CN110938679A - Method for quantitatively detecting recombination of telomeres of different chromosomes of yeast with high sensitivity and high efficiency - Google Patents
Method for quantitatively detecting recombination of telomeres of different chromosomes of yeast with high sensitivity and high efficiency Download PDFInfo
- Publication number
- CN110938679A CN110938679A CN201911106923.4A CN201911106923A CN110938679A CN 110938679 A CN110938679 A CN 110938679A CN 201911106923 A CN201911106923 A CN 201911106923A CN 110938679 A CN110938679 A CN 110938679A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- seq
- yeast
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency belongs to the technical field of bioengineering. The method specifically comprises the following steps: performing multiple sequence alignment analysis on DNA sequences of 19Y' elements positioned in a subtelomere region in a yeast database to determine a fragment of a consensus sequence; designing a real-time quantitative PCR analysis primer by utilizing the fragments of the consensus sequence, and designing a primer as an internal reference by utilizing a gene sequence close to the centromere; carrying out real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer; by 2－ΔΔCTThe method determines the copy number of the Y' element in the mutant cell relative to the wild-type cell. The method has the advantages of extremely high sensitivity, quantification, simple operation and short required time, is particularly suitable for micro genome DNA samples, and can be used for high-passQuantitative analysis and the like.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a method for quantitatively detecting different chromosome telomere recombinations of yeast (Quantitative sub-temporal amplification assisted chromosomal chromosomes by PCR (qSACH for short) with high sensitivity and high efficiency, and more particularly relates to a method for quantitatively analyzing the copy number of Y' elements in subtelomere regions in a yeast genome with high sensitivity and high efficiency.
Background
Saccharomyces cerevisiae (Saccharomyces cerevisiae) is the yeast most widely related to human beings, and is used as a eukaryotic model organism in fundamental disciplines such as modern molecular and cell biology, and the action and the position of the yeast are equivalent to prokaryotic model organism Escherichia coli.
At present, the widely used method for detecting yeast subtelomere region recombination is to digest genomic DNA by using restriction enzymes XhoI or PstI and then to use isotope32P, digoxin, fluorescein or biotin labeled telomere DNA TG1-3Or probes specific for the Y' element for nucleic acid imprinting analysis. The method needs a large amount of genome DNA (generally at least microgram-grade genome DNA), is complex to operate, consumes long time, cannot realize high throughput, and has high quantitative analysis difficulty.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to design and provide a technical scheme of a method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency.
The invention is realized by the following technical scheme:
the method for quantitatively detecting the recombination of the telomeres of different chromosomes of the yeast with high sensitivity and high efficiency is characterized by comprising the following steps of:
1) multiple sequence alignment analysis (Multiple sequence alignment) was performed on the DNA sequences of 19Y' elements located in the subtelomeric region in the yeast database (Saccharomyces genome database, www.yeastgenome.org) to determine fragments of consensus sequences;
2) designing a real-time quantitative PCR analysis primer by using the fragment of the consensus sequence obtained in the step 1), and designing a primer as an internal reference by using a gene sequence close to a centromere (far away from a subtelomere region);
3) carrying out real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer obtained in the step 2);
4) by 2－ΔΔCTThe method utilizes the following formula to determine the copy number of the Y' element in mutant cells relative to wild-type cells:
2 [ - (CT (wild type gene near centromere) -CT (wild type Y ')) - (CT (mutant gene near centromere) -CT (mutant Y')) ], wherein CT represents the cycle number at which half the maximum amplification of the PCR amplification occurs.
The method for quantitatively detecting the recombination of different chromosome telomeres of yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR analysis primers in the step 2) comprise Y ' #1, Y ' #2, Y ' #3, Y ' #4, Y ' #5, Y ' #6, Y ' #7, Y ' #8, Y ' #9 and Y ' #10, wherein the sequence of the Y ' #1_ F primer is shown as SEQ ID No.1, the sequence of the Y ' #1_ R primer is shown as SEQ ID No.2, the sequence of the Y ' #2_ F primer is shown as SEQ ID No.3, the sequence of the Y ' #2_ R primer is shown as SEQ ID No.4, the sequence of the Y ' #3_ F primer is shown as SEQ ID No.5, the sequence of the Y ' #3_ R primer is shown as SEQ ID No.6, the sequence of the Y ' #4_ F primer is shown as SEQ ID No.7, the sequence of the Y ' #4_ R primer is shown as SEQ ID No.8, and the sequence of the Y ' #5_ F primer is shown as SEQ ID No.9, the sequence of the Y ' #5_ R primer is shown as SEQ ID No.10, the sequence of the Y ' #6_ F primer is shown as SEQ ID No.11, the sequence of the Y ' #6_ R primer is shown as SEQ ID No.12, the sequence of the Y ' #7_ F primer is shown as SEQ ID No.13, the sequence of the Y ' #7_ R primer is shown as SEQ ID No.14, the sequence of the Y ' #8_ F primer is shown as SEQ ID No.15, the sequence of the Y ' #8_ R primer is shown as SEQ ID No.16, the sequence of the Y ' #9_ F primer is shown as SEQ ID No.17, the sequence of the Y ' #9_ R primer is shown as SEQ ID No.18, the sequence of the Y ' #10_ F primer is shown as SEQ ID No.19, and the sequence of the Y ' #10_ R primer is shown as SEQ ID No. 20.
The method for quantitatively detecting the recombination of different chromosome telomeres of the yeast with high sensitivity and high efficiency is characterized in that a gene sequence close to the centromere in the step 2) is a gene PAC2 sequence, internal reference primers are PAC2-F and PAC2-R, the PAC2-F primer sequence is shown as SEQ ID No.21, and the PAC2-R primer sequence is shown as SEQ ID No. 22.
The method for quantitatively detecting the recombination of the telomeres of different chromosomes of the yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR conditions in the step 3) are as follows: one cycle at 95 ℃ for 3 minutes; following 40 PCR cycles: denaturation at 95 ℃ for 5 seconds, annealing at 55 ℃ for 30 seconds, and elongation at 72 ℃ for 20 seconds; melting curves of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
The PCR primer for quantitatively detecting the recombination of different chromosome telomeres of yeast with high sensitivity and high efficiency is characterized in that the real-time quantitative PCR analysis primer in the step 2) comprises Y '# 1, Y' #2, Y '# 3, Y' #4, Y '# 5, Y' #6, Y '# 7, Y' #8, Y '# 9 and Y' #10, wherein the sequence of the Y '# 1_ F primer is shown as SEQ ID No.1, the sequence of the Y' #1_ R primer is shown as SEQ ID No.2, the sequence of the Y '# 2_ F primer is shown as SEQ ID No.3, the sequence of the Y' #2_ R primer is shown as SEQ ID No.4, the sequence of the Y '# 3_ F primer is shown as SEQ ID No.5, the sequence of the Y' #3_ R primer is shown as SEQ ID No.6, the sequence of the Y '# 4_ F primer is shown as SEQ ID No.7, and the sequence of the Y' #4_ R is shown as SEQ ID No.8, the sequence of the Y '# 5_ F primer is shown as SEQ ID No.9, the sequence of the Y' #5_ R primer is shown as SEQ ID No.10, the sequence of the Y '# 6_ F primer is shown as SEQ ID No.11, the sequence of the Y' #6_ R primer is shown as SEQ ID No.12, the sequence of the Y '# 7_ F primer is shown as SEQ ID No.13, the sequence of the Y' #7_ R primer is shown as SEQ ID No.14, the sequence of the Y '# 8_ F primer is shown as SEQ ID No.15, the sequence of the Y' #8_ R primer is shown as SEQ ID No.16, the sequence of the Y '# 9_ F primer is shown as SEQ ID No.17, the sequence of the Y' #9_ R primer is shown as SEQ ID No.18, the sequence of the Y '# 10_ F primer is shown as SEQ ID No.19, and the sequence of the Y' #10_ R primer is shown as SEQ ID No. 20.
The high-sensitivity high-efficiency quantitative detection method for yeast different chromosome telomere recombination is applied to various fields of biology, medicine, biomedicine and various categories contained in the biomedicine, such as genetics, forensic medicine and the like, for example, (1) the method is used for monitoring the aging degree of saccharomyces cerevisiae and the like, and for example, (2) the method is modified and used for other organisms and the like on the basis of the method.
The method for quantitatively detecting the recombination of different chromosome telomeres of the yeast with high sensitivity and high efficiency has the advantages of extremely high sensitivity, high quantification, simple operation, short required time, particular suitability for trace genome DNA samples, high-throughput analysis and the like. The method can analyze the DNA recombination level of the subtelomere region only by pg-ng level genome DNA.
Drawings
FIG. 1 is a graph comparing conventional Southern blot (Southern blot) with a novel method for detecting subtelomeric region recombination.
WT (wild type) andyku80 Δ MRE11 Δ (YKU80 and MRE11 knock-out) strains were passaged continuously for 6 times on YPD (1% yeast extract, 2% peptone, 2% glucose and 2% agar powder) solid medium, and then the cells were harvested to extract genomic DNA. In FIG. 1, (A) there are 19Y' elements in 17 out of 32 telomeres of 16 chromosomes in yeast, and we found 12 longer consensus sequences by multiple sequence alignment (but not limited to). (B) The novel method is a schematic diagram of the principle of the method for detecting the recombination of subtelomere regions. 17 chromosomes have 19Y' elements in total, 12 segments of common sequences are found through multiple sequence alignment, and 10 pairs of primers for real-time quantitative analysis of subtelomere region recombination are designed from the common sequences. (C) About 2. mu.g of genomic DNA was digested with restriction enzyme XhoI overnight, separated on a 1.2% agarose gel and Southern Blot, digoxigenin-labeled TG1-3The probe detects subtelomere recombination. (D) The genomic DNA samples (diluted 30-fold) in the 10-pair primer set (C) in the newly constructed cube method were analyzed, and the amount of the analyzed genomic DNA was reduced to about several nanograms. Statistical analysis by two-tailed student's t-test,. p<0.05。
FIG. 2 shows the dissolution curves of real-time quantitative PCR amplification products for PAC2-F & PAC2-R, Y '# 1-F & Y' #1-R, Y '# 3-F & Y' #3-R, Y '# 4-F & Y' #4-R, Y '# 5-F & Y' #5-RY '# 10-F & Y' # 10-R.
FIG. 3 shows the dissolution curves of PAC2-F & PAC2-R, Y '# 2-F & Y' #2-R, Y '# 6-F & Y' #6-R, Y '# 7-F & Y' #7-R, Y '# 8-F & Y' #8-R, and Y '# 9-F & Y' #9-R real-time quantitative PCR amplification products.
Detailed Description
The present invention is further described below in conjunction with specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. These examples are merely illustrative and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
Example 1: design of real-time quantitative PCR analysis primers
By performing multiple sequence alignment analysis on the DNA sequences (from www.yeastgenome.org) of 19Y' elements in the genome of Saccharomyces cerevisiae (not limited to the background of S288C, including other background species), the following longer 12 consensus fragments were obtained (not limited to these 12 consensus fragments, but there are also multiple consensus fragments not listed):
#1(91 bases)
ACAAAAACGACTTGGTACATTGTCCCTCAATAACTTTATTTGAATCGATCCCCACGGAAGTGCGGTCATTCTACGAAGACGAAAAGTCTGG
#2(106 bases)
TGATGGTCTACACGTTGTTTCAAGTGCATACTTTGAAATTCAATAGAAAGGATTACGATACCCTTTCTCTTTTTTACCTCAACAGAGGATACTATAATGAGTTGAG
#3(73 bases)
CAAGCAAGTTTACCTGGCGAAAAGAAAGTCGACACAGAGCGGCTGAAGCGTGATCTATGCCCACGTAAACCCA
#4(97 bases)
ATGAAATATACATGGCAGACACACCCTCTGTGGCAGTACAGGCCCCACCGGGCTATGGTAAGACGGAGTTATTTCATCTCCCCTTGATAGCACTGGC
#5(147 bases)
CGATGGCGTTACTGATTTATACGTGGGGATCTACGATGATCTTGCTAGCACTAATTTCACAGACAGGATAGCTGCGTGGGAGAATATTGTTGAGTGCACCTTTAGGACCAACAACGTAAAATTGGGTTACCTCATTGTAGATGAGTT
#6(101 bases)
CACAACTTTGAAACGGAGGTCTACCGGCAGTCGCAATTTGGGGGCATAACTAACCTTGATTTTGACGCTTTTGAGAAAGCAATCTTTTTGAGCGGCACAGC
#7(96 bases)
TCGATGGACATCAACGAGCTCAAACGGTCGGAAGATCTCAGCAGAGGTCTATCCAGCTATCCAACACGGATGTTTAATCTAATCAAGGAGAAATCC
#8(107 bases)
TGAACCAGAGTCGAAGGCCATTGTAGTTGCAAGCACAACCAACGAAGTGGAAGAATTGGCCTGCTCTTGGAGAAAGTATTTTAGGGTGGTATGGATACACGGGAAGC
#9(89 bases)
AAATTAGTGACTGAAGGAATTGACATTAAGCAATTGATGATGGTGATCATGCTTGATAATAGACTTAATATTATTGAGCTCATTCAAGG
#10(117 bases)
CTAGAGAGAAAGAAACTGAAAGCACAATTTCCCAATACTTCCGAGAATATGAATGTCTTACAGTTTCTTGGATTTCGGTCTGACGAAATTAAACATCTTTTCCTCTATGGTATTGAC
#11(150 bases)
GAGAGATCTACTCTCAGATACAGAGAAATTATGCTTGGTACCTGGCCATTACTAGAAGAAGAGAAACAATTAGTGTATTGGATTCGACAAGAGGCAAGCAAGGGAGCCAAGTTTTCCGCATGTCTGGAAGGCAGATCAAAGAGTTGTATT
#12(114 bases)
TGGAGTTTTTCAGCGTTTGCGTTCCATGACGAGCGCTGGACTGCAGGGTCCGCAGTACGTCAAGCTGCAGTTTAGCAGGCATCATCGACAGTTGAGGAGCAGATATGAATTAAG
Using this longer 12 consensus fragments (not limited), we designed 10 primers that could be used for real-time quantitative PCR analysis (Table 1). Primers were designed as internal references using the sequence of the gene PAC2 near the centromere (not limited to PAC2, other genes near the centromere can also be used).
Table 1: primers for real-time quantitative analysis of 19Y' element consensus copy number
| Primer name | Primer sequence information |
| Y’#1_F | TTGCAAGCACAACCAACGAA (shown as SEQ ID No. 1) |
| Y’#1_R | CCGTGTATCCATACCACCCT (shown as SEQ ID No. 2) |
| Y’#2_F | CAACGCTAGTGCCAAGGAG (shown as SEQ ID No. 3) |
| Y’#2_R | AATGTCGGTGACTGGATGGA (shown as SEQ ID No. 4) |
| Y’#3_F | GGGATCTACGATGATCTTGCT (shown as SEQ ID No. 5) |
| Y’#3_R | TGGTCCTAAAGGTGCACTCA (shown as SEQ ID No. 6) |
| Y’#4_F | TGGACATCAACGAGCTCAAA (shown as SEQ ID No. 7) |
| Y’#4_R | ATCCGTGTTGGATAGCTGGA (shown as SEQ ID No. 8) |
| Y’#5_F | ACGTTGTTTCAAGTGCATAC (shown as SEQ ID No. 9) |
| Y’#5_R | AGTATCCTCTGTTGAGGTAAA (shown as SEQ ID No. 10) |
| Y’#6_F | CCAGAGTCGAAGGCCATTGT (shown as SEQ ID No. 11) |
| Y’#6_R | CTCCAAGAGCAGGCCAATTC (shown as SEQ ID No. 12) |
| Y’#7_F | ACTGAAAGCACAATTTCCCA (shown as SEQ ID No. 13) |
| Y’#7_R | GTCAGACCGAAATCCAAGAA (shown as SEQ ID No. 14) |
| Y’#8_F | TGCTTGGTACCTGGCCATT (shown as SEQ ID No. 15) |
| Y’#8_R | GATCTGCCTTCCAGACATGC (shown as SEQ ID No. 16) |
| Y’#9_F | TTTCAGCGTTTGCGTTCCAT (shown as SEQ ID No. 17) |
| Y’#9_R | AACTGCAGCTTGACGTACTG (shown as SEQ ID No. 18) |
| Y’#10_F | AGCAAGTTTACCTGGCGAAA (shown as SEQ ID No. 19) |
| Y’#10_R | TGGGTTTACGTGGGCATAGA (shown as SEQ ID No. 20) |
As shown in FIG. 2, the dissolution curves of PCR amplified products were prepared using 5 pairs of primers for different genomic DNA samples, including PAC2-F & PAC2-R, Y '# 1-F & Y' #1-R, Y '# 3-F & Y' #3-R, Y '# 4-F & Y' #4-R, and Y '# 5-F & Y' #5-RY '# 10-F & Y' # 10-R. The results show that the PCR products are specific peak curves, and therefore, all PCR products are primer-specific amplifications.
FIG. 3 shows the dissolution curves of the amplification products for the different genomic DNA samples with 5 pairs of primers, including PAC2-F & PAC2-R, Y '# 2-F & Y' #2-R, Y '# 6-F & Y' #6-R, Y '# 7-F & Y' #7-R, Y '# 8-F & Y' #8-R, Y '# 9-F & Y' # 9-R. The results show that the PCR products are all specific peak curves, and therefore, all PCR products are primer-specific amplifications.
Example 2: real-time quantitative PCR analysis method
The internal reference used to quantify the copy number of the Y' element in the genome using the newly established real-time quantitative PCR method is the PAC2 gene, which is located on chromosome 5 near the centromere. The sequences of primers used for amplifying the PAC2 gene were:
PAC2-F: ACGTCGAAGAACAGGCTACT (shown as SEQ ID No. 21)
PAC2-R: ACATCTCAGCCTCTCTTCTTGT (shown as SEQ ID No. 22)
Genomic DNA was extracted from yeast cells according to the reported methods.
In this example, the kit (not limited to the kit, but any kit of the same type) and ABIQuantStudio 7 Real-Time-PCR System Real-Time quantitative PCR analyzer (Thermo Fisher) were used to analyze using Talent qPCR PreMix (SYBR Green) (Tiangen Biochemical technology, Beijing) Co., Ltd., product No. FP 209-02.
The conditions for real-time quantitative PCR analysis were as follows:
the real-time quantitative PCR is 20 microliter system amplification, the using amount of genome DNA is 15-50ng, and the final concentration of each primer in the 20 microliter amplification system is 0.3 mu M (micromole per liter).
One cycle at 95 ℃ for 3 minutes;
following 40 PCR cycles: denaturation 95 ℃ for 5 seconds, annealing 55 ℃ for 30 seconds, and elongation 72 ℃ for 20 seconds.
Melting curves (melt curves) of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
Data analysis in Microsoft Excel with 2－ΔΔCTMethod, the copy number of the Y' element in the mutant cell relative to the wild-type cell is calculated using the following formula:
2 [ - (CT (wild-type PAC2) -CT (wild-type Y ')) - (CT (mutant PAC2) -CT (mutant Y')) ] (CT represents the cycle number at which half the maximum amplification of PCR amplification occurs).
All samples were 4 biological replicates and the results are expressed as mean plus error bars (SEM). Statistical analysis using a two-tailed student's t-test, p <0.05 was assigned as significantly different.
Analysis of
As shown in FIG. 1, the conventional Southern blot method was compared with the novel method to detect the subtelomeric region recombination. As shown in fig. 1C, when subtelomeric recombination was detected by the conventional Southern blot method, YKU80 and MRE11 gene knockouts increased significantly with increasing cell division and subtelomeric DNA recombination, which is consistent with reported results. However, there are many other DNA bands in the genomic DNA of Wild Type (WT) cells at positions with similar molecular weights to those of the Y 'element bands, and these similar DNA bands make it difficult and inaccurate to quantify the amount of the Y' element by the conventional Southern blot method (FIG. 1C). Analysis of the same DNA sample using the method of the invention (this example requires a DNA sample reduced to 1/200) showed that YKU80 and MRE11 gene knockouts significantly increased the level of subtelomeric region recombination (p <0.05) (fig. 1D). Because the novel method of the invention is to design the primer of the specific amplification consensus sequence fragment by using the DNA sequence shared by all Y ' elements, the method is not influenced by other DNA bands with similar molecular weights of the Y ' elements, and the extremely sensitive real-time quantitative PCR technology is used for realizing the very specific quantitative analysis of the copy number of the Y ' elements. Therefore, the method is an effective method for simply and quickly detecting the yeast subtelomere region recombination with high sensitivity and efficiency.
Sequence listing
<110> university of teachers in Hangzhou
<120> method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency
<160>22
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> primer (primer)
<400>1
ttgcaagcac aaccaacgaa 20
<210>2
<211>20
<212>DNA
<213> primer (primer)
<400>2
ccgtgtatcc ataccaccct 20
<210>3
<211>19
<212>DNA
<213> primer (primer)
<400>3
caacgctagt gccaaggag 19
<210>4
<211>20
<212>DNA
<213> primer (primer)
<400>4
aatgtcggtg actggatgga 20
<210>5
<211>21
<212>DNA
<213> primer (primer)
<400>5
gggatctacg atgatcttgc t 21
<210>6
<211>20
<212>DNA
<213> primer (primer)
<400>6
tggtcctaaa ggtgcactca 20
<210>7
<211>20
<212>DNA
<213> primer (primer)
<400>7
tggacatcaa cgagctcaaa 20
<210>8
<211>20
<212>DNA
<213> primer (primer)
<400>8
atccgtgttg gatagctgga 20
<210>9
<211>20
<212>DNA
<213> primer (primer)
<400>9
acgttgtttc aagtgcatac 20
<210>10
<211>21
<212>DNA
<213> primer (primer)
<400>10
agtatcctct gttgaggtaa a 21
<210>11
<211>20
<212>DNA
<213> primer (primer)
<400>11
ccagagtcga aggccattgt 20
<210>12
<211>20
<212>DNA
<213> primer (primer)
<400>12
ctccaagagc aggccaattc 20
<210>13
<211>20
<212>DNA
<213> primer (primer)
<400>13
actgaaagca caatttccca 20
<210>14
<211>20
<212>DNA
<213> primer (primer)
<400>14
gtcagaccga aatccaagaa 20
<210>15
<211>19
<212>DNA
<213> primer (primer)
<400>15
tgcttggtac ctggccatt 19
<210>16
<211>20
<212>DNA
<213> primer (primer)
<400>16
gatctgcctt ccagacatgc 20
<210>17
<211>20
<212>DNA
<213> primer (primer)
<400>17
tttcagcgtt tgcgttccat 20
<210>18
<211>20
<212>DNA
<213> primer (primer)
<400>18
aactgcagct tgacgtactg 20
<210>19
<211>20
<212>DNA
<213> primer (primer)
<400>19
agcaagttta cctggcgaaa 20
<210>20
<211>20
<212>DNA
<213> primer (primer)
<400>20
tgggtttacg tgggcataga 20
<210>21
<211>20
<212>DNA
<213> primer (primer)
<400>21
acgtcgaaga acaggctact 20
<210>22
<211>22
<212>DNA
<213> primer (primer)
<400>22
acatctcagc ctctcttctt gt 22
Claims (6)
1. A method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency is characterized by comprising the following steps:
1) performing multiple sequence alignment analysis on DNA sequences of 19Y' elements positioned in a subtelomere region in a yeast database to determine a fragment of a consensus sequence;
2) designing a real-time quantitative PCR analysis primer by using the segment of the consensus sequence obtained in the step 1), and designing a primer as an internal reference by using a gene sequence close to centromere;
3) carrying out real-time quantitative PCR analysis on the genomic DNA of the yeast cells according to the PCR analysis primer and the internal reference primer obtained in the step 2);
4) by 2－ΔΔCTThe method utilizes the following formula to determine the copy number of the Y' element in mutant cells relative to wild-type cells:
2 [ - (CT (wild type gene near centromere) -CT (wild type Y ')) - (CT (mutant gene near centromere) -CT (mutant Y')) ], wherein CT represents the cycle number at which half the maximum amplification of the PCR amplification occurs.
2. The method of claim 1, wherein the primers for real-time quantitative PCR analysis in step 2) include Y '# 1, Y' #2, Y '# 3, Y' #4, Y '# 5, Y' #6, Y '# 7, Y' #8, Y '# 9, Y' #10, wherein the Y '# 1_ F primer sequence is shown in SEQ ID No.1, the Y' #1_ R primer sequence is shown in SEQ ID No.2, the Y '# 2_ F primer sequence is shown in SEQ ID No.3, the Y' #2_ R primer sequence is shown in SEQ ID No.4, the Y '# 3_ F primer sequence is shown in SEQ ID No.5, the Y' #3_ R primer sequence is shown in SEQ ID No.6, the Y '# 4_ F primer sequence is shown in SEQ ID No.7, and the Y' #4_ R primer sequence is shown in SEQ ID No.8, the sequence of the Y '# 5_ F primer is shown as SEQ ID No.9, the sequence of the Y' #5_ R primer is shown as SEQ ID No.10, the sequence of the Y '# 6_ F primer is shown as SEQ ID No.11, the sequence of the Y' #6_ R primer is shown as SEQ ID No.12, the sequence of the Y '# 7_ F primer is shown as SEQ ID No.13, the sequence of the Y' #7_ R primer is shown as SEQ ID No.14, the sequence of the Y '# 8_ F primer is shown as SEQ ID No.15, the sequence of the Y' #8_ R primer is shown as SEQ ID No.16, the sequence of the Y '# 9_ F primer is shown as SEQ ID No.17, the sequence of the Y' #9_ R primer is shown as SEQ ID No.18, the sequence of the Y '# 10_ F primer is shown as SEQ ID No.19, and the sequence of the Y' #10_ R primer is shown as SEQ ID No. 20.
3. The method for quantitatively detecting the telomere recombination of different chromosomes of the yeast with high sensitivity and high efficiency as claimed in claim 1, wherein the gene sequence close to the centromere in the step 2) is a gene PAC2 sequence, the internal reference primers are PAC2-F and PAC2-R, the PAC2-F primer sequence is shown as SEQ ID No.21, and the PAC2-R primer sequence is shown as SEQ ID No. 22.
4. The method for quantitatively detecting the telomere recombination of different chromosomes of the yeast with high sensitivity and high efficiency according to claim 1, wherein the real-time quantitative PCR conditions in the step 3) are as follows: one cycle at 95 ℃ for 3 minutes; following 40 PCR cycles: denaturation at 95 ℃ for 5 seconds, annealing at 55 ℃ for 30 seconds, and elongation at 72 ℃ for 20 seconds; melting curves of all PCR products were analyzed to ensure that all PCR amplifications were specific amplifications.
5. A PCR primer for quantitatively detecting the recombination of telomeres of different chromosomes of yeast in a high-sensitivity and high-efficiency manner is characterized in that a real-time quantitative PCR analysis primer in the step 2) comprises Y ' #1, Y ' #2, Y ' #3, Y ' #4, Y ' #5, Y ' #6, Y ' #7, Y ' #8, Y ' #9 and Y ' #10, wherein the sequence of the Y ' #1_ F primer is shown as SEQ ID No.1, the sequence of the Y ' #1_ R primer is shown as SEQ ID No.2, the sequence of the Y ' #2_ F primer is shown as SEQ ID No.3, the sequence of the Y ' #2_ R primer is shown as SEQ ID No.4, the sequence of the Y ' #3_ F primer is shown as SEQ ID No.5, the sequence of the Y ' #3_ R primer is shown as SEQ ID No.6, the sequence of the Y ' #4_ F primer is shown as SEQ ID No.7, the sequence of the Y ' #4_ R primer is shown as SEQ ID No.8, and the sequence of the Y ' #5_ F primer is shown as SEQ ID No.9, the sequence of the Y ' #5_ R primer is shown as SEQ ID No.10, the sequence of the Y ' #6_ F primer is shown as SEQ ID No.11, the sequence of the Y ' #6_ R primer is shown as SEQ ID No.12, the sequence of the Y ' #7_ F primer is shown as SEQ ID No.13, the sequence of the Y ' #7_ R primer is shown as SEQ ID No.14, the sequence of the Y ' #8_ F primer is shown as SEQ ID No.15, the sequence of the Y ' #8_ R primer is shown as SEQ ID No.16, the sequence of the Y ' #9_ F primer is shown as SEQ ID No.17, the sequence of the Y ' #9_ R primer is shown as SEQ ID No.18, the sequence of the Y ' #10_ F primer is shown as SEQ ID No.19, and the sequence of the Y ' #10_ R primer is shown as SEQ ID No. 20.
6. Use of the primer according to claim 5 for detecting telomeres in different species of organisms or animals and for detecting telomeric DNA of chromosomes or chromosomes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911106923.4A CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911106923.4A CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110938679A true CN110938679A (en) | 2020-03-31 |
| CN110938679B CN110938679B (en) | 2022-11-04 |
Family
ID=69906819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911106923.4A Active CN110938679B (en) | 2019-11-13 | 2019-11-13 | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110938679B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296113A (en) * | 2011-08-12 | 2011-12-28 | 杨楠 | Method for measuring absolute length of chromosome telomere by monochrome multiplex quantitative PCR method |
| CN105624306A (en) * | 2016-02-23 | 2016-06-01 | 天津大学 | Method for detecting klenow fragment repetition position in saccharomyces cerevisiae chromosome |
-
2019
- 2019-11-13 CN CN201911106923.4A patent/CN110938679B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296113A (en) * | 2011-08-12 | 2011-12-28 | 杨楠 | Method for measuring absolute length of chromosome telomere by monochrome multiplex quantitative PCR method |
| CN105624306A (en) * | 2016-02-23 | 2016-06-01 | 天津大学 | Method for detecting klenow fragment repetition position in saccharomyces cerevisiae chromosome |
Non-Patent Citations (2)
| Title |
|---|
| JUN LIU 等: "A method for efficient quantitative analysis of genomic subtelomereY0 element abundance in yeasts", 《YEAST.》 * |
| SANKI TASHIRO 等: "NAR Breakthrough Article Subtelomeres constitute a safeguard for gene expression and chromosome homeostasis", 《NUCLEIC ACIDS RESEARCH》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110938679B (en) | 2022-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7985546B2 (en) | Genomic library construction | |
| Lyne et al. | Whole-genome microarrays of fission yeast: characteristics, accuracy, reproducibility, and processing of array data | |
| CN108588236B (en) | SNP rapid detection method for monitoring genetic quality of inbred line, SNP locus and primer thereof | |
| US11837325B2 (en) | Method for identifying balanced translocation break points and carrying state for balanced translocations in embryos | |
| Vermulst et al. | Quantification of random mutations in the mitochondrial genome | |
| US11542562B2 (en) | Single nucleotide polymorphism marker related to Chinese horse short stature trait and use thereof | |
| CN110938679B (en) | Method for quantitatively detecting different chromosome telomere recombinations of yeast with high sensitivity and high efficiency | |
| CN111944917B (en) | Method for developing camellia plant SSR primers based on transcriptome sequencing | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| CN113969322B (en) | SNP core site, primer and high-throughput purity identification method for identifying purity of corn hybrid | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| Hoff | Molecular typing of wine yeasts: Evaluation of typing techniques and establishment of a database | |
| CN106319045A (en) | Method for screening gene editing products | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN113322278B (en) | Plasmid containing beef cattle DKK3 gene 3' UTR sequence and dual-luciferase reporter gene and application thereof | |
| CN113981134B (en) | Indel marker combination for early screening of high-polysaccharide lentinan strains and detection method thereof | |
| KR102465232B1 (en) | Method and Kit for Analyzing Canine Subject Microsatellite Marker by using Multiplex System | |
| US11788154B2 (en) | Method for identifying racehorse using microsatellite marker | |
| Dwyer et al. | Chapter IV: Identification and characterization of mutations in library of thousands of temperature sensitive S. pombe strains | |
| CN115838784A (en) | Method for detecting gene editing rice based on CRISPR technology | |
| KR101955073B1 (en) | Snp markers for discrimination of raphanus sativus | |
| Priyadarsini et al. | Application of Cutting-Edge Molecular Biotechnological Tools in Microbial Bioprocessing | |
| CN115710602A (en) | HRM analysis method for quickly and sensitively diagnosing gene editing oysters | |
| KR20230095709A (en) | Kompetitive Allele Specific PCR (KASP) marker set for seed purity check of Chinese cabbage(Brassica rapa spp. pekinensis) and methods for efficient marker development | |
| CN105316399A (en) | Method for screening mutants by high-throughput sequencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |