Mattarucchi et al. | Different real time PCR approaches for the fine quantification of SNP's alleles in DNA pools: assays development, characterization and pre-validation | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| CN113969322B (en) | SNP core site, primer and high-throughput purity identification method for identifying purity of corn hybrid | |
| KR20230095709A (en) | Kompetitive Allele Specific PCR (KASP) marker set for seed purity check of Chinese cabbage(Brassica rapa spp. pekinensis) and methods for efficient marker development | |
| US9670480B2 (en) | Genome-wide construction of Schizosaccharomyces pombe heterozygous deletion mutants containing gene-specific barcodes by the methods of 4-round serial or block PCR, or total gene synthesis thereof | |
| Hoff | Molecular typing of wine yeasts: Evaluation of typing techniques and establishment of a database | |
| CN111944917B (en) | Method for developing camellia plant SSR primers based on transcriptome sequencing | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| CN106319045A (en) | Method for screening gene editing products | |
| CN111808977A (en) | Design method and detection method of specific primer of rifampicin antibiotic drug resistance gene caused by SNP | |
| Dwyer et al. | Chapter IV: Identification and characterization of mutations in library of thousands of temperature sensitive S. pombe strains | |
| CN113322278B (en) | Plasmid containing beef cattle DKK3 gene 3' UTR sequence and dual-luciferase reporter gene and application thereof | |
| CN115838784A (en) | Method for detecting gene editing rice based on CRISPR technology | |
| Priyadarsini et al. | Application of Cutting-Edge Molecular Biotechnological Tools in Microbial Bioprocessing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |