CN110938647A

CN110938647A - Recombinant expression vector, recombinant attenuated salmonella typhimurium and construction method and application thereof

Info

Publication number: CN110938647A
Application number: CN201911363444.0A
Authority: CN
Inventors: 陈廷涛; 魏泓
Original assignee: Qianhai Shenzhen Jin Zhuo Biotechnology Co Ltd
Current assignee: Qianhai Shenzhen Jin Zhuo Biotechnology Co Ltd
Priority date: 2019-12-26
Filing date: 2019-12-26
Publication date: 2020-03-31

Abstract

The invention relates to a recombinant expression vector, recombinant attenuated salmonella typhimurium, a construction method and application thereof. The recombinant expression vector comprises a nucleotide sequence for coding a recombinant protein formed by a single-chain antibody of endosialin and Caspase-3. The recombinant attenuated salmonella typhimurium containing the recombinant expression vector has specific aggregation and intracellular invasion in tumors, realizes the effect of killing tumor cells specifically and simultaneously reduces the damage of the tumor cells to normal cells of organisms, and has good anti-tumor effect.

Description

Recombinant expression vector, recombinant attenuated salmonella typhimurium and construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant expression vector, recombinant attenuated salmonella typhimurium, a construction method and application thereof.

Background

The targeted therapy is a tumor treatment mode that the antitumor drug can be specifically combined with tumor cells, so that the tumor cells are killed and killed without basically influencing healthy tissues. The targeted therapy is an ideal mode for treating tumors at present and also represents the future trend of tumor treatment.

Currently, the targeted therapeutic drugs are mainly divided into monoclonal antibodies and Antibody Drug Conjugates (ADCs). The ADC drug is formed by coupling a monoclonal antibody and a potent toxic drug (toxin drug) through a bioactive connector (linker), and is a drug for targeting tumor cells at a fixed point.

Although the ADC drugs have better target recognition and no influence on non-cancer cells at present, the anti-tumor effect of the ADC drugs still needs to be improved.

Disclosure of Invention

Based on this, there is a need for a recombinant attenuated salmonella typhimurium with good anti-tumor effect.

A recombinant attenuated Salmonella typhimurium transformed from a recombinant expression vector comprising a nucleotide sequence encoding a recombinant protein formed from a single chain antibody to endosialin and Caspase-3.

The recombinant attenuated salmonella typhimurium utilizes the invasion and aggregation characteristics of the recombinant attenuated salmonella typhimurium in solid tumors, and expresses the single-chain antibody of endosialin and the recombinant protein formed by Caspase-3 in the attenuated salmonella typhimurium through a recombinant expression vector, so that the aggregation of the Caspase-3 protein in tumors is realized, tumor cells are specifically killed, the problem that the Caspase-3 protein cannot be specifically aggregated in the tumors is avoided, and the anti-tumor effect of the recombinant attenuated salmonella typhimurium is improved. Proved by verification, the recombinant attenuated salmonella typhimurium has good anti-tumor effect.

In one embodiment, the nucleotide sequence encoding the recombinant protein is shown in SEQ ID No. 2.

In one embodiment, the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009.

A construction method of recombinant attenuated salmonella typhimurium comprises the following steps:

introducing a target expression fragment into an expression empty vector to obtain a recombinant expression vector, wherein the target expression fragment contains one of nucleotide sequences of recombinant proteins formed by a single-chain antibody of endosialin and Caspase-3; and

and (3) converting the recombinant expression vector into attenuated salmonella typhimurium to obtain the recombinant attenuated salmonella typhimurium.

In one embodiment, the expression empty vector is selected from one of pcDNA3.3c plasmid, pEnCMV-WAC-3 XFLAG plasmid and pCDNA3.1-Mbnl3-m-Myc plasmid.

The recombinant expression vector or the recombinant attenuated salmonella typhimurium prepared by the construction method of the recombinant attenuated salmonella typhimurium is applied to preparing antitumor drugs.

In one embodiment, the tumor is a solid tumor.

An anti-tumor drug comprises the recombinant expression vector or the recombinant attenuated salmonella typhimurium prepared by the construction method of the recombinant attenuated salmonella typhimurium.

Drawings

FIG. 1 is a PCR-verified result of the recombinant plasmid pcDNA3.3c-Caspase-3 of example 1;

FIG. 2 is a PCR-verified result chart of the recombinant plasmid pcDNA3.3c-78-Caspase-3 of example 1;

FIG. 3 is the attenuated Salmonella typhimurium VNP20009 of example 1;

FIG. 4 is the result of co-culturing the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 of example 1 with MS1-TEM1 cells for 24 hours;

FIG. 5 shows MTT assay results of blank control, attenuated Salmonella typhimurium VNP20009, recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3, and recombinant attenuated Salmonella typhimurium VNP 20009-pcDNA3.3c-78-Caspase-3;

FIG. 6 is a graph of tumor size versus time for each group of tumor model mice in example 1.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Some embodiments of the invention are presented in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The recombinant expression vector of an embodiment includes a nucleotide sequence encoding a recombinant protein formed from a single chain antibody to endosialin and Caspase-3. The recombinant expression vector can express the recombinant protein formed by the single-chain antibody of the endosialin and Caspase-3, can be expressed in a eukaryotic system, and is favorable for improving the action effect of the recombinant protein formed by the single-chain antibody of the endosialin and Caspase-3 in a host.

Caspase-3 (Caspase-3) is a key enzyme in the process of apoptosis execution and effect in mammalian cells, and the cascade activation reaction of the Caspase-3 is an important information transmission path of apoptosis, under the normal state, Caspase-3 exists in cytoplasm in the form of zymogen (32KDa), when activated, two subunits of large (17KDa) and small (12KDa) of Caspase-3 are released after two times of decomposition (sites are both in peptide bonds at carboxyl terminals of aspartic acid), the released large and small subunits are recombined and combined to form a new dimer structure (β sheet is taken as a core and two sides are α helices), the two dimers are reassembled into α 2 β 2 tetramer active enzymes with 2 substrate binding sites and catalytic sites, thereby causing apoptosis, according to the difference of apoptosis signal conduction sites and initiation sites, the three routes of the apoptosis information transmission can be divided into three routes, namely a death receptor pathway, a mitochondrial pathway, an endoplasmic reticulum-3 pathway, a tetrapeptide active enzyme activity pathway which is formed by the mutual cleavage of the apoptosis signal conduction sites and the Caspase 3, the apoptosis pathway is a stable and a balanced mechanism of the Caspase, thereby the apoptosis-mediated by the biological cleavage of the Caspase, the biological growth pathway, the biological growth and the biological cleavage of the Caspase-3, the biological cleavage of the apoptosis pathway, the biological pathways of the Caspase-3, the biological pathways of the apoptosis pathway, and the biological pathways of the biological pathways are closely related to form a stable and the biological pathways, so that.

Endosialin (also known as tumor endothelial cell marker molecule 1, TEM1/CD248) is a type I transmembrane protein, and comprises a 80.9kDa protein core region modified by glycosylation, and the mature endosialin is about 175kDa after the modification. Endosialin is one of human tumor markers, and plays an important role in cell growth, angiogenesis infiltration and metastasis of tumors. Therefore, the targeting of Caspase-3 is improved by the combination of Caspase-3 and the single-chain antibody of endosialin.

In this embodiment, Caspase-3 is derived from human Caspase-3; the single-chain antibody of endosialin is also a single-chain antibody of human endosialin.

Further, the nucleotide sequence encoding Caspase-3 is shown in SEQ ID No. 1. The nucleotide sequence of the recombinant protein formed by the single-chain antibody of endosialin and Caspase-3 is shown as SEQ ID No. 2. The nucleotide sequences shown as SEQ ID No.1 and SEQ ID No.2 can efficiently express corresponding polypeptide fragments.

Specifically, the nucleotide sequence shown as SEQ ID No.1 is:

5’-ATGTTGGTTCCTACAGGATAGACTTCTACCAGTGGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGCTACAAATCAGACTCAGATATGCAGAAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGCAGCTTCGGCCAATGCAGGGCATTTACTCTACCATGGGCTCCAGTCTGAGGATGAGGCTGACTATTATTGTATGATTTGGCACAACAGCGCTGGGGTGTTCGGCGGGGGCACCAAGCTGACCGTCCTAGGCGGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGGCAGGTGCAGCTGCAGGAGTCGGGGGGAACCTTGGTACAGCCTGGTAGGTCCCTGAGACTCTCTTGGAAAGCCTCTGGATTCACCTTTAGCAACTATGCCATGGGCTGGGTCCGCCAGACTCCAGGAAAGGGGCTGGAGTGGCTGTCGGCTATTCGTAAAAGTGGTCCTACCACATACTACGCGGACTCCGTGAAGGGCCGGTTCATCATCTCCAGAGACAATTCCAAGAACACCCTGTATCTGCAAATGAATAGGCTGAGAGTCGGCGACACGGCCACTTATTACTGTGCGACTCACCCCATCGCGGGCTACTGGGGCCAGGGAACCC-3’。

specifically, the nucleotide sequence shown as SEQ ID No.2 is: 5'-GTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAAACTTTAAGAAGGAGATATACATATGCATACTAGCTGGGAAGCGGCACTGGCAGAAGCGTTGGCGGAAGCACTGGCGGAACACCTGGCAGAAGCACTGGCGGAAGCGTTGGAAGCACTGGCGGCCAAGCTTGCTCGACTCACTAGTCTGAAGATCGCAGCCTTCAACATCCAGACAGAAGAAATTGTGGAATTGATGCGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGCCATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATTCAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTTTGGGGAGACCAAGATGTCCAATGCCACCCTCGTCAGCTACATTGTGCAGATCCTGAGCCGCTATGACATCGCCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACAACCTCAATCAGGATGCACCAGACACCTATCACTACGTGGTCAGTGAGCCACTGGGACGGAACAGCTATAAGGAGCGCTACCTGTTCGTGTACAGGCCTGACCAGGTGTCTGCGGTGGACAGCTACTACTACGATGATGGCTGCGAGCCCTGCGGGAACGACACCTTCAACCGAGAGCCAGCCATTGTCAGGTTCTTCTCCCGGTTCACAGAGGTCAGGGAGTTTGCCATTGTTCCCCTGCATGCGGCCCCGGGGGACGCAGTAGCCGAGATCGACGCTCTCTATGACGTCTACCTGGATGTCCAAGAGAAATGGGGCTTGGAGGACGTCATGTTGATGGGCGACTTCAATGCGGGCTGCAGCTATGTGAGACCCTCCCAGTGGTCATCCATCCGCCTGTGGACAAGCCCCACCTTCCAGTGGCTGATCCCCGACAGCGCTGACACCACAGCTACACCCACGCACTGTGCCTATGACAGGATCGTGGTTGCAGGGATGCTGCTCCGAGGCGCCGTTGTTCCCGACTCGGCTCTTCCCTTTAACTTCCAGGCTGCCTATGGCCTGAGTGACCAACTGGCCCAAGCCATCAGTGACCACTATCCAGTGGAGGTGATGCTGAAGGAATTCGCGGGTAATCGTGTGCGTCGCTCTGTTGGTCTTAAGGGTGGTGGAGGTGGTTCTGGTGGTGGAGGTTCTGGTGGTGGTGGATCTGTCCAGCCTGTGCTGACTCAGCCACCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTACGCAGTGACATCA-3' are provided.

The empty vector of the recombinant expression vector may be an empty vector commonly used in the art for expression. In this embodiment, the empty vector of the recombinant expression vector is selected from one of pcDNA3.3c plasmid, pEnCMV-WAC-3 XFLAG plasmid and pCDNA3.1-Mbnl3-m-Myc plasmid. Preferably, the empty vector of the recombinant expression vector is pcDNA3.3c plasmid.

The recombinant attenuated salmonella typhimurium of one embodiment is obtained by transforming the recombinant expression vector into attenuated salmonella typhimurium.

Compared with other bacteria, the salmonella typhimurium is easier to colonize tumor sites and has the characteristics of invasion and aggregation in solid tumors, however, the natural salmonella typhimurium strain has strong toxicity and is easy to cause serious infection of patients. The attenuated salmonella typhimurium can keep the colonization characteristics of tumor parts and also weaken the toxicity of the salmonella typhimurium to patients.

Preferably, the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009. Attenuated salmonella typhimurium VNP20009 is a genetically modified salmonella typhimurium strain with excellent safety characteristics including reduced genotoxicity (puri gene deletion), reduction of septic shock potential (msbb gene deletion), and antibiotic sensitivity.

The recombinant attenuated salmonella typhimurium can efficiently express recombinant protein formed by single-chain antibody of human endosialin and human Caspase-3; and due to the characteristics of tumor specific aggregation and intracellular invasion of the attenuated salmonella typhimurium, the recombinant attenuated salmonella typhimurium can efficiently express the recombinant protein formed by the single-chain antibody of the human endosialin and the human Caspase-3 around tumor cells, thereby achieving the effect of specifically killing tumors. In addition, the single-chain antibody of the human endosialin and the single-chain antibody of the human endosialin of the recombinant protein formed by the human Caspase-3 have targeting property on the endothelial sialoprotein positive cells, and the effect of specifically killing the tumor cells can be better realized and the damage to the normal cells of the organism can be reduced by combining the targeting property of the single-chain antibody of the human endosialin with the cell killing effect of Caspase-3.

The method for constructing recombinant attenuated salmonella typhimurium of an embodiment includes steps S110 to S120. Specifically, the method comprises the following steps:

and step S110, introducing the target expression fragment into an expression empty vector to obtain a recombinant expression vector. Wherein the target expression fragment comprises a nucleotide sequence coding for a recombinant protein formed by a single-chain antibody of endosialin and Caspase-3.

Specifically, the single-chain antibody of endosialin is a single-chain antibody scFv78 specifically recognizing endosialin, which is called scFv78 for short. The expression empty vector is selected from one of pcDNA3.3c plasmid, pEnCMV-WAC-3 XFLAG plasmid and pCDNA3.1-Mbnl3-m-Myc plasmid. Of course, the expression empty vector may also be other empty vectors commonly used in the art for expression.

The nucleotide sequence of the recombinant protein formed by the single-chain antibody of endosialin and Caspase-3 is shown as SEQ ID No. 2. The recombinant expression vector containing the nucleotide sequence shown as SEQ ID No.1 or SEQ ID No.2 can efficiently express the corresponding polypeptide fragment in a host.

The expression empty vector in this embodiment is pcDNA3.3c plasmid. The pcDNA3.3c plasmid is a DNA molecule whose nucleotide sequence is shown in SEQ ID No. 3. 5'-GTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGAGGATCGAACCCTTACTAGTGCCACCATGGAGTTTGGGCTGAGCTGGGTCTTCCTGGTGGCTATCTTGAAGGGTGTCCAGTGTGAGGTGGCTAGCGAATTCAAGCTTCCCGGGGTCGACCTGCAGGAGCTCCTCGAGAGATCTGGATCCCACCATCACCACCATCACCACCACGGGTGAGCGGCCGCTTCATGAAGGGTTCGATCCCTACCGGTTAGTAATGAGTTTAAACGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCAGATCTGCGCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTA-3' are provided.

Specifically, the target expression fragment is introduced into the expression empty vector in a enzyme digestion and enzyme connection mode. The target expression fragment comprises a cohesive end corresponding to the enzyme cutting site on the expression empty vector, and the cohesive end is used for connecting the target expression fragment with the expression empty vector after enzyme cutting. Further, the ligase is T4 ligase.

In this embodiment, the expression empty vector is pcDNA3.3c plasmid. The expression fragment of interest includes the Xho I cohesive ends and the EcoR I cohesive ends. Of course, in other embodiments, the cohesive ends of the target expression fragment are not limited to the Xho I cohesive end and the EcoR I cohesive end, and may be designed according to the corresponding enzyme cleavage site of the expression empty vector and the selected endonuclease.

Of course, the method further comprises the steps of verifying whether the target expression fragment is correctly introduced into the expression empty vector and performing scale-up culture on the recombinant expression vector into which the target expression fragment has been correctly inserted, after the target expression fragment is introduced into the expression empty vector. Specifically, the means for verifying whether the expression fragment of interest is correctly introduced into the expression empty vector includes colony resistance screening or sequencing. The step of expanding culture includes transferring the recombinant expression vector into E.coli Top10 for culture and expansion.

And step S120, transforming the recombinant expression vector into attenuated salmonella typhimurium to obtain the recombinant attenuated salmonella typhimurium.

In this embodiment, the mode of transformation of the recombinant expression vector into the attenuated Salmonella typhimurium is electrotransformation. The attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009. Specifically, a 0.1cm electric rotating cup is adopted, and the recombinant expression vector is electrically rotated into the sensitive attenuated salmonella typhimurium VNP20009 under the conditions of 1.8kV, 200 omega, 25 muF and 4.7 ms; then screening out positive clones through ampicillin resistance to obtain the recombinant attenuated salmonella typhimurium. Of course, in other embodiments, other transformation means commonly used in the art may be used to transform the recombinant expression vector into competent attenuated salmonella typhimurium.

Further, the preparation steps of the competent attenuated salmonella typhimurium VNP20009 comprise: the attenuated salmonella typhimurium VNP20009 is streaked and inoculated to an LB plate without resistance and cultured overnight at 37 ℃; picking a single colony in 5mL LB culture medium, and carrying out shake culture at 37 ℃ for 12 h; inoculating the strain into 100mL LB culture medium according to the proportion of 1:100, and performing shaking culture until the OD value of bacteria is 0.4; ice-cooling for 20min, and centrifuging at 4 deg.C and 3000rpm for 10 min; washing thallus precipitate twice with 1/10 volume pre-cooled sterile deionized water, centrifuging at 4 deg.C and 3000rpm for 10 min; washing thallus with 1/100 volume precooled 10% glycerol, centrifuging at 4 deg.C and 3000rpm for 10 min; the pellet was resuspended in 1/100 volumes of pre-cooled 10% glycerol to give a competent attenuated Salmonella typhimurium VNP 20009.

The construction method of the recombinant attenuated salmonella typhimurium is simple, convenient and easy to operate, and is suitable for industrial production.

The recombinant expression vector or the recombinant attenuated salmonella typhimurium is applied to the preparation of antitumor drugs. Further, the tumor is a solid tumor. Such as sarcoma, brain tumor, breast cancer, skin cancer, or colon cancer.

An antitumor drug comprises the recombinant attenuated salmonella typhimurium.

The anti-tumor medicament comprises the recombinant attenuated salmonella typhimurium, can kill tumor cells specifically and targetedly and simultaneously reduce the damage of the tumor cells to normal cells of an organism, and has good anti-tumor effect; in addition, the antitumor drug adopts attenuated salmonella typhimurium as a drug expression vector, mediates eukaryotic plasmid transfected cells and realizes eukaryotic expression of the cells, and the drug cost is greatly reduced.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The following detailed description is given with reference to specific examples. The following examples are not specifically described, and other components except inevitable impurities are not included. The examples, which are not specifically illustrated, employ drugs and equipment, all of which are conventional in the art. The experimental procedures, in which specific conditions are not indicated in the examples, were carried out according to conventional conditions, such as those described in the literature, in books, or as recommended by the manufacturer.

Example 1

(1) A plasmid pUC 57-Csepase 3 and a plasmid pUC 57-78-Csepase 3 were synthesized by Nanjing Kingsry Biotech Ltd. Wherein, the plasmid pUC 57-Csepase 3 contains a target expression fragment which has a nucleotide sequence shown as SEQ ID No.1 and codes Caspase-3; the plasmid pUC 57-78-Csepase 3 contains a target expression fragment with a nucleotide sequence shown as SEQ ID No.2 and codes a recombinant protein formed by a single-chain antibody of endosialin and Caspase-3.

(2) The plasmid pUC 57-Csappase 3 and the plasmid pcDNA3.3c are subjected to Xho I and EcoR I double enzyme digestion respectively, after the enzyme digestion products are purified, T4 ligase is adopted, and colony screening verification is carried out, so that the recombinant expression vector pcDNA3.3c-Caspase-3 (or called recombinant plasmid pcDNA3.3c-Caspase-3) is obtained. The plasmid pUC 57-78-Csepase 3 and the plasmid pcDNA3.3c are subjected to double enzyme digestion by Xho I and EcoR I respectively, after enzyme digestion products are purified, T4 ligase is adopted for colony screening and verification, and the recombinant expression vector pcDNA3.3c-78-Caspase-3 (or the recombinant plasmid pcDNA3.3c-78-Caspase-3) is obtained. Wherein, the PCR verification result after extracting the plasmids in the positive clone of the recombinant plasmid pcDNA3.3c-Caspase-3 group is shown in figure 1; the PCR results of the plasmid extraction from the positive clones of the recombinant plasmid pcDNA3.3c-78-Caspase-3 group are shown in FIG. 2. In FIG. 1, M is Marker-DL 2000; lanes 1-5 are plasmid pcDNA3.3c-Caspase-3; in FIG. 2, M is Marker-DL 2000; lanes 5-6 are plasmids pcDNA3.3c-78-Caspase-3.

As can be seen from FIGS. 1 and 2, the recombinant plasmid pcDNA3.3c-78-Caspase-3 and the recombinant plasmid pcDNA3.3c-Caspase-3 were successfully constructed.

(3) The attenuated salmonella typhimurium VNP20009 preserved at-80 ℃ is streaked and inoculated to an LB plate without resistance and cultured overnight at 37 ℃; then picking a single colony in 5mL LB, and carrying out shake culture at 37 ℃ for 12 h; inoculating the strain in 100mLLB according to the proportion of 1:100, and performing shaking culture until the OD of the bacteria is about 0.4; after ice-bath for 20min, centrifuging at 4 ℃ and 3000rpm for 10 min; washing thallus precipitate twice with 1/10 volume of precooled sterile deionized water, and centrifuging at 4 ℃ and 3000rpm for 10 min; washing thallus with 1/100 volume precooled 10% glycerol, centrifuging at 4 deg.C 3000rpm for 10 min; and (3) resuspending the thallus precipitate in 1/100 volume of precooled 10% glycerol to prepare competent attenuated salmonella typhimurium VNP20009, and reserving the competent attenuated salmonella typhimurium at-80 ℃ for later use after subpackaging.

(4) Respectively electrically transforming the recombinant plasmid pcDNA3.3c-Caspase-3 and the recombinant plasmid pcDNA3.3c-78-Caspase-3 obtained in the step (2) into the competent attenuated salmonella typhimurium VNP20009 obtained in the step (3): adopting a 0.1cm electric revolving cup, and setting the conditions as follows: 1.8kV, 200 omega, 25 muF, 4.7ms of electric conversion; then screening out positive clones through ampicillin resistance to obtain two recombinant attenuated salmonella typhimurium, and naming the recombinant attenuated salmonella typhimurium corresponding to the recombinant plasmid pcDNA3.3c-Caspase-3 as VNP 20009-pcDNA3.3c-Caspase-3; the recombinant plasmid pcDNA3.3c-78-Caspase-3 corresponds to the recombinant attenuated Salmonella typhimurium VNP 20009-pcDNA3.3c-78-Caspase-3.

(5) MS1-TEM1 cells (gift from university of Pennsylvania) were seeded in 96-well plates (using penicillin-and streptomycin-free medium) at 10000 cells/well, and the two recombinant attenuated Salmonella typhimurium obtained in step (4) were cultured in MS1-TEM1 cells: the recombinant attenuated salmonella typhimurium is inoculated in a 96-well plate at the ratio of 1:1, the total volume is 200 mu L, after 2h of culture, the culture medium is replaced by a culture medium containing penicillin and streptomycin for mixed culture for 24h, the killing effect of the recombinant proteins generated by the two recombinant attenuated salmonella typhimurium on cells is compared by adopting an MTT colorimetric method, and the results are shown in figures 3 to 5.

FIG. 3 is a blank control (attenuated Salmonella typhimurium VNP 20009); FIG. 4 shows the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 co-cultured with MS1-TEM1 cells for 24 h. FIG. 5 shows MTT assay results for blank control (MS1-TEM1 cells), attenuated Salmonella typhimurium VNP20009, recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3, and recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3, where the ordinate of FIG. 5 is the relative cell density.

As can be seen from FIG. 5, compared with the blank control group and the attenuated Salmonella typhimurium VNP20009 group, the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 group and the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3 group both showed more significant killing effects, and the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3 group had the best effect. Therefore, the MTT detection result is consistent with the microscopic examination result, and the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 and the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3 have definite killing effect on tumor cells.

(6) MS1-TEM1 (donated by university of Pennsylvania) cells were treated at 5X 10⁶An MS1-TEM1 mouse tumor (subcutaneous tumor) model was prepared by inoculating subcutaneously into 6-week-old female C57BL/6 mice and randomly grouping 10 mice each. By adding attenuated Salmonella typhimurium VNP20009 (1X 10) to drinking water of tumor model mice⁷CFU/mL), recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 (1X 10)⁷CFU/mL) and recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3 (1X 10)⁷CFU/mL) to evaluate the tumor inhibition effect of the recombinant attenuated Salmonella typhimurium. The tumor model mice are treated once every three days, the tumor volume of the mice is measured once every 2-3 days, the tumors are taken out of the mice after the experiment (or the mice die), the diameters of the tumors are measured, and the tumors are weighed, and the result is shown in fig. 6. FIG. 6In the middle, the abscissa is time (day) and the ordinate is tumor volume (mm)³)。

As can be seen from FIG. 6, the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-Caspase-3 and the recombinant attenuated Salmonella typhimurium VNP20009-pcDNA3.3c-78-Caspase-3 have obvious tumor size inhibition effect and good anti-tumor effect.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen Shenzhu Biotechnology Limited

<120> recombinant expression vector, recombinant attenuated salmonella typhimurium and construction method and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>645

<212>DNA

<213>Artificial Sequence

<400>1

atgttggttc ctacaggata gacttctacc agtggaagcc agggagtcct ccccagtatc 60

tcctgagcta caaatcagac tcagatatgc agaagggctc tggagtcccc agccgcttct 120

ctggatccaa agcagcttcg gccaatgcag ggcatttact ctaccatggg ctccagtctg 180

aggatgaggc tgactattat tgtatgattt ggcacaacag cgctggggtg ttcggcgggg 240

gcaccaagct gaccgtccta ggcggtggtt cctctagatc ttcctcctct ggtggcggtg 300

gctcgggcgg tggtgggcag gtgcagctgc aggagtcggg gggaaccttg gtacagcctg 360

gtaggtccct gagactctct tggaaagcct ctggattcac ctttagcaac tatgccatgg 420

gctgggtccg ccagactcca ggaaaggggc tggagtggct gtcggctatt cgtaaaagtg 480

gtcctaccac atactacgcg gactccgtga agggccggtt catcatctcc agagacaatt 540

ccaagaacac cctgtatctg caaatgaata ggctgagagt cggcgacacg gccacttatt 600

actgtgcgac tcaccccatc gcgggctact ggggccaggg aaccc 645

<210>2

<211>1448

<212>DNA

<213>Artificial Sequence

<400>2

gtgagcggat aacaattccc ctctagaaat aattttgttt aaactttaag aaggagatat 60

acatatgcat actagctggg aagcggcact ggcagaagcg ttggcggaag cactggcgga 120

acacctggca gaagcactgg cggaagcgtt ggaagcactg gcggccaagc ttgctcgact 180

cactagtctg aagatcgcag ccttcaacat ccagacagaa gaaattgtgg aattgatgcg 240

tgatgtttct aaagaagatc acagcaaaag gagcagtttt gtttgtgtgc ttctgagcca 300

tggtgaagaa ggaataattt ttggaacaaa tggacctgttgacctgaaaa aaataacaaa 360

ctttttcaga ggggatcgtt gtagaagtct aactggaaaa cccaaacttt tcattattca 420

ggcctgccgt ggtacagaac tggactgtgg cattgagaca gacagtggtg ttgatgatga 480

catggcgtgt cataaaatac cagtggaggc cgacttcttg tttggggaga ccaagatgtc 540

caatgccacc ctcgtcagct acattgtgca gatcctgagc cgctatgaca tcgccctggt 600

ccaggaggtc agagacagcc acctgactgc cgtggggaag ctgctggaca acctcaatca 660

ggatgcacca gacacctatc actacgtggt cagtgagcca ctgggacgga acagctataa 720

ggagcgctac ctgttcgtgt acaggcctga ccaggtgtct gcggtggaca gctactacta 780

cgatgatggc tgcgagccct gcgggaacga caccttcaac cgagagccag ccattgtcag 840

gttcttctcc cggttcacag aggtcaggga gtttgccatt gttcccctgc atgcggcccc 900

gggggacgca gtagccgaga tcgacgctct ctatgacgtc tacctggatg tccaagagaa 960

atggggcttg gaggacgtca tgttgatggg cgacttcaat gcgggctgca gctatgtgag 1020

accctcccag tggtcatcca tccgcctgtg gacaagcccc accttccagt ggctgatccc 1080

cgacagcgct gacaccacag ctacacccac gcactgtgcc tatgacagga tcgtggttgc 1140

agggatgctg ctccgaggcg ccgttgttcc cgactcggct cttcccttta acttccaggc 1200

tgcctatggc ctgagtgacc aactggccca agccatcagt gaccactatc cagtggaggt 1260

gatgctgaag gaattcgcgg gtaatcgtgt gcgtcgctct gttggtctta agggtggtgg 1320

aggtggttct ggtggtggag gttctggtgg tggtggatct gtccagcctg tgctgactca 1380

gccaccttcc ctctctgcat ctcctggagc atcagccagt ctcacctgca ccttacgcag 1440

tgacatca 1448

<210>3

<211>1288

<212>DNA

<213>Artificial Sequence

<400>3

gttaggcgtt ttgcgctgct tcgcgatgta cgggccagat atacgcgttg acattgatta 60

ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc atatatggag 120

ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa cgacccccgc 180

ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac tttccattga 240

cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca agtgtatcat 300

atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc 360

cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt agtcatcgct 420

attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg gtttgactca 480

cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg gcaccaaaat 540

caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg 600

cgtgtacggt gggaggtcta tataagcaga gctcgtttag tgaaccgtca gatcgcctgg 660

agacgccatc cacgctgttt tgacctccat agaagacacc gggaccgatc cagcctccgg 720

actctagagg atcgaaccct tactagtgcc accatggagt ttgggctgag ctgggtcttc 780

ctggtggcta tcttgaaggg tgtccagtgt gaggtggcta gcgaattcaa gcttcccggg 840

gtcgacctgc aggagctcct cgagagatct ggatcccacc atcaccacca tcaccaccac 900

gggtgagcgg ccgcttcatg aagggttcga tccctaccgg ttagtaatga gtttaaacgg 960

gggaggctaa ctgaaacacg gaaggagaca ataccggaag gaacccgcgc tatgacggca 1020

ataaaaagac agaataaaac gcacgggtgt tgggtcgttt gttcataaac gcggggttcg 1080

gtcccagggc tggcactctg tcgatacccc accgagaccc cattggggcc aatacgcccg 1140

cgtttcttcc ttttccccac cccacccccc aagttcgggt gaaggcccag ggctcgcagc 1200

caacgtcggg gcggcaggcc ctgccatagc agatctgcgc agctggggct ctagggggta 1260

tccccacgcg ccctgtagcg gcgcatta 1288

Claims

1. A recombinant expression vector comprising a nucleotide sequence encoding a recombinant protein formed from a single chain antibody to endosialin and Caspase-3.

2. The recombinant expression vector according to claim 1, wherein the nucleotide sequence encoding the recombinant protein is shown in SEQ ID No. 2.

3. A recombinant attenuated Salmonella typhimurium transformed from a recombinant expression vector comprising a nucleotide sequence encoding a recombinant protein formed from a single chain antibody to endosialin and Caspase-3.

4. The recombinant attenuated salmonella typhimurium of claim 3, wherein the nucleotide sequence encoding the recombinant protein is set forth in SEQ ID No. 2.

5. The recombinant attenuated salmonella typhimurium of claim 3, wherein the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009.

6. A construction method of recombinant attenuated salmonella typhimurium is characterized by comprising the following steps:

7. The method for constructing recombinant attenuated salmonella typhimurium according to claim 6, wherein the nucleotide sequence encoding the recombinant protein is shown as SEQ ID No. 2.

8. The method for constructing recombinant attenuated Salmonella typhimurium according to any one of claims 6 to 7, wherein the expression empty vector is selected from one of pcDNA3.3c plasmid, pEnCMV-WAC-3 XFLAG plasmid and pCDNA3.1-Mbnl3-m-Myc plasmid.

9. Use of the recombinant expression vector of any one of claims 1 to 2 or the recombinant attenuated salmonella typhimurium of any one of claims 3 to 5 or the recombinant attenuated salmonella typhimurium prepared by the method for constructing the recombinant attenuated salmonella typhimurium of any one of claims 6 to 8 in the preparation of an anti-tumor medicament.

10. The use of claim 9, wherein the tumor is a solid tumor.

11. An antitumor drug comprising the recombinant expression vector of any one of claims 1 to 2 or the recombinant attenuated salmonella typhimurium of any one of claims 3 to 5 or the recombinant attenuated salmonella typhimurium produced by the method for constructing the recombinant attenuated salmonella typhimurium of any one of claims 6 to 8.