CN110923339A - Streptococcus agalactiae detection method and detection kit thereof - Google Patents

Streptococcus agalactiae detection method and detection kit thereof Download PDF

Info

Publication number
CN110923339A
CN110923339A CN201911157293.3A CN201911157293A CN110923339A CN 110923339 A CN110923339 A CN 110923339A CN 201911157293 A CN201911157293 A CN 201911157293A CN 110923339 A CN110923339 A CN 110923339A
Authority
CN
China
Prior art keywords
probe
streptococcus agalactiae
solution
seq
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201911157293.3A
Other languages
Chinese (zh)
Inventor
不公告发明人
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Zhongke Antibody Biotechnology Co ltd
Original Assignee
Guangzhou Zhongke Antibody Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Zhongke Antibody Biotechnology Co ltd filed Critical Guangzhou Zhongke Antibody Biotechnology Co ltd
Priority to CN201911157293.3A priority Critical patent/CN110923339A/en
Publication of CN110923339A publication Critical patent/CN110923339A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Abstract

The invention discloses a method for detecting streptococcus agalactiae, which comprises the steps of designing a primer pair sequence as SEQ ID No.1 and SEQ ID No.2, a first probe marked by biotin and a second probe sequence of amino-modified connecting magnetic beads, and detecting the streptococcus agalactiae efficiently and with high specificity by carrying out PCR amplification, exonuclease digestion, linkage with the first probe, hybridization with the second probe and luminescence detection on DNA in a sample, wherein the primer pair sequence and the first probe are used for carrying out biotin labeling, and the second probe sequence is used for carrying out luminescence detection.

Description

Streptococcus agalactiae detection method and detection kit thereof
Technical Field
The invention relates to the technical field of in-vitro detection, in particular to a streptococcus agalactiae detection method and a detection kit thereof.
Background
Streptococcus agalactiae, also known as Group B Streptococcus (GBS), is a serious neonatal-threatening bacterium that is predominantly present in the lower 1/3 of a pregnant woman's vagina, at the vaginal entrance and around the anus, and relatively rarely in the upper 1/3 of the vagina and cervical region. When the vaginal secretion is taken as the pathogenic microorganism for culture at ordinary times, the secretion of the internal opening of the cervix is generally taken as a sample, but when the streptococcus agalactiae is cultured, the secretion at the position 1/3 below the vagina is taken as the sample for detection, otherwise, the detection is easy to miss. For pregnant women, the bacteria can cause prenatal and postpartum genital tract infections, which are mainly manifested by acute chorioamnionitis, postpartum endometritis, pneumonia, meningitis, liver abscess, septicemia and the like.
The current commonly used method for detecting the streptococcus agalactiae is a CAMP method, wherein β -hemolytic staphylococcus aureus is used for cross-line inoculation firstly on a blood agar plate, then a bacterium to be detected in a culture solution taken out of a detected part is used for vertical inoculation with the previous streaking, the distance between the bacterium to be detected and the previous streaking is 1cm, incubation is carried out for 18-24h at 35 ℃, and the result is observed.
The clinical detection of the streptococcus agalactiae by the immunochromatography method has the advantages of short detection time, short detection result of only 10 minutes, low specificity, high cost and the need of special professional equipment, and the detection result is easily interfered by different sample types.
The fluorescence quantitative PCR method for detecting the streptococcus agalactiae is already used clinically, but the fluorescence quantitative PCR method has higher requirements on samples and more expensive machines, can be developed only by professional PCR laboratories, has higher requirements on the skills of operators, and is not beneficial to large-scale popularization. Therefore, the clinical detection of streptococcus agalactiae has urgent need for a kit which has high specificity and strong sensitivity, is relatively simple to operate and has low cost.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide the streptococcus agalactiae detection method which has high specificity, high precision and sensitive result in detecting the streptococcus agalactiae.
The invention also aims to provide a streptococcus agalactiae detection test kit.
One of the purposes of the invention is realized by adopting the following technical scheme:
a method for detecting Streptococcus agalactiae, which is characterized by comprising the following steps:
1) selecting a streptococcus agalactiae specific DNA sequence segment of 140-160bp, designing a primer sequence and a probe sequence:
designing an upstream primer, a downstream primer, a first probe and a second probe;
the sequence of the upstream primer is shown as SEQ ID No. 1; the sequence of the downstream primer is shown as SEQ ID No. 2:
the first probe is a biotin labeled probe, and the second probe is an amino modified probe and is connected with magnetic beads;
2) amplifying DNA by using an upstream primer and a downstream primer through PCR and carrying out restriction enzyme digestion by using exonuclease to obtain a restriction enzyme digestion product:
3) adding the acridinium ester solution and the reaction solution of the first probe into the enzyme digestion product obtained in the step 2), and hybridizing to obtain a first hybridization product;
4) adding a second probe into the primary hybridization product obtained in the step 3), cooling on ice after reaction, and washing away redundant acridinium ester solution and the reaction solution of the first probe on a magnetic frame by using a cleaning solution; obtaining a secondary hybridization product;
5) adding an excitation liquid into the secondary hybridization product, and detecting an optical signal value: the exciting liquid is NaOH solution containing hydrogen peroxide.
Compared with the conventional primer, the primer of the application has the specific sequence fragment length of about 140-160bp, and the specificity can reach 99.9 percent, so that the sensitivity of the clinical detection result brought by the reaction system is greatly improved.
Further, in the step 1), the 5' end of the downstream primer is connected with a Phos phosphate group, so that the PCR amplification product is conveniently cut into a single-stranded sequence by enzyme.
Further, in the step 1), the sequence of the probe I is shown as SEQ ID No. 3. The first probe can react with the luminous marker acridinium ester to obtain a reaction solution of the acridinium ester and the first probe.
Further, in the step 1), biotin is connected to the 3' end of the probe I.
Further, in the step 1), the sequence of the probe II is shown as SEQ ID No. 4.
Further, in step 1), the 5' end of the second probe is modified by an amino group.
Further, in the step 2), the exonuclease is Lambda exonuclease.
Further, in the step 3), the reaction solution of the acridinium ester solution and the probe I is prepared by the following steps:
taking a probe, dissolving the probe in NaHCO3Performing constant volume to obtain a first probe solution;
diluting acridinium ester with anhydrous DMSO to a concentration of 0.5 + -0.1 μ M/mL, acridinium ester DMSO solution;
the probe solution No. one and the acridinium ester DMSO solution were mixed according to the ratio of 1: 7-9, reacting at room temperature for 4-6 hours, and purifying by an ethanol method to obtain a reaction solution of the acridinium ester solution and the first probe.
Further, step 5) adding an excitation liquid into the secondary hybridization product, and detecting the optical signal value.
Further, the exciting liquid was a 0.2M NaOH solution containing 0.06 wt% of hydrogen peroxide.
The second purpose of the invention is realized by adopting the following technical scheme:
a streptococcus agalactiae assay comprising the following components: an upstream primer shown as SEQ ID No. 1; a downstream primer shown as SEQ ID No. 2; a probe I shown as SEQ ID No.3, wherein the probe I is connected with a biotin label; the second probe is an amino-modified probe and is connected with magnetic beads as shown in SEQ ID No. 4.
Or further comprises an acridine ester DMSO solution, a cleaning solution and an excitation solution, wherein the concentration of the acridine ester in the acridine ester DMSO solution is 0.5 +/-0.1 mu M/mL; the cleaning solution consists of 100 mu L of 1Mtris solution, 100 mu L of 5% Tween-20 and ultrapure water which is complemented by 10 mL; the exciting liquid is 0.06 wt% of hydrogen peroxide in 0.2M NaOH solution.
The principle of the invention is as follows:
according to the streptococcus agalactiae detection method, the specific primers can effectively amplify the streptococcus agalactiae DNA sequence to obtain a double-stranded PCR product, and the exonuclease is used for enzyme digestion to obtain an enzyme digestion product. Hybridizing the enzyme digestion product with the reaction solution of the acridinium ester first probe to obtain a product, hybridizing the product with the second probe to obtain a secondary hybridization product, adsorbing the secondary hybridization product on a magnetic frame by magnetic force, washing off the redundant reaction solution of the acridinium ester first probe, eliminating the interference of redundant acridinium ester on an optical signal so as to quantitatively detect the content of the primary hybridization product, and detecting the optical signal value of the secondary hybridization product by a light detector to obtain the relation between the optical signal value and the target nucleic acid content in a clinical sample.
Compared with the prior art, the invention has the beneficial effects that:
the streptococcus agalactiae detection method can effectively identify streptococcus agalactiae in a specific amplification mode, has high specificity during detection, and effectively distinguishes streptococcus agalactiae from other mixed bacteria;
according to the streptococcus agalactiae detection method provided by the invention, a light signal value and the content of DNA (deoxyribonucleic acid) of a clinical sample can be effectively in a better linear relation in a light signal detection mode, and the method can be used for quantitatively detecting streptococcus agalactiae;
according to the streptococcus agalactiae detection method, the magnetic beads can realize automatic detection in a magnetic adsorption mode, so that the detection efficiency is improved, and the labor cost is reduced.
The kit can realize the rapid detection of the streptococcus agalactiae, has the characteristics of high sensitivity and high specificity, is low in cost and simple to operate, can be widely developed in basic medical institutions, and has a great market prospect.
Drawings
FIG. 1 shows the identification of exonuclease cleavage products;
wherein, M is Marker, 1 is the product after enzyme digestion, and 2 is the PCR amplification product;
FIG. 2 is a graph showing the operation of the light signal value with respect to the DNA content of a sample.
Detailed Description
The present invention is further described below with reference to specific embodiments, and it should be noted that, without conflict, any combination between the embodiments or technical features described below may form a new embodiment.
The invention provides a streptococcus agalactiae detection method, which comprises the following steps:
1) selecting a streptococcus agalactiae specific DNA sequence segment of 140-160bp, designing a primer sequence and a probe sequence:
designing an upstream primer, a downstream primer, a first probe and a second probe;
the sequence of the upstream primer is shown as SEQ ID No. 1; the sequence of the downstream primer is shown as SEQ ID No. 2:
namely, the sequence of the upstream primer is shown as follows: 5'-CGGTTAATgAGGCTATTACTAGTG-3', respectively;
the sequence of the downstream primer is shown below: 5 '-Phos-ATCTGTTAAGGCTTCTACACGAC-3';
the 5' end of the downstream primer is preferably ligated with a Phos group to facilitate cleavage of the PCR double stranded product into single strands with Lambda exonuclease.
The first probe is a biotin labeled probe, and the second probe is an amino modified probe and is connected with magnetic beads;
the sequence of probe number one is shown below: 5 '-aatttttcaa cactagtaat agcctcatta accgtttttttttt-biotin-3';
the sequence of probe two is shown below: 5' -NH2-cccccccccc cccatctgtt aaggcttctacacgactacc aat-3’；
2) Amplifying DNA using the forward and reverse primers and cleaving with exonuclease:
3) adding the acridinium ester solution and the reaction solution of the first probe into the enzyme digestion product obtained in the step 2), and hybridizing to obtain a first hybridization product;
4) adding a second probe into the primary hybridization product obtained in the step 3), cooling on ice after reaction, and washing off redundant acridinium ester solution and reaction liquid of the first probe on a magnetic frame by using a cleaning solution to obtain a secondary hybridization product;
5) adding an excitation liquid into the secondary hybridization product, and detecting an optical signal value: the exciting liquid is NaOH solution containing hydrogen peroxide.
The following are specific examples of the present invention, and raw materials, equipments and the like used in the following examples can be obtained by purchasing them unless otherwise specified.
In the following embodiments, the concentration of acridinium ester in the acridinium ester DMSO solution is 0.5 + -0.1 μ M/mL; the cleaning solution consists of 100 mu L of 1Mtris solution, 100 mu L of 5% Tween-20 and 10mL of ultrapure water; the exciting liquid is a 0.2M NaOH solution containing 0.06 wt% hydrogen peroxide.
Example 1:
a method for detecting streptococcus agalactiae comprises the following steps:
1) extracting DNA in a sample to be detected by adopting a column passing method;
2) performing PCR amplification by using the upstream primer and the downstream primer and using the DNA obtained in the step 1) as a template, wherein the PCR amplification reaction system is a 10-mu L reaction system and comprises: 1.0. mu.L of 10 XBuffer, 0.2. mu.L of dNTPs, 0.25. mu.L of 2U/. mu.L of Taq enzyme, 1.0. mu.L of 1.25. mu. mol/L of upstream primer, 1.0. mu.L of 1.25. mu. mol/L of downstream primer, DNA template extracted in step 1) and ddH complementing to 10. mu.L2O；
PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, and extension at 72 ℃ for 60s, and performing 30 cycles and purification to obtain PCR amplification products.
3) The amplified product of the step 2) is subjected to enzyme digestion by Lambda exonuclease, and the enzyme digestion reaction system is a 50 mu L reaction system and comprises the following steps: 5. mu.L of 10 XBuffer, 1. mu.L of Lambda exonuclease, PCR amplification product of step 2), ddH made up to 50. mu.L2O; the enzyme digestion reaction procedure is that enzyme digestion is carried out for 30min at 37 ℃, and the reaction is terminated after 10min at 75 ℃ to obtain an enzyme digestion product; carrying out 15% agarose electrophoresis on the PCR amplification product and the enzyme digestion product to judge whether the enzyme digestion is successful or not, wherein the result is shown in figure 1, and the electrophoresis result shows that the enzyme digestion is successful;
4) adding the acridinium ester solution and the reaction solution of the first probe into the enzyme digestion product obtained in the step 3), and hybridizing to obtain a primary hybridization product;
the method specifically comprises the following steps:
a) taking a probe, dissolving the probe in NaHCO3Performing constant volume to obtain a first probe solution;
b) diluting the acridine ester with anhydrous DMSO until the concentration of the acridine ester is 0.5 +/-0.1 mu M/mL to obtain an acridine ester DMSO solution;
c) the probe solution No. one and the acridinium ester DMSO solution were mixed according to the ratio of 1: 7-9, reacting at room temperature for 4-6 hours, and purifying by an ethanol method to obtain a reaction solution of an acridinium ester solution and a first probe;
d) taking the enzyme digestion product, adding 5 times of reaction liquid of acridinium ester solution and a first probe of the enzyme digestion product in parts by mass, and dissolving the mixture in 0.1M NaHCO3Performing constant volume to 90 mu L, reacting at 55 ℃ for 30min, and cooling on ice for 5min to obtain a primary hybridization product;
5) adding 2-4 times of the second probe solution connected with the magnetic beads and used for enzyme digestion products into the primary hybridization products obtained in the step 4), simultaneously adding 180 mu L of connection buffer solution, reacting for 10min at 55 ℃, cooling for 5min on ice, placing on a magnetic frame, washing away the redundant acridinium ester solution and the reaction solution of the first probe by using a cleaning solution, and obtaining secondary hybridization products;
6) adding an excitation liquid into the secondary hybridization product obtained in the step 5), reading a light signal value lasting for 10s immediately after the addition of the excitation liquid on an optical machine, and fitting the light signal value and the DNA amount in the sample obtained in the step 1) to a standard curve, wherein as shown in FIG. 2, the light signal value and the DNA content (ng) in the sample have a better linear relation and satisfy the linear equation y of 32284x +259869, wherein R is R2＝0.9895。
Example 2:
a streptococcus agalactiae detection test kit comprises an upstream primer, a downstream primer, a first probe, a second probe, Lambda exonuclease, acridinium ester DMSO solution, a cleaning solution and an excitation solution;
an upstream primer shown as SEQ ID No. 1; a downstream primer shown as SEQ ID No. 2; probe No. one as shown in SEQ ID No. 3; the first probe is connected with a biotin label; a second probe shown as SEQ ID No.4, wherein the second probe is an amino modified probe and is connected with magnetic beads;
wherein the concentration of the acridinium ester in the acridinium ester DMSO solution is 0.5 +/-0.1 mu M/mL; the cleaning solution consists of 100 mu L of 1Mtris solution, 100 mu L of 5% Tween-20 and ultrapure water which is complemented by 10 mL; the exciting liquid is 0.06 wt% of hydrogen peroxide in 0.2M NaOH solution.
The above embodiments are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited thereby, and any insubstantial changes and substitutions made by those skilled in the art based on the present invention are within the protection scope of the present invention.
Sequence listing
<110> Guangzhou Zhongke antibody Biotechnology Ltd
<120> detection method and detection kit for streptococcus agalactiae
<130>1
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>24
<212>DNA
<213> unknown (Artificial sequence)
<400>1
cggttaatga ggctattact agtg 24
<210>2
<211>23
<212>DNA
<213> unknown (Artificial sequence)
<400>2
atctgttaag gcttctacac gac 23
<210>3
<211>44
<212>DNA
<213> unknown (Artificial sequence)
<400>3
aatttttcaa cactagtaat agcctcatta accgtttttt tttt 44
<210>4
<211>43
<212>DNA
<213> unknown (Artificial sequence)
<400>4
cccccccccc cccatctgtt aaggcttcta cacgactacc aat 43

Claims (10)

1. A method for detecting Streptococcus agalactiae, which is characterized by comprising the following steps:
1) selecting a streptococcus agalactiae specific DNA sequence segment of 140-160bp, designing a primer sequence and a probe sequence:
designing an upstream primer, a downstream primer, a first probe and a second probe;
the sequence of the upstream primer is shown as SEQ ID No. 1; the sequence of the downstream primer is shown as SEQ ID No. 2:
the first probe is a biotin labeled probe, and the second probe is an amino modified probe and is connected with magnetic beads;
2) amplifying DNA by using an upstream primer and a downstream primer through PCR and carrying out restriction enzyme digestion by using exonuclease to obtain a restriction enzyme digestion product:
3) adding the acridinium ester solution and the reaction solution of the first probe into the enzyme digestion product obtained in the step 2), and hybridizing to obtain a first hybridization product;
4) adding a second probe into the primary hybridization product obtained in the step 3), cooling on ice after reaction, and washing away redundant acridinium ester solution and the reaction solution of the first probe on a magnetic frame by using a cleaning solution; obtaining a secondary hybridization product;
5) adding an excitation liquid into the secondary hybridization product, and detecting an optical signal value: the exciting liquid is NaOH solution containing hydrogen peroxide.
2. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 1), a Phos phosphate group is linked to the 5' end of the downstream primer.
3. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 1), the probe sequence No. one is as shown in SEQ ID No. 3.
4. The method for detecting Streptococcus agalactiae according to claim 3, wherein in step 1), biotin is linked to the 3' end of the probe I.
5. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 1), the sequence of the probe II is represented by SEQ ID No. 4.
6. The method for detecting Streptococcus agalactiae according to claim 5, wherein in step 1), the 5' end of the second probe is modified with an amino group.
7. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 2), the exonuclease is Lambda exonuclease.
8. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 3), the reaction solution of the acridinium ester solution and the probe I is prepared by:
taking a probe, dissolving the probe in NaHCO3Performing constant volume to obtain a first probe solution;
diluting the acridine ester with anhydrous DMSO until the concentration of the acridine ester is 0.5 +/-0.1 mu M/mL to obtain an acridine ester DMSO solution;
the probe solution No. one and the acridinium ester DMSO solution were mixed according to the ratio of 1: 7-9, reacting at room temperature for 4-6 hours, and purifying by an ethanol method to obtain a reaction solution of the acridinium ester solution and the first probe.
9. The method for detecting Streptococcus agalactiae according to claim 1, wherein in step 5), the exciting liquid is a 0.2M NaOH solution containing 0.06 wt% of hydrogen peroxide.
10. A streptococcus agalactiae assay comprising the following components: an upstream primer shown as SEQ ID No. 1; a downstream primer shown as SEQ ID No. 2; a probe I shown as SEQ ID No.3, wherein the probe I is connected with a biotin label; the second probe is shown as SEQ ID No.4, is an amino modified probe and is connected with magnetic beads.
CN201911157293.3A 2019-11-22 2019-11-22 Streptococcus agalactiae detection method and detection kit thereof Pending CN110923339A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911157293.3A CN110923339A (en) 2019-11-22 2019-11-22 Streptococcus agalactiae detection method and detection kit thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911157293.3A CN110923339A (en) 2019-11-22 2019-11-22 Streptococcus agalactiae detection method and detection kit thereof

Publications (1)

Publication Number Publication Date
CN110923339A true CN110923339A (en) 2020-03-27

Family

ID=69850778

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911157293.3A Pending CN110923339A (en) 2019-11-22 2019-11-22 Streptococcus agalactiae detection method and detection kit thereof

Country Status (1)

Country Link
CN (1) CN110923339A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111647685A (en) * 2020-05-19 2020-09-11 广州中科抗体生物技术有限公司 Primer group, probe group and kit for detecting COVID-19 virus and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0425217A2 (en) * 1989-10-23 1991-05-02 Ciba Corning Diagnostics Corp. A hybridization assay for campylobacter rRNA
US20030207295A1 (en) * 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
JP2007232675A (en) * 2006-03-03 2007-09-13 Matsushita Electric Ind Co Ltd Gene detection method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0425217A2 (en) * 1989-10-23 1991-05-02 Ciba Corning Diagnostics Corp. A hybridization assay for campylobacter rRNA
US20030207295A1 (en) * 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
JP2007232675A (en) * 2006-03-03 2007-09-13 Matsushita Electric Ind Co Ltd Gene detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
TING HUANG等: "Spatiotemporal distribution of Streptococcus agalactiae attenuated vaccine strain YM001 in the intestinal tract of tilapia and its effect on mucosal associated immune cells", 《FISH & SHELLFISH IMMUNOLOGY》, 30 April 2019 (2019-04-30), pages 2 *
薛力刚等: "大肠杆菌O157：H7核酸探针检测方法的建立", 《生物技术》, vol. 19, no. 6, 30 June 2009 (2009-06-30) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111647685A (en) * 2020-05-19 2020-09-11 广州中科抗体生物技术有限公司 Primer group, probe group and kit for detecting COVID-19 virus and application thereof

Similar Documents

Publication Publication Date Title
Cremonesi et al. Improved method for rapid DNA extraction of mastitis pathogens directly from milk
Cai et al. Development of a real-time PCR for detection of Mycoplasma bovis in bovine milk and lung samples
US10253376B2 (en) DNA-based detection and identification of eight mastitis pathogens
CN105256048B (en) Multiple PCR detection primer group and probe group for oral pathogenic bacteria and application thereof
JP5203387B2 (en) Method for detecting methicillin-resistant Staphylococcus aureus and its detection primer, probe and kit
KR100434244B1 (en) Amplification and detection method of mycobacterium avium complex species
CN109913565B (en) Kit, primer pair, probe and method for detecting vibrio parahaemolyticus
US20150093749A1 (en) Real-time pcr detection of streptococcus pyogenes
CN115029459A (en) Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application
CN104263838A (en) LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes
US20220098645A1 (en) Fast and portable microfluidic detection system as an alternative to salmonella&#39;s classical culture method
Zeng et al. Uracil-DNA-glycosylase-assisted loop-mediated isothermal amplification for detection of bacteria from urine samples with reduced contamination
CN110923339A (en) Streptococcus agalactiae detection method and detection kit thereof
CN110734988A (en) methicillin-resistant staphylococcus aureus (MRSA) nucleic acid isothermal amplification method
KR101756736B1 (en) Method for rapidly detecting actinobacillus pleuropneumoniae from clinical samples through multiplex real-time pcr assay and the apparatus thereof
CN108192988B (en) Staphylococcus aureus strand exchange amplification detection method
RU2435853C1 (en) TEST SYSTEM FOR QUANTITATIVE DETERINATION OF Streptococcus agalactiae IN BIOLOGICAL MATERIAL
CN116479150A (en) Single tube one-step method for rapidly detecting methicillin-resistant staphylococcus aureus by RPA-Cas12a/Cas13a
US20090136930A1 (en) Method for the identification of microorganisms by means of in situ hybridization and flow cytometry
JPH0654700A (en) Highly sensitive detection of resistant bacterium
TW202204635A (en) Primer set and probe for detecting staphylococcus argenteus
CN103725761A (en) Group B streptococcus (GBS) nucleic acid detection kit and detection method
EP3438280B1 (en) Haemoplasma detection method
CN101892313B (en) Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology
US6558909B2 (en) Haemobartonella PCR methods and materials

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20200327