KR20100006939A - Method for reprogramming of cells using fusion protein delivery - Google Patents

Abstract

PURPOSE: A method for inducing reprogramming of subject cells is provided to enhance reprogramming using peptide and maintain genetic stability. CONSTITUTION: A method reprogramming subject cells comprises: a step of preparing a fusion protein containing CPP(cell-penetrating peptide) and reprogramming induction protein; a step of transferring the fusion protein to the subject cells; and a step of producing fusion protein from microorganism cells transformed with an expression vector containing a nucleic acid molecule encoding the CPP and reprogramming induction protein. The method further comprises a step of isolating and purifying the fusion protein. The fusion protein also contains secretory signal peptide. The CPP is TAT(Transactivator of transcription) peptide. The reprogramming induction protein is POU5F1(OCT4), SOX2, KLF4, C-Myc, NANOG, or LIN-28.

Description

 Reprogramming of Cells through Fusion Protein Delivery {METHOD FOR REPROGRAMMING OF CELLS USING FUSION PROTEIN DELIVERY}

The present invention relates to a method of inducing reprogramming of a subject cell, and more particularly to producing a fusion protein comprising a reprogramming inducing protein bound to a cell penetrating peptide (CPP) and the fusion protein to a subject cell. A method of reprogramming a subject cell comprising the step of delivering, the vector used in the method and the transformed cell for expressing the vector, and the reprogrammed undifferentiated stem cell prepared by the method.

Stem cells are cells that are capable of differentiating organisms that make up biological tissues into various cells, and are collectively referred to as undifferentiated cells before they are differentiated in each tissue of embryo, fetus and adult. . These stem cells are differentiated into specific cells by differentiation stimulation, and have the characteristic of producing and proliferating the same cells as their own by cell division, and also differentiating into other cells by different environment or different differentiation stimulation. Has differentiation plasticity that can be achieved. Stem cells are undifferentiated cells with the unique ability to generate cells of many different cell types, eg, skin, neurons, or other organs. Stem cells also have the ability to self-replicate for an indefinite period of time. Embryonic stem cells arise from the blastocyst stage, one of the earliest stages of embryonic development, and the most important characteristic of embryonic stem cells is totipotency. That is, embryonic stem cells can differentiate and self-regenerate into almost any type of cell in the body, including all three germ layers consisting of endoderm, mesoderm, and ectoderm.

The fact that stem cells have the potential to develop into certain types of cells and can proliferate indefinitely allows stem cells to develop organs and tissues for transplantation, cell therapy for degenerative diseases, gene therapy, and toxicity testing for new drugs. It can be usefully used for the same purpose. For example, the possibility of cell therapy through embryonic stem cell research has been demonstrated through research using functional progenitor cells derived from mouse embryonic stem cells and animal disease models. Stem cells are attracting attention as an important research target for the treatment of intractable disease due to the pluripotency of these stem cells.

As part of this research, in order to reprogram differentiated cells of mice and humans to induce undifferentiated stem cells, viruses using specific genes are combined to transfer the viruses into cells, and the genes are inserted into the genome of cells. Methods of expressing the protein have been suggested by various researchers. That is, the selection process of the induced pluripotent stem cells using the conventional viral vector proceeds as follows. The cells to be reprogrammed are inoculated with 1 x 10 ^ 5 cells in one well of 6 well-dis and cultured therein, and four viral genes (eg, OCT4, SOX2, KLF4, C-Myc) can be transferred. The mixture is treated for 24 hours. After incubation, the viral vector mixture is removed, fresh cell culture is added and incubated for 3-6 days. Cells cultured for 3 to 6 days are separated into single cells, transferred to a culture plate with basal cells (feeders), and cultured using human embryonic stem cell culture. At this time, the basal cells are inactivated through a method such as gamma irradiation to prevent the growth of mouse embryo fibroblasts. During the transfer of the cells to be reprogrammed to the basal cells, the cell populations resembling embryonic stem cells may be selected and then transferred to a new basal cell culture dish for culture. The selection period takes about 7 days to 21 days depending on the type of cell and the method, and the medium is exchanged every 1 to 2 days. (Takahashi et al. 2007. Induction of pluripotent stem cells from adult human fibroblast by defined factors.Cell. 131: 1-12; Park et al. 2008. Generation of human-induced pluripotent stem cells.Nature protocol 3: 1180-1186 ). As such, the overall process for selecting induced pluripotent stem cells can be broadly divided into a process of culturing cells to be reprogrammed, transforming them with a viral vector, and transferring them to basal cells.

The reprogrammed cells prepared by the above method were found to have almost the same cellular characteristics and differentiation capacity as embryonic stem cells, but since the gene was transferred through the viral vector, virus-derived genetic material was added to the genome of the cell. There is a problem that involves a large amount. In mouse experiments, these characteristics are causing the side effects of cancer-producing mice from induced pluripotent stem cells, which means that the application of these induced pluripotent stem cells in clinical practice can still be very dangerous. do.

To overcome the safety issues of these induced undifferentiated stem cells, the number of genes delivered can be reduced (Kim et al., 2008, Pluripotent stem cells induced from adult neural stem cells by reprogramming with two factors.Nature , doi: 10.1038 / nature07061) an attempt is made to reduce the risks through the combination with other compounds have been made (Shi et al., 2008, a combined chemical and genetic approach for the generation of induced pluripotent stem cells. Cell Stem Cell , 2: 525-528; Huangfu et al., 2008, Induction fo pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat . Biotech ., Doi: 10.1038 / nbt118). However, because it is also combined with the genetic method using the virus, it is not possible to completely eliminate the virus risk factors, and it is very unlikely to replace the complex reprogramming process with only a few compounds.

As a result of diligent efforts to overcome this problem, the researchers developed a method of directly delivering a specific protein to a target cell instead of inducing reprogramming of the target cell through gene transfer. The present invention has been completed by demonstrating that reprogramming of pluripotent stem cells with the stability of the genome can be produced by reprogramming without genetic modification. That is, the present invention was intended to obtain the effect of reprogramming by treating the fusion protein instead of directly processing the viral vector, the method of treating the fusion protein is a method of treating the purified protein directly to the cell culture medium and the fusion protein It is divided into methods of delivering secretory eukaryotic cells as basal cells. Two fusion protein delivery methods can be used independently or in combination.

It is an object of the present invention to produce a fusion protein comprising (a) a cell-penetrating peptide (CPP) and a reprogramming protein; And (b) delivering the fusion protein comprising the CPP and the reprogramming induction protein to the subject cell.

Another object of the present invention is to provide a vector comprising a nucleic acid molecule encoding CPP and reprogramming inducing protein.

Another object of the present invention is to provide a cell transformed with the vector.

Still another object of the present invention is to provide undifferentiated stem cells prepared by the method of reprogramming the cells.

Accordingly, in one aspect, the present invention provides a method for producing a fusion protein comprising: (a) producing a fusion protein comprising a cell-penetrating peptide (CPP) and a reprogramming inducing protein; And (b) delivering the fusion protein comprising the CPP and reprogramming inducing protein to the subject cell.

As used herein, the term "cell penetrating peptide (CPP)" refers to a peptide having characteristics of cell permeability, and peptides commonly used in the art having such characteristics (Dietz, GP and Bdeltahr, M. 2004, Delivery of bioactive molecules into the cell: the Trojan horse approach.Mol.Cell. Neurosci. , 27: 85-131) can be used without limitation, and thus various types of peptides that have been previously developed and reported can be used. Preferably, CPP is a TAT peptide derived from HIV (Tunnemann et al., 2006, Cargo-dependent mode of uptake and bioavailability of TAT-containing proteins and peptides in living cell.FASEB J. , 20: 1775-1784; Fawell et al. , 1994. Tat-mediated delivery of heterologous proteins into cells Proc Natl Acad, Sci USA, 91:..... 664-668) may be utilized. The TAT peptide is preferably, but not limited to, the peptide used in Vives et al. (Vives et al., J. Biol. Chem. , 272: 16010-16017, 1997). In a specific embodiment of the present invention, it was confirmed that the cell permeability was maintained even in the protein fused with TAT by expressing the protein form in which the TAT peptide and the enhanced green fluorescent protein (EGFP) were fused.

The term "reprogramming inducing protein" refers to a protein capable of inducing reprogramming of cells, and proteins commonly used in the art having such characteristics may be used without limitation. Examples of such proteins include POU5F1 (OCT4), SOX2, KLF4, C-Myc, NANOG, and LIN-28, which induce the reprogramming of cells when genes are introduced into cells through viruses. In addition, a variety of proteins that can change the characteristics of the cells can be used without limitation, in a preferred embodiment of the present invention prepared a vector in which the POU5F1 (OCT4), SOX2, KLF4, and C-Myc protein is bound to the TAT peptide, respectively .

As used herein, the term “fusion protein” refers to a protein in a form in which the CPP and reprogramming inducing protein are combined, and other components may be additionally included as necessary. Preferably, the fusion protein is a form in which CPP and a reprogramming inducing protein are combined, and may be directly connected between the two components or by other proteins, and in some cases, a vector may be inserted into a transformed protein. The microbial cell may further include various secretion signal peptides for secreting the fusion protein to the outside. More preferably, it may further include SV40 large T antigen and hTERT, which are proteins that can be combined with CPP to enhance the efficiency of the reprogramming induction protein.

As used herein, the term "reprogramming" of a subject cell means a process by which the finally differentiated cells can be restored to a state with the potential to differentiate into new cell types. The reprogramming mechanism of these cells means establishing a different set of epigenetic marks after the epigenetics in the nucleus (the DNA state associated with causing a genetic change in function without a change in nucleotide sequence) are deleted. While multicellular organisms differentiate and grow, different cells and tissues acquire different gene expression programs. Distinct gene expression patterns of these are believed to be substantially controlled by epigenetic modifications such as DNA methylation, histone modifications and other chromatin binding protein (Li, E. Chromatin modification and epigenetic programming in mammalian development. Nat. Rev. Genet ., 2002, 3: 662-273, Reik W. et al, epigenetic reprogramming in mammalian development Science, 2001, 293:.. 1089-1093). Thus, each cell type in a multicellular organism is generally fixed and unchanged once the cell differentiates or leaves the cell cycle, but the major epigenetic genetics of some cells during normal development or when certain diseases progress. Programming may also proceed. The present invention provides a method of obtaining a cell having the capacity of undifferentiated cells as a result of reprogramming a subject cell by treating a specific protein with a subject cell already differentiated.

The method for delivering a fusion protein through the present invention can be used without limitation the method for providing a protein to cells commonly used in the art, preferably can be carried out by the following methods.

In a preferred embodiment, the reprogramming method of the present invention comprises the steps of: (a) expressing a fusion protein using a microbial cell transformed with an expression vector comprising a nucleic acid molecule encoding CPP and a reprogramming inducing protein and said fusion protein Separating and purifying the protein; And (b) administering the isolated, purified fusion protein to a culture of the subject cell, wherein the reprogramming method of the subject cell can be used.

In this case, the reprogramming proteins, which are separated and purified to induce reprogramming of the target cells, combined with the cell penetrating peptides, may be prepared and administered to the cells in various combinations according to the type and condition of the cells to be reprogrammed. The synthesized protein may be administered to the culture solution in any formulation, and is preferably in the form of a solution, powder, or the like. More preferably, by adding the lyophilized fusion protein purified product in powder form to the culture medium of the target cells, the concentration of the reprogramming protein in the culture medium can be maintained high, and the culture solution is diluted to solve the problem. You can prevent it from happening.

In another preferred embodiment, the reprogramming method of the present invention comprises the steps of: (a) expressing a fusion protein using a basal cell transformed with an expression vector comprising a nucleic acid molecule encoding CPP and a reprogramming inducing protein; And (b) reprogramming the subject cells by co-culturing the basal cells expressing the fusion protein with the subject cells.

As such, the cells secreting the fusion protein outside the cell are co-cultured with the target cells, and the secreted protein is delivered to the differentiated cells, and the delivered protein induces reprogramming of the differentiated cells, thereby changing its characteristics. You get a cell. To this end, the secretion signal peptide is added to the fusion protein in a form that is coupled to the base cell can be performed.

As a preferred embodiment of the basal cells for coculture, subject cell reprogramming of the present invention may further comprise secreting said fusion protein for the production of CPP and reprogramming inducing proteins, which are commonly known in the art. Can be carried out in a Various secretion signal sequences for secreting fusion proteins to the outside are known in the art (Tan, NS et atl, 2002, Engineering a novel secretion signal for cross-host recombinant protein expression.Protein Eng., 15: 337-345 ).

However, when transformed basal cells secreting a fusion protein including CPP and reprogramming inducing protein used in the present invention as co-culture cells, mitomycin C (mitomycin C) is used to prevent the transformed basal cells themselves from being reprogrammed. It is preferable to facilitate selection of the target cells to be reprogrammed by inhibiting proliferation of the transformed cells through C) or gamma-ray (ray) irradiation.

As another preferred embodiment, the reprogramming method of the present invention may be used by combining the two methods simultaneously or sequentially.

Specifically, considering the protein dosage, the method of over-administering the isolated and purified fusion protein is used in the early stage of reprogramming, and the co-culture of transformed basal cells and target cells in the middle and late stages of reprogramming. Can be used in combination. In some cases, the two methods may be used simultaneously from early to late reprogramming.

As another aspect, the invention relates to a vector comprising a nucleic acid molecule encoding CPP and reprogramming inducing protein.

As used herein, the term "vector" refers to a vector capable of expressing a fusion protein comprising a target protein of CPP and a reprogramming inducing protein in a suitable host cell, and comprising an essential regulatory element operably linked to express a gene insert. Refers to the genetic construct. "Operably linked" means that the nucleic acid expression control sequence and the nucleic acid sequence encoding the protein of interest are functionally linked to perform a general function. Operative linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation employs enzymes and the like generally known in the art.

Vectors of the present invention include signal or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals, enhancers and can be prepared in various ways depending on the purpose. Can be. The promoter of the vector may be constitutive or inducible. In addition, the expression vector includes a selectable marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin. Vectors can self replicate or integrate into host DNA.

Vectors include plasmid vectors, cosmid vectors, viral vectors, and the like. Viral vectors are retroviruses such as Human immunodeficiency virus HIV (Murine leukemia virus) Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), Rous sarcoma virus (RSV) and Mouse mammary (MMTV). tumor viruses, and the like, but are not limited to vectors derived from Adenovirus, Adeno-associated virus, Herpes simplex virus, and the like. In a preferred embodiment of the present invention, a gene encoding a fusion protein including TAT and reprogramming inducing protein was introduced into pET-22b (+) vector using Nde I and Xho I restriction enzymes. E. coli was transformed for selection, and then cultured in LB plate medium containing ampicillin.

As another aspect, the present invention relates to a transformed cell comprising a vector expressing the CPP and reprogramming inducing protein. CPP and reprogramming proteins can be inserted and produced as described above as components of a vector.

In the present invention, the vector is introduced into a host cell to induce the production of a fusion cell, wherein the introduction of the vector may be performed using a conventional transformation method. As used herein, the term "transformation" refers to introducing DNA into a host cell so that the DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration. It means a phenomenon. In the present invention, transformation was performed to introduce the vector into the host organism in order to express the vector including the sequence of the fusion protein. As a transformation method for introducing a vector, any transformation method may be used, and may be easily performed according to a conventional method in the art.

Generally, transformation methods include CaCl ₂ Hanahan method which improved efficiency by using reducing material called DMSO (dimethyl sulfoxide) in precipitation method, CaCl ₂ method, electroporation, calcium phosphate precipitation method, plasma fusion method, stirring method using silicon carbide fiber, agro bacteria Mediated transformation, transformation with PEG, dextran sulfate, lipofectamine and dry / inhibition mediated transformation methods.

In a preferred embodiment, the present invention provides a microbial host cell comprising the vector. The microbial host cell may be used without limitation so long as it is a microbial host cell for transformation commonly used in the art, and examples thereof include, but are not limited to, gram-negative bacteria, gram-positive bacteria, actinomycetes, yeasts, and fungi. . In a preferred embodiment of the present invention, the produced vector was transformed into E. coli BL21 (DE3) (Stratagene, La Jolla, CA, USA) using a heat shock method.

In another preferred embodiment, the present invention provides a basal cell that secretes fusion proteins, including cell penetrating peptides and reprogramming proteins, out of the cell. These cells are secretory signal peptide for the secretion of the fusion protein to the outer cell (Tan, NS et al., 2002, Engineering a novel secretion signal for cross-host recombinant protein expression. Protein Eng . , 15: 337-345), transformed into a vector to produce a protein bound to the target cell, and co-cultured with the target cell to be reprogrammed to provide a fusion protein with continuous and stable cell infiltration ability to the target cell. Can provide.

By culturing the basal cells that secrete the fusion protein of the present invention as co-culture cells with the target cells, the secreted fusion proteins are delivered to the differentiated target cells, and the delivered fusion proteins penetrate and differentiate into the target cells. The reprogramming of the target cells can be induced to obtain cells with altered properties (reprogrammed undifferentiated stem cells). The transformed cells secreting the fusion protein may serve as coculture basal cells when the target cells are reprogrammed. The basal cells used can be used without limitation so long as the conventional cells used in the art, preferably fibroblasts.

As another aspect, the present invention relates to undifferentiated stem cells produced by the cell reprogramming method.

Stem cells are defined as cells that have a broad and undefined proliferative potential that differentiate into several cell lineages and that can reproliferate into tissue at the time of transplantation. Among them, embryonic stem (ES) cells have a non-limiting self-renewal and pluripotent differentiation potential, which can be obtained by reprogramming a subject cell using the reprogramming method according to the present invention. Can be.

Induction of reprogramming according to the present invention can increase the reprogramming efficiency by using a cell penetrating peptide, and since it is a reprogramming method by introducing a protein, it does not bring about modification to the genome of the target cell, thereby maintaining genetic stability. Cells can be reprogrammed. Undifferentiated stem cells obtained by such reprogramming can be used without problems in clinical applications due to the genetic stability of the cells.

Hereinafter, the Example of this invention is described concretely. However, the examples are only for describing the present invention in detail, and the present invention is not limited or limited by the following examples.

Example  One: TAT Peptides and Combined Green fluorescent protein  Gene for Production Cloning

To clone genes expressing the TAT-EGFP-TAT fusion protein into recombinant E. coli, the sequence of TAT48-60 of the reported TAT peptide (Vives et al., J. Biol . Chem., 272: 16010-16017, 1997) Reference was made. Using recombinant plasmid pEGFP (BD Biosciences Clontech, Palo Alto, Calif., USA) as template DNA, primers of SEQ ID NO: 1 and SEQ ID NO: 2 were used to express in the form of TAT-EGFP-TAT fusion protein. The cleavage site of restriction enzyme Nde I was inserted into the primer of SEQ ID NO: 1, and the cleavage site of restriction enzyme Xho I was inserted into the synthesized primer of SEQ ID NO: 2 for cloning.

SEQ ID NO 1:

5'-AGATATA CATATG CATCATCACCATCACCACGGTCGTAAAAAGCGCCGTCAACGTCGTCGTCCACCAC AGGTGAGCAAGG-3 '(Primer 1)

SEQ ID NO 2:

5'-TCT CTCGAG CTGTGGTGGACGACGACGTTGACGGCGCTTTTTACGACCCTTGTACAGCTCGTCCATGC-3 '(Primer 2)

The pEGFP was used as a template, and PCR was performed using the primers of SEQ ID NOs: 1 and 2 to finally obtain a product in a fused form of TAT-EGFP-TAT. The first denaturation was performed once at 94 ° C for 5 minutes under the PCR conditions, then the second denaturation was performed at 94 ° C for 1 minute, the annealing at 56 ° C for 1 minute, and the extension at 72 ° C for 1 minute. This was repeated 30 times. After the last extension for 5 minutes at 72 ℃.

DNA obtained by PCR was subjected to agarose gel electrophoresis to separate DNA fragments of about 800 bp size, which were digested with two restriction enzymes Nde I and Xho I, and then the DNA fragment was digested with the same restriction enzyme. The recombinant plasmid pET-tat-EGFP-tat was constructed by cloning into the cut plasmid pET-22b (+) (Novagen, San Diego, Calif., USA).

The prepared pET-tat-EGFP-tat was introduced into Escherichia coli BL21 (DE3) (Stratagene, La Jolla, Calif., USA) using a heat shock method to obtain ampicillin (50 mg / l) and bacterium. -Recombinant Escherichia coli BL21 (DE3) screened in LB plate medium (yeast extract, 5 g / l; tryptone, 10 g / l; NaCl, 10 g / l) to which bacto-agar (15 g / l) was added ) / pET-tat-EGFP-tat was prepared. Figure 2 shows the gene map of the plasmid pET-tat-EGFP-tat prepared above. In the present embodiment, the form of TAT peptide binding to the N-terminus and C-terminus of EGFP was used, and the same result was obtained even when the form of TAT peptide was bound to the N-terminus or C-terminus of the present invention. Acquisition is obvious to those of ordinary knowledge in this field.

Example  2: TAT Peptides and Combined Green fluorescent protein  Manufacture and production

Powerful and Inducible T7 E. coli BL21 (DE3) transformed with the recombinant plasmid pET-tat-EGFP-tat carrying a promoter was cultured to express the TAT-EGFP-TAT fusion protein. In the T7 promoter, gene expression is induced by IPTG (isopropyl-β-thiogalactoside), and for E. coli BL21 (DE3) transformed with pET-tat-EGFP-tat, a TAT-EGFP-TAT fusion protein was prepared as follows. . The transformed recombinant E. coli was inoculated into a 500 ml flask containing 200 ml of LB liquid medium and incubated at 37 ° C. pET-tat-EGFP-tat recombinant plasmid T7 Having a promoter, IPTG was added to induce gene expression. Gene expression induction was performed by adding 1 mM of IPTG when the optical density (OD) measured at 600 nm wavelength was 0.4 with a spectrophotometer.

Four hours after induction, the whole culture was centrifuged at 6000 rpm for 5 minutes at 4 ° C, then the supernatant was discarded and washed once with 100 ml TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0). After centrifugation at 6000 rpm for 5 minutes at 4 ° C, the solution was suspended in 100 ml of TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0), and then ultrasonically pulverized at 4 ° C (Branson Ultrasonics Co., Danbury, CT, Cells) were disrupted. The crushed solution was centrifuged at 6000 rpm for 30 minutes at 4 rpm to discard insoluble protein and filtered through a 0.2 μm filter to obtain an aqueous protein fraction containing TAT-EGFP-TAT fusion protein. The protein was analyzed by Bradford method (Bradford, M. et. al . , Anal . Biochem ., 72: 248, 1976).

Example  3: TAT Peptides and Combined Green fluorescent protein Intracellular  Penetration Check

A vector was produced to express EGFP in a form combined with a representative cell penetrating peptide, TAT peptide, to obtain a transformed microorganism, and by culturing the microorganism, an excess of TAT-EGFP binding protein was produced and separated and purified. Administration to fibroblast cultures.

In the case of the TAT-EGFP protein as shown in FIG. 3, the green fluorescent protein penetrated into the cells at 60 μg / ml and 20 μg / ml can be identified, whereas the green fluorescent protein not bound to TAT is not only 60 μg / ml. Increasing the concentration to 200 ㎍ / ㎖ did not see any penetration into the cell at all. That is, it was confirmed that the cell penetrating peptide can smoothly transfer the protein bound thereto.

Example  4: TAT Peptides and Combined Reprogramming  Production of Induced Pluripotent Stem Cells Using Protein Combination

In order to induce reprogramming of fibroblasts into pluripotent stem cells, an experiment as shown in FIG. 1 was performed.

POU5F1 (OCT4), SOX2, KLF4 and C-Myc proteins were each produced using microorganisms in the form of TAT peptides. After separation and purification, they were administered to human foreskin fibroblasts at a concentration of 20-60 ㎍ / ml for 7 days. At this time, the culture medium was used as a human foreskin fibroblast culture medium, and the separated and purified protein was prepared in lyophilized form and dissolved in human foreskin fibroblast culture medium. After 7 days, the cultured human foreskin fibroblasts were isolated into single cells, followed by culture plates containing transformed cells secreting POU5F1 (OCT4), SOX2, KLF4, and C-Myc proteins bound to TAT peptides. Moved on. At this time, the transformed cells secreting the protein were cells transformed with human foreskin fibroblasts, and were used as basal cells after inactivation by irradiating gamma rays to prevent proliferation. The cells separated into single cells were sufficiently diluted and transferred to human embryonic stem cell culture, and from this time, human embryonic stem cell culture was used, and cultured for about 2 weeks while replacing the culture medium every 1-2 days. During the cultivation, the cells were continuously observed to select a population of cells growing like human embryonic stem cells, and the inactivated mouse embryonic fibroblasts were transferred to a culture dish in which basal cells were cultured. Cultured reprogrammed cells were analyzed by the method of characterizing human embryonic stem cells.

The above embodiment is merely a preferred embodiment, thereby revealing that the scope of the present invention is not limited or limited. Thus, the substantial scope of the present invention is defined by the claims herein and their equivalents.

1 is a schematic diagram of the cell reprogramming process through the protein delivery of the present invention, by using a microorganism to produce a protein bound to TAT, a kind of CPP, isolated, purified and administered to the cell to induce cell reprogramming And coculture with cells secreting TAT-binding protein to provide a long-term continuous supply of TAT-binding protein to induce reprogramming of differentiated cells.

2 shows the structure of a plasmid vector comprising TAT-EGFP-TAT.

Figure 3 is a result of binding to TAT, a kind of CPP, produced by binding to EGFP (green fluorescent protein) and added to the fibroblast (CRL-2097) culture solution and observed with a fluorescence microscope. TAT-bound EGFP did not penetrate into the cells at 60 μg / ml and 200 μg / ml, but TAT-bound EGFP penetrated into the cell at both 60 μg / ml and 20 μg / ml. It was confirmed that the effect persisted afterwards.

Claims (20)

(a) producing a fusion protein comprising CPP (Cell-penetrating peptide) and reprogramming inducing protein; And (b) delivering the fusion protein comprising the CPP and reprogramming induction protein to the subject cell. The method of claim 1, wherein step (a) comprises: producing from a microbial cell transformed with an expression vector comprising a nucleic acid molecule encoding CPP and a reprogramming protein; And separating and purifying the fusion protein. The method of claim 2, wherein step (b) comprises administering the isolated, purified fusion protein to a culture of the subject cell. The method of claim 1, wherein step (a) further comprises secreting a fusion protein from the basal cell transformed with an expression vector comprising a nucleic acid molecule encoding CPP and a reprogramming inducing protein. The method of claim 4, further comprising a secretion signal peptide in the fusion protein. 6. The method of claim 5, wherein step (b) is co-cultured with basal cells secreting CPP and reprogramming inducing protein. The method of claim 1, wherein step (b) uses the method of claim 2 and 4 simultaneously or sequentially in combination. The method of claim 1, wherein the CPP is a Transactivator of transcription (TAT) peptide. The method of claim 1, wherein the reprogramming inducing protein is one or more proteins selected from the group consisting of POU5F1 (OCT4), SOX2, KLF4, C-Myc, NANOG, and LIN-28. The method of claim 1, wherein the fusion protein further comprises SV40 large T antigen and hTERT. A vector comprising a nucleic acid molecule encoding a fusion protein comprising CPP and reprogramming inducing protein. The vector of claim 11, wherein the CPP is a TAT peptide. The vector of claim 11, wherein the nucleic acid molecule encoding the reprogramming inducing protein is one or more genes selected from the group consisting of POU5F1 (OCT4), SOX2, KLF4, C-Myc, NANOG, and LIN-28. The vector of claim 11, wherein the vector further comprises a nucleic acid encoding SV40 large T antigen and hTERT. The gene vector of claim 11, wherein said vector is disclosed in FIG. 2. A cell transformed with a vector expressing a fusion protein comprising the CPP and reprogramming inducing protein of any one of claims 11 to 15. The microbial host cell of claim 16, wherein the cell is transformed into any one host selected from the group consisting of Gram-negative bacteria, Gram-positive bacteria, Actinomycetes, yeast and fungi. The basal cell of claim 16, wherein the fusion protein further comprises a secretion signal peptide. The transformed cell of claim 16, wherein said cell secretes a fusion protein comprising CPP and a reprogramming inducing protein. Reprogrammed undifferentiated stem cells produced by the method of claim 1.

Images