CN109081873B

CN109081873B - Anti-tumor recombinant NMM fusion antigen plasmid DNA vaccine

Info

Publication number: CN109081873B
Application number: CN201810908222.1A
Authority: CN
Inventors: 于继云; 王宇; 徐强; 柯尊阳; 宋卫卫; 郭润姿
Original assignee: Gu'an Dingtai Haigui Biological Technology Co ltd
Current assignee: Beijing Zhendan Dingtai Biotechnology Co ltd
Priority date: 2018-08-10
Filing date: 2018-08-10
Publication date: 2022-04-22
Anticipated expiration: 2038-08-10
Also published as: CN109081873A

Abstract

The invention discloses an anti-tumor recombinant NMM fusion antigen plasmid DNA vaccine. The design scheme of the anti-tumor recombinant NMM fusion antigen is as follows: the NY-ESO-1 is linked to the 5 ' end of the MUCI gene by linker arm GCAGCATAT, and the 3 ' end of the MUCI gene is linked to the 5 ' end of the MAGE-A3 encoding gene by linker arm AAGAAG. The NMM fusion antigen target can cover various tumors, particularly body surface tumors, such as breast cancer, lymphoma, skin cancer, thyroid cancer and melanoma. The tumor plasmid DNA vaccine pNMM is a novel immunotherapy drug which can generate efficient systemic anti-tumor immune response through local injection, has good safety and tolerance and has the potential of being developed into an effective anti-tumor relapse drug.

Description

Anti-tumor recombinant NMM fusion antigen plasmid DNA vaccine

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an anti-tumor recombinant NMM fusion antigen plasmid DNA vaccine.

Background

Currently, neoplasms are an important public health problem and are also one of the leading causes of death in countries around the world. According to the global statistical data of the tumor epidemics, the number of newly increased cancer cases increases to 2000 ten thousand every year in 2025. Cancer morbidity and mortality in the united states have been reported to decrease continuously for many years. This indicates that prevention and control of cancer can be achieved by medical means and the like. However, in recent years, with the increase of population and the increasing degree of aging, the morbidity and mortality of tumor patients in China are continuously increased. Cancer remains a serious disease burden in our country. Therefore, research on the prevention, treatment and prognosis of tumors is still important.

After the tumor treatment is carried out by simple surgical excision and radiotherapy/chemotherapy for killing one thousand of eight hundred, the fourth major tumor treatment technology, namely immunotherapy, appears, namely, the tumor cells are restarted to maintain the recognition and killing of the immune system on the tumor cells by a method for targeting the tumor cells or activating the immune cells, and the normal anti-tumor immune response of an organism is recovered. The Central Style of Sterline cancer states that future tumor treatments should be a combination of immunotherapies rather than a single treatment modality. Checkpoint monoclonal antibody, CAR-T, is a representative means in current tumor immunotherapy, with a large number of research institutes and researchers. Although they have some therapeutic effects on tumors to some extent, they are not as expected, and systemic administration can induce some adverse reactions such as cytokine storm, which limits part of their clinical application and development.

One of the hot spots of recent research on therapeutic tumor vaccines is to deliver tumor target antigens into human bodies to induce the organisms to actively generate specific immune response and prevent the growth, diffusion and recurrence of tumors so as to achieve the purpose of eliminating or controlling the tumors, and the therapeutic tumor vaccine is a novel biological immune technology drug. Immunotherapy with tumor-specific antigens (TSAs) can initiate an anti-tumor effect, mainly a tumor-specific Cytotoxic T Lymphocyte (CTL) response, to effectively fight tumors, prevent metastasis, recurrence, and no damage to unrelated tissues, with anti-tumor specificity and immune memory comparable to those of other approaches.

The medicine can be injected locally, has good safety and tolerance, can induce systemic immunity, and is a mild and effective tumor treatment medicine. The development speed of tumor vaccines is not fast in the last decade, and with the development of technologies, especially the development of high-throughput sequencing, individualized treatment and intratumoral injection technologies, new power is brought to the development of tumor vaccines. Particularly, in recent two years, the disclosure of the high-efficiency clinical test results of personalized tumor vaccines of the American and Germany research groups and the shocking animal experiment results obtained by scholars at Stanford university delivering the tumor vaccines by intratumoral injection push the research of the tumor vaccines to the wave tip of the tuyere, so that the study of a plurality of research institutions and investment institutions draws attention. The therapeutic tumor vaccine is an important technical means for preventing and treating postoperative recurrence and metastasis of malignant tumor, and is an important industrial growth point in the field of biological medicine. The therapeutic vaccine is used for carrying out the ultra-early intervention of the tumor and preventing the postoperative recurrence, and possibly brings new hope for the prevention and treatment of the tumor.

Disclosure of Invention

The invention aims to provide an anti-tumor recombinant NMM fusion antigen plasmid DNA vaccine.

An anti-tumor recombinant NMM fusion antigen takes MAGE-A3 as a main antigen framework, upstream fusion MUC1 antigen CTL epitope and downstream fusion NY-ESO-1 antigen CTL epitope.

The design and fusion scheme of the anti-tumor recombinant NMM fusion antigen is as follows: the NY-ESO-1 is linked to the 5 ' end of the MUCI gene by linker arm GCAGCATAT, and the 3 ' end of the MUCI gene is linked to the 5 ' end of the MAGE-A3 encoding gene by linker arm AAGAAG.

The amino acid sequence of the anti-tumor recombinant NMM fusion antigen is shown in a sequence table SEQ ID NO: 1 is shown.

The gene sequence of the anti-tumor recombinant NMM fusion antigen is shown in a sequence table SEQ ID NO: 2, respectively.

A plasmid vector containing the anti-tumor recombinant NMM fusion antigen gene.

Host bacteria containing the plasmid vector of the anti-tumor recombinant NMM fusion antigen gene.

And (3) a primer for amplifying any segment in the anti-tumor recombinant NMM fusion antigen gene.

The anti-tumor recombinant NMM fusion antigen gene is applied to the preparation of anti-tumor plasmid DNA vaccines.

The tumor is breast cancer, lymphoma, skin cancer, thyroid cancer and melanoma.

The invention has the beneficial effects that: the invention designs and constructs a recombinant plasmid DNA (pNMM) vaccine fused with 3 tumor antigen targets (NY-ESO-1, MUC1, MAGE-A3), wherein the 3 tumor antigen targets can cover various tumors, in particular body surface tumors such as breast cancer, lymphoma, skin cancer, thyroid cancer and melanoma, and the above 5 tumors have about 50 thousands of new cases every year. FLT3L and CD40L capable of stimulating proliferation and maturation of DC, GM-CSF and a co-stimulatory molecule CD80 capable of stimulating proliferation and differentiation of various immune cells are also expressed in the recombinant plasmid DNA in a fusion manner, so that the immunogenicity of the plasmid DNA can be further improved theoretically, and the anti-tumor immune effect of the plasmid DNA can be further enhanced. pNMM can be used for immunization by intramuscular injection or intratumoral injection, and the intratumoral injection can achieve better effect according to the conjecture of the previous research. Meanwhile, the vaccine can be used independently, and can also be applied in combination therapy with other immune preparations. When used alone, the composition can play a role in resisting tumor recurrence and metastasis, and when used in combination, the composition can enhance the anti-tumor effect and reduce the dosage of monoclonal antibody or CAR-T immune preparations, thereby greatly reducing the probability of systemic adverse reaction. The tumor plasmid DNA vaccine pNMM is a novel immunotherapy drug which can generate efficient systemic anti-tumor immune response through local injection, has good safety and tolerance and has the potential of being developed into an effective anti-tumor relapse drug.

Drawings

FIG. 1 pUC57-NMM plasmid double digestion; in the figure, 1: before the enzyme digestion of pUC57-NMM plasmid; 2: double digestion of pUC57-NMM plasmid Bgl II and NotI; 3: and (5) DNA marker.

FIG. 2 double digestion of pVAX1-FLT3L-4P-CD40L-IRES-GM + B7 plasmid; in the figure, 1: before the plasmid pVAX1-FLT3L-4P-CD40L-IRES-GM + B7 is digested; 2: carrying out double digestion on plasmid Bgl II and NotI of pVAX1-FLT3L-4P-CD40L-IRES-GM + B7; 3: and (5) DNA marker.

FIG. 3 double restriction enzyme identification of pVAX1-FLT3L-NMM-CD40L-IRES-GM + B7 plasmid; in the figure, 1: carrying out double digestion on plasmid Bgl II and NotI of pVAX1-FLT3L-NMM-CD40L-IRES-GM + B7; 2: and (5) DNA marker.

FIG. 4 double restriction enzyme identification of plasmid pSFVK1-FLT3L-NMM-CD40L-IRES-GM + B7(pSFVK 1-NMM); in the figure, 1: before cutting pSFVK1-NMM plasmid; 2: carrying out BamHI enzyme digestion on pSFVK1-NMM plasmid; 3: and (5) DNA marker.

FIG. 5 Western blot detection result of antigen expressed by pSFVK1-NMM plasmid.

FIG. 6 ELISPOT statistics test results.

FIG. 7 statistics of tumor formation time of mice in each experimental group.

FIG. 8 shows the tumor growth curves of tumor-bearing mice of each experimental group.

FIG. 9 mean tumor weight of tumor-bearing mice of each experimental group.

FIG. 10 shows the tumor suppression rate in each experimental group.

Detailed Description

The invention is further described with reference to the following figures and specific embodiments.

The experimental primer segment is synthesized by biological engineering (Shanghai) GmbH; the vector pSFVK1 and the transition plasmid pVAX1-FLT3L-4P-CD40-IRES-GM/B7 were constructed by the same company (the construction method is referred to the following patent: application No. 2015107650912); plasmid pUC57-NY-ESO-1/MUC1/MAGE-A3 containing humanized fusion genes NY-ESO-1, MUC1 and MAGE-A3 was synthesized and constructed by GeneWiz. 50 XTAE (Tris acetate running buffer) was obtained from Beijing BO Chuang technology Ltd; regular Agarose G-10 was from Biowest; ttype and Yeast extract are from Oxoid corporation; agar powder, purified from chemical reagents of the national drug group, ltd; sodium chloride and ethanol were from the Beijing chemical plant; 2 xTaq PCR Mix was purchased from Beijing Bo Innovation technologies, Inc.; the Seamless Assembly Cloning Kit is from the company Mimetai and Biotechnology (Beijing); the competence preparation kit is from Biotechnology engineering (Shanghai) GmbH; bulk agarose gel DNA recovery kit (spin column type) from TIANGEN; plasmid small-amount extraction kit (centrifugal column type) and plasmid large-amount extraction kit (centrifugal column type) are from Beijing Virginia east science and technology Co., Ltd; t4DNA ligase, DNA restriction endonuclease from New England Biolabs (NEB); gel recovery kit and plasmid recovery kit are purchased from health into century biotechnology limited company.

Example 1 design of fusion antigen and expression plasmid construction

1. Analysis, selection and design of antigens

MAGE-A3 is used as a main antigen framework, MUC1 antigen CTL epitope is fused at the upstream, and NY-ESO-1 antigen CTL epitope is fused at the downstream. The NY-ESO-1 is connected with the 5 ' end of the MUCI gene through a connecting arm GCAGCATAT, the 3 ' end of the MUCI gene is connected with the 5 ' end of the MAGE-A3 coding gene through a connecting arm AAGAAG, the total length of the final fusion gene is 1073bp (shown as a sequence table SEQ ID NO: 2), and 353 amino acids (shown as a sequence table SEQ ID NO: 1) are coded. The amino acid sequence is shown in Table 1 below (-AAY-and-KK-added linker arm):

TABLE 1 design of fusion antigens

Finally, the whole sequence of the fusion antigen gene is synthesized by Jinwei Zhi company (the sequence comprises an upstream enzyme cutting site BglII, a downstream enzyme cutting site NotI and a bold part), and the whole sequence is shown as the sequence table SEQ ID NO: 2, respectively.

2. Obtaining NMM fusion antigen gene fragment

After the fusion antigen gene sequence is synthesized, an NMM fusion antigen gene fragment NY-ESO-1/MUC1/MAGE-A3 is obtained from a plasmid pUC57-NY-ESO-1/MUC1/MAGE-A3 in a digestion and purification mode, and a digestion product is subjected to 1% agarose electrophoresis identification. As shown in FIG. 1 below, the molecular weight of the NMM antigen gene fragment is consistent with the expected molecular weight, about 1065 bp.

2.1 preparation and recovery of transition plasmid pVAX1-FLT3L-4P-CD40L-IRES-GM + B7 by digestion

Plasmid was extracted according to the plasmid miniprep kit of Beijing Huiwai Orient science and technology, transition plasmid pVAX1-FLT3L-4P-CD40L-IRES-GM/B7, and after BglII/Not I double digestion, two gene fragments with different sizes were generated, as shown in FIG. 2. The large fragment was recovered and used as the backbone for the construction plasmid, designated the transition vector pVAX1-FLT3L-CD40L-IRES-GM + B7.

2.2 connection and transformation of transition vector pVAX1-FLT3L-CD40L-IRES-GM/B7 and NMM fusion antigen gene NY-ESO-1/MUC1/MAGE-A3T4

Connecting the transition vector recovered by cutting the gel with an NMM fusion antigen gene, wherein the system is as follows:

the reaction conditions are that the ligation is carried out for 15min at 25 ℃, and the ligase activity is removed for 15min at 65 ℃.

Transforming the ligation product into E.coli DH5 alpha competent Escherichia coli, and identifying and cloning by colony PCR:

because the DNA carrier and the fusion antigen fragment are connected through BglII/Not I, the primers of the upstream F and the downstream R are designed to cover the upstream and the downstream of the fusion antigen as an amplification object:

upstream F: 5'-GGTACCGCCACCATGTCCCTGTTGATGTGGATC-3'

Downstream R: 5'-CTCGAGTCATTACTCTTCCCCCTCTCTC-3'

PCR System (12. mu.L): 5ul of 2 × PCR mix; ddH of 5ul₂O; 1ul of F (10uM)1ul of R (10uM), and PCR amplification was performed on the ligation-transformed colonies. Carrying out PCR by using a PCR instrument under the reaction condition of 95 ℃ for 5min for 1 cycle; 30 cycles of amplification at 94 ℃ for 30s, at 55 ℃ for 30s, and at 72 ℃ for 30 s; 7min at 72 ℃. The PCR products were analyzed by 0.8% agarose DNA gel electrophoresis. The results of the identification are shown in FIG. 3.

2.3 recombinant ligation of vector pSFVK1 with FLT3L-NY-ESO-1/MUC1/MAGE-A3-CD40-IRES-GM/B7 fragment

Using pVAX1-FLT3L-NY-ESO-1/MUC1/MAGE-A3-CD40-IRES-GM/B7 plasmid as template, the following primers, upstream 4pGMb7-r and downstream 4pGMb8-f, were used:

4pGMb7-r：5’CGTTAATACACAGAATTCTGATTGGATCCCGGATCCGCCACCATGACAGTG 3’

4pGMb8-f： 5’GCGTAGGGATGTAATTCAATTAATTACCCCTCGAGCGCGCTTATACAGGGCGTAC 3’

amplifying a target gene DNA fragment, and carrying out PCR amplification by using a PCR instrument under the following reaction conditions:

the reaction condition is 95 ℃ for 5 min; 30s at 94 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles; 7min at 72 ℃. The PCR product was analyzed by 0.8% agarose DNA gel electrophoresis, and the 4.3kb target gene fragment was recovered by gel cutting, as described above.

Carrying out linearization treatment by utilizing a Sma I single enzyme digestion vector, wherein a single enzyme digestion system is as follows:

the enzyme is cut for 4 hours at 25 ℃, 20min at 65 ℃, identified by 0.7 percent electrophoresis, purified and recycled.

The linearized vector pSFVK1 was ligated with the target DNA FLT3L-NY-ESO-1/MUC1/MAGE-A3-CD40-IRES-GM/B7 by recombinant ligation in a gentle mixing system, centrifuged for several seconds, and reacted at 50 ℃ for 15 minutes on a heating apparatus.

After the reaction is finished, placing the centrifugal tube on ice for bacterial transformation, selecting a plurality of monoclonal thalli after the bacterial transformation, and carrying out PCR identification: since the pSFVK1 vector is recombined with the target DNA, the upstream primer 4pGMb7-r and the downstream primer 4pGMb8-f are used for amplifying the target DNA, wherein the upstream primer and the downstream primer contain the upstream primer and the downstream primer:

4pGMb7-r：5’CGTTAATACACAGAATTCTGATTGGATCCCGGATCCGCCACCATGACAGTG 3’

4pGMb8-f： 5’GCGTAGGGATGTAATTCAATTAATTACCCCTCGAGCGCGCTTATACAGGGCGTAC 3’

PCR System (12. mu.L): 5ul of 2 × PCR mix; 5ul of ddH 2O; 1ul of 4pGMb7-r (10uM)1ul of 4pGMb8-f (10uM), ligation transformed colonies were PCR amplified. Carrying out PCR by using a PCR instrument under the reaction condition of 95 ℃ for 5min for 1 cycle; amplifying for 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s and 72 ℃ for 2 min; 7min at 72 ℃. The PCR products were analyzed by 0.8% agarose DNA gel electrophoresis.

Clones were identified as positive by PCR, plasmids were extracted and identified by BamHI digestion (as shown in FIG. 4). The final successfully constructed recombinant plasmid was named pSFVK1-NMM (pNMM).

2.4 transfection and expression characterization of recombinant plasmid DNA

Transfection procedure

a. Collecting 293T cells by a trypsinization method, resuspending and counting by using a fresh culture solution, inoculating 20 ten thousand cells into each hole of a six-hole plate for culturing, and enabling the cell confluency to reach 50-80% after 24 hours (on the day of transfection);

b. on the day of transfection, a transfection complex is first prepared: adding 200 μ l DMEM medium, 2 μ g pSFVK1-NMM plasmid and 6 μ l Chemifect into a sterilized EP tube (1.5ml), mixing, and standing at room temperature for 30min to form a transfection complex;

c. gently adding the incubated transfection complex into cells, gently shaking front and back and left and right to fully mix the transfection complex, marking, and culturing in a cell culture box with 5% CO2 at 37 ℃;

d.6h later, the culture solution is replaced, and 5 mu l of Z-VAD is added into one group at the same time;

e. after 48h of culture, transfected cells were collected and subjected to Western Blot expression detection.

Expression characterization

(1) Preparation of protein samples

a. 293T cells after transient transfection for 48h were washed twice with PBS;

b. add 150. mu.l of Laemmli Sample Buffer, scrape the cells with cell scraper and transfer to 1.5ml EP tube;

c. placing into a dry thermostat, and heating at 100 deg.C for 10min to lyse cells;

e. the lysed sample was placed in a 4 ℃ freezer for future use.

(2) SDS-PAGE electrophoresis

a. Preparation of 10% separation gel (pH 8.8):

b. slowly adding the prepared glue into the assembled plate until the gel height is 5.5cm, and reserving 2cm for preparing concentrated glue;

c. preparation of 5% concentrated gum (PH 6.8):

d. adding the prepared concentrated glue to the upper layer of the separation glue, and inserting a comb to prepare a sampling hole;

e. after the concentrated gel is solidified, pinching both sides of the comb vertically upwards and slightly pulling out the comb;

f. adding 5% mercaptoethanol into the sample before loading, mixing, adding the mixed protein sample into the upper layer concentrated gel, 15 μ l/hole, and adding pre-dyed marker;

g. carrying out electrophoresis at a constant voltage of 100V, and adjusting the voltage to 200V when the bromophenol blue is in a line;

h. when the bromophenol blue reaches the bottom of the gel, the electrophoresis can be stopped, and the membrane is transferred.

(3) Transfer blot

a. Preparing sufficient transfer buffer to fill the transfer chamber;

b. taking down the gel from the glass plate, and removing the upper layer of concentrated gel;

c. soaking the gel in transfer buffer solution for 1 min;

d. soaking the PVDF membrane in methanol for 30s to ensure that the membrane becomes a semitransparent state;

e. putting the PVDF membrane into a balance buffer solution to be soaked for 3-5 min;

f. paving filter paper, gel and PVDF film layer by layer as shown in figure 1 to avoid bubbles and wrinkles;

g. and (5) performing constant current of 200mA, and performing transfer printing for 2h in an ice-water bath.

(4) Immune response

a. Placing the PVDF membrane after transfer printing in 5% skimmed milk powder (prepared by TBST) and oscillating for 1h for sealing;

b. after the sealing is finished, washing the membrane for 3 times by TBST, 5min each time;

c.1:2000BSA diluted Ms mab MAGE-A3 antibody was incubated overnight at 4 deg.C;

d. after the primary antibody incubation is finished, washing the membrane for 3 times by TBST, 5min each time;

e.1 incubation of goat anti-mouse IgG labeled with horseradish enzyme diluted with 50005% skimmed milk powder for 2h at room temperature;

f. after the secondary antibody incubation was completed, the membrane was washed 3 times for 5min each with TBST.

(6) Detecting a target protein by ECL color development

a. Turning on the Tanon-5200 chemiluminescence imaging system, and starting to use after the temperature is reduced to 25 ℃;

b. mixing ECL developing solution A and solution B according to the proportion of A: B to 1:1 to obtain a proper amount of mixed solution;

c. taking out the PVDF membrane, slightly drying, placing on a clean glass plate, and dropwise adding the mixed solution at the position of the strip;

d. the shooting and picture overlapping process is carried out according to the instruction.

The Western blot result is shown in FIG. 5, the fusion antigen has a theoretical molecular weight of 92kDa, and the detected expression size is consistent with the expected size (Z-VAD is an apoptosis inhibitor and has the function of inhibiting apoptosis).

Example 2 immunogenicity Studies and analysis of antitumor Effect

Large amount of extracted and purified pSFVK1-NMM plasmid DNA for immunization

The endotoxin-free plasmids required for animal experiments are all operated according to the instruction of "endotoxin-free plasmid extraction kit" of Tiangen Biotechnology (Beijing) Co., Ltd.

Grouping of Experimental animals and description of injectables

Female C57BL/6 mice, 6-8 weeks old, were randomly divided into 7 groups of 10 mice each. The groups and injections were as follows:

immunization strategy

Experimental mice were immunized 3 times at 14 day intervals. The immunization is carried out by adopting a mode of intramuscular injection of quadriceps femoris and simultaneous electric pulse stimulation, multipoint electric pulse stimulation is carried out on an injection site by a living gene electrotransformation instrument immediately after the injection, and the conditions of the electric pulse stimulation are as follows: voltage 60V, pulse time 50ms, pulse number 1Hz 6 times. After 3 immunizations of experimental mice, 5 mice of each group were used for immunogenicity testing and the other 5 mice of each group were used for tumor challenge experiments.

ELISPOT method for detecting secretion of immune mouse spleen cell antigen specific IFN-gamma

Isolation of immunized mouse spleen lymphocyte suspension:

a. in 2 weeks after the last immunization, each group of immunized mice were killed by neck-breaking, soaked in 75% ethanol for 5min, and then placed in an ultra-clean bench sterilized by ultraviolet irradiation;

b. taking out the spleen of a mouse by operation under the aseptic condition, shearing the spleen into a 200-mesh cell sieve, putting the cell sieve into a serum-free plate with 1640 culture medium, and grinding the spleen uniformly by using a grinding rod;

c. gently washing out the lymphocytes in the cell sieve by using a serum-free 1640 culture medium;

d. adding 5mL of mouse lymphocyte separation liquid into a centrifuge tube, slowly dripping the spleen cell suspension obtained in the step c above the lymphocyte separation liquid along the tube wall (taking care not to mix the two), and centrifuging at the room temperature at 2500rpm for 30 min;

e. centrifuging, dividing the liquid into three layers, collecting the middle white membrane, adding 10mL serum-free 1640 culture medium, and cleaning lymphocytes for 2 times (1500rpm/min,10 min); resuspended in 10mL serum-free medium and counted.

The procedure was carried out according to the Mouse IFN-. gamma.coated ELISPOT kit, Dake Biotech Ltd, as follows:

the first day: inoculating cells, adding stimuli, culturing (strict attention to aseptic operation)

1. Activation of pre-coated plates: adding 200 μ L EZ-CultureTM serum-free culture medium or RPMI-1640 culture medium into each well, standing at room temperature for 5-10min, and deducting.

2. Adding a cell suspension: the adjusted concentration of cell suspension was added to each experimental well at 100. mu.L/well.

Positive control wells: the cell concentration can adopt 1 × 105 cells/well; negative control wells: the cell concentration can adopt 1 × 105 cells/well; background negative control: add the medium for resuspension of cells (EZ-CurtureTM none)

Serum medium or RPMI-1640 medium containing fetal bovine serum); experiment hole: the sample cell concentration is self-adjusted by the experimenter according to the experiment.

3. Adding a stimulus: 10 μ L/well, as follows: positive control wells: adding positive irritant working solution.

Negative control wells: adding EZ-CultureTM serum-free medium (or medium for re-suspending cells); experiment hole: the experimenter's own stimuli (formulated with EZ-CultureTM serum-free medium or RPMI 1640 at 10 Xfinal concentration) were added.

4. And (3) incubation: after all the samples and stimuli were added, the plate cover was closed. Culturing at 37 deg.C in 5% CO2 incubator for 16-20 hr. The next day: post-culture manipulation (sterile manipulation is no longer required)

1. Cell lysis: pour the cells and media from the wells. Ice-cold deionized water was added, and the cells were hypotonic lysed by placing in a refrigerator at 200. mu.L/well for 10min at 4 ℃.

2. Washing the plate: the well was decanted, washed 5-7 times with 1 × Washing buffer, 200 μ L/well. The residence time is 30-60s each time. And finally, drying the water-absorbing paper in a buckling way.

3. And (3) incubation of the detection antibody: diluted biotin-labeled antibody working solution was added to each assay well at 100. mu.L/well. Incubate at 37 ℃ for 1 hr.

4. Washing the plate: the well was decanted, washed 5 times with 1 × Washing buffer, 200 μ L/well. The residence time is 30-60s each time. And finally, drying the water-absorbing paper in a buckling way.

5. Incubation with enzyme-linked avidin: diluted enzyme-labeled avidin working solution was added to each experimental well at 100. mu.L/well. Incubate at 37 ℃ for 1 hr.

6. Washing the plate: the well was decanted, washed 5 times with 1 × Washing buffer, 200 μ L/well. The residence time is 30-60s each time. And finally, drying the water-absorbing paper in a buckling way.

7. Color development: the AEC color developing solution working solution prepared in situ is added into each experimental hole, and the volume is 100 mu L/well. Standing at room temperature in dark for 15-45min (at 20-25 deg.C, developing for 25min is suitable). If the room temperature is lower than 20 ℃, the color development is recommended to be carried out in an incubator at 37 ℃, and the examination is carried out once every 5-10 min.

8. And (3) stopping color development: the liquid in the wells was poured out, the plate base was uncovered, the front and back sides and base were washed 3-5 times with deionized/tap water, and the development was stopped. The plate is placed in a cool place at room temperature, and the base is closed after the plate is naturally dried.

Spot count on ELISPOT plates and record various parameters of spots for statistical analysis.

The lymphocyte of each group of immune mice which are separated aseptically is re-stimulated and activated by taking the protein antigen purified in the previous period as a specific stimulant, T lymphocyte which is responsive to the specific antigen is activated to start secreting IFN-gamma, the cytokines are captured by IFN-gamma monoclonal antibody which is pre-coated on an enzyme linked plate and become spots through enzyme linked color development, and lymphocyte which is not responsive to the specific antigen is not stimulated to release the cytokines, and the result is shown in figure 6. As can be seen from the results in FIG. 6, the experimental mice of group E pSFVK1-NY-ESO-1/MUC1/MAGE-A3-IRES-GM/B7 plasmid, group F pSFVK1-FLT 3L-NY-ESO-1/MUC1/MAGE-A3-IRES-GM/B7 plasmid, and group G pSFVK1-FLT 3L-NY-ESO-1/MUC1/MAGE-A3-CD 40L-IRES-GM/7 plasmid, i.e., pSFVK1-NMM, all detected T cell immune response. Wherein the number of spots in the G group was significantly different from the other groups and was 1.8 times and 1.3 times the number of spots induced by the E and F groups. The experimental result shows that the full-length plasmid pSFVK1-NMM fused with immune adjuvant molecules FLT3L and CD40L can induce a stronger cellular immune response of a mouse after immunization, thereby proving the promotion effect of the immune adjuvant molecules on the immunogenicity of plasmid DNA.

Establishment of tumor cell model for stably expressing NMM antigen

In order to complete the pharmacodynamic study of the recombinant plasmid, a tumor cell model of high-expression NMM target antigen is established. MUC1, MAGE-A3 and NY-ESO-1 fusion genes are synthesized by adopting a gene synthesis method, are directionally inserted into a eukaryotic expression vector pIRES-neo by utilizing a DNA recombination technology, are transfected with B16 cells by utilizing a cationic polymer, and are subjected to pressure screening by G418 medicaments to obtain a mouse melanoma (B16) cell strain capable of stably expressing the three antigens, so that a cell model is provided for evaluating a tumor inhibition action mechanism of recombinant plasmid DNA and is named as B16-NMM +. Meanwhile, C57BL/6 mice are inoculated by using the cell strain B16-NMM +, and the tumorigenic capacity of the B16 cells after stably transfecting exogenous genes is observed.

Tumor growth curves of mice of each experimental group are drawn by measuring the tumor size of the tumor-bearing mice. The results are shown in fig. 7 (time to tumor formation) and fig. 8 (tumor growth curve). A. B, C mice had no significant difference in the time of tumor formation of transplanted tumors, and the tumor-free incubation period of D, E, F, G mice was prolonged compared with that of the control group (FIG. 7); D. e, F, G group showed a delay in tumor growth compared to the remaining control groups, whereas mice in group G, i.e., pNMM plasmid DNA group had the longest period of tumor-free latency and showed a significant delay in tumor growth compared to group D, E, F (FIG. 8).

Tumor challenge experiment

On day 7 after the last immunization of each group of mice, the mice were challenged with the tumor cell line stably expressing NMM antigen obtained in 2.7.6.

The operation steps are as follows: c57BL/6 mice were vaccinated 3 consecutive times with 1 immunization every 14 days before transplantation tumor challenge, immunizations were performed by injecting quadriceps femoris muscle and simultaneously stimulating with electric pulses, and multi-point electrical stimulation was performed at the injection site with ECM830 electric pulse introduction instrument under the pulse conditions: voltage 60V, pulse time 50ms, pulse number 1Hz 6 times. Transplantation tumor challenge was performed 7 days after the last immunization, and the back was inoculated subcutaneously with 1 x 10⁵B16-NMM + cells. Each group of 5 mice was sacrificed by cervical dislocation 30-35 days after the transplantation tumor challenge, tumor tissue was surgically removed and various data were recorded.

Observation of tumor-inhibiting Activity of DNA vaccine

After the subcutaneous graft tumor challenge, the growth of the tumor in the mice was observed. When the tumor knot can be touched, recording the tumor formation time of each group of mice; then, measuring and recording the vertical long diameter and the vertical short diameter of the transplanted tumor by using a vernier caliper every two days, calculating the volume of the transplanted tumor according to a formula, and drawing a growth curve of the transplanted tumor in the mouse body; when the transplanted tumor grows to a certain number of days, the neck is cut off to kill 5 mice in each group, tumor tissues are stripped through operation, the tumor weight is weighed, and the tumor inhibition rate is calculated according to a formula. The formula is as follows:

tumor volume (mm3) 0.5 × vertical major axis x (vertical minor axis) 2;

tumor growth inhibition (%) (average tumor weight in blank group-average tumor weight in experimental group)/average tumor weight in blank group × 100%.

The results are shown in FIGS. 9 and 10: wherein the mean tumor weights of A, B, C groups were not significantly different (p > 0.05); the mean tumor weight of the D, E, F, G group was significantly reduced compared to the control group; the average tumor weight of the G group of mice is minimum, the tumor growth inhibition rate reaches 85.0 percent, and the fact that the group of plasmids, namely the pNMM immunized mice, has strong anti-tumor attack capability is shown, and the method has important significance for resisting tumor recurrence.

To verify that this pNMM is most immunogenic, several intermediate versions of plasmid DNA, truncated control plasmids containing part or all of the stimulatory molecule, were also constructed. After different plasmid DNAs are injected into experimental animals, it can be seen that the pNMM group can induce the strongest cellular immune response, and has significant difference compared with other main control groups, which can prove the importance of immune activation and stimulation molecules for enhancing cellular immune response. In line with the above, tumor-attacking experiments show that the pNMM plasmid DNA group has the strongest effect of inhibiting tumor growth, and the tumor growth inhibition rate of the group can reach 85%, so that the effect is obvious.

The result can confirm that the constructed recombinant plasmid pNMM has very strong capacity of inhibiting tumor growth, and the variety is currently undergoing pilot test and preclinical research and has the prospect of developing a new variety of effective anti-tumor relapse immunotherapy drugs. Meanwhile, in further research, the recombinant plasmid pNMM is administrated in an intratumoral injection mode, mainly aiming at body surface tumors, and the tumor inhibition effect can be greatly enhanced theoretically.

Claims

1. An anti-tumor plasmid DNA vaccine for expressing recombinant NMM fusion antigen, which is characterized in that the recombinant NMM fusion antigen takes MAGE-A3 as a main antigen frame, upstream fuses MUC1 antigen CTL epitope, upstream of the MUC1 antigen CTL epitope fuses NY-ESO-1 antigen CTL epitope, upstream of the NY-ESO-1 antigen CTL epitope fuses FLT3L, downstream of the MAGE-A3 fuses CD40L, downstream of the CD40L gene is connected with a gene coding GM/B7 through IRES sequence in the anti-tumor plasmid DNA vaccine, and the GM/B7 represents cytokines GM-CSF and B7.1;

the design fusion scheme of the recombinant NMM fusion antigen is as follows: connecting the NY-ESO-1 antigen CTL epitope with the 5 ' end of the MUC1 antigen CTL epitope through a connecting arm AAY, wherein the 3 ' end of the MUC1 antigen CTL epitope is connected to the 5 ' end of the MAGE-A3 through a connecting arm KK;

the amino acid sequence of the NY-ESO-1 antigen CTL epitope is as follows: SLLMWITQC;

the amino acid sequence of the MUC1 antigen CTL epitope is as follows: STAPPAHGVTSAPDTRPAPGSTAPP, respectively;

the amino acid sequence of MAGE-A3 is as follows:

MPLEQRSQHCKPEEGLEARGEALGLVGAQAPATEEQEAASSSSTLVEVTLGEVPAAESPDPPQSPQGASSLPTTMNYPLWSQSYEDSSNQEEEGPSTFPDLESEFQAALSRKVAELVHFLLLKYRAREPVTKAEMLGSVVGNWQYFFPVIFSKASSSLQLVFGIELMEVDPIGHLYIFATCLGLSYDGLLGDNQIMPKAGLLIIVLAIIAREGDCAPEEKIWEELSVLEVFEGREDSILGDPKKLLTQHFVQENYLEYRQVPGSDPACYEFLWGPRALVETSYVKVLHHMVKISGGPHISYPPLHEWVLREGEE。

2. a host bacterium comprising the anti-tumor plasmid DNA vaccine expressing recombinant NMM fusion antigen of claim 1.

3. The use of the anti-tumor plasmid DNA vaccine expressing recombinant NMM fusion antigen as claimed in claim 1 in the preparation of anti-tumor drugs.

4. Use according to claim 3, wherein the tumour is breast cancer, lymphoma, skin cancer, thyroid cancer or melanoma.