CN110923240A

CN110923240A - Function of insect adult disc growth factor and application of dsRNA (double-stranded ribonucleic acid) thereof

Info

Publication number: CN110923240A
Application number: CN201911332131.9A
Authority: CN
Inventors: 李大琪; 张建琴; 陆俊姣; 任美凤; 董晋明; 李涛
Original assignee: INSTITUTE OF PLANT PROTECTION SHANXI ACADEMY OF AGRICULTURE SCIENCE
Current assignee: INSTITUTE OF PLANT PROTECTION SHANXI ACADEMY OF AGRICULTURE SCIENCE
Priority date: 2019-12-21
Filing date: 2019-12-21
Publication date: 2020-03-27
Anticipated expiration: 2039-12-21
Also published as: CN110923240B

Abstract

The invention provides a function of an insect adult disc growth factor (IDGF) and application of dsRNA thereof, which can assist insects to resist germ invasion, and when the dsRNA is silenced, the resistance of the insects is reduced to cause death. Cloning and sequencing the adult disc growth factor gene of the black cutworm to obtain a sequence of SEQ ID NO: 1; the selection sequence is SEQ ID NO: 2 for the synthesis of double-stranded rna (dsrna). After the dsRNA is injected into the body cavity of an insect, the resistance of the insect is reduced in the development process, the insect is easy to infect germs, the phenomena of blackening and the like occur, and the death rate is greatly increased. The invention provides a new target for pest control.

Description

Function of insect adult disc growth factor and application of dsRNA (double-stranded ribonucleic acid) thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a function of an insect adult disc growth factor (IDGF) and an application of dsRNA thereof.

Background

Agricultural pests threaten the safe production of food in China. At present, chemical insecticides are applied for a long time for preventing and treating, so that the insecticide resistance of insects appears; the pesticide dosage is increased indirectly, and a series of problems of environmental pollution, threat to human health and the like are caused. With the development of actions such as the reduction of fertilizer and pesticide application in China, novel pest control methods and strategies are urgently needed.

RNA interference (RNAi) has been popular in recent years for pest control and is being developed at a high rate. The method has the advantages of specific prevention and treatment, green and safety, and the like. Studying the function of insect genes can provide a wider stage for pest control based on RNAi. The pest control scheme is designed aiming at the specific functional genes of the insects, so that the pest control scheme is safe and reliable, high-efficiency pest control is realized, and the application of chemical pesticides is reduced.

The insect mainly depends on humoral immunity to external invasive pathogens, and if the function of key genes in the humoral immunity can be found, the immunity can be reduced by designing a control method aiming at the insect, so that the death rate of pests in the nature is increased, and the aim of reducing pesticide application is fulfilled. Insect adult disc growth factor (IDGF) is a chitinase gene specific to insects, has a chitinase conserved structural domain, but has no intrinsic function of chitinase, and the function of the chitinase is to be researched. Research shows that IDGF can influence the development of the tribolium castaneum wings. The research discovers for the first time that the IDGF plays a key role in humoral immunity, and the IDGF is used for preventing and controlling pests by using important biological functions, so that the IDGF is time-saving, labor-saving, safe and efficient.

Disclosure of Invention

The invention aims to provide functions of an insect adult disc growth factor and application of dsRNA thereof.

The invention provides an insect adult disc growth factor gene, the nucleotide sequence of which is SEQ ID NO: 1. the sequence is obtained by searching the black cutworm transcriptome to obtain 1 black cutworm imago disc growth factor gene segment, and the full-length cDNA sequence is obtained by further cloning. The sequence is 1610bp in length, comprises 1302 bp open reading frames and encodes 434 amino acids. It has the functions of raising the humoral immunity of insect and preventing germ infection.

The invention provides a black cutworm adult disc growth factor gene fragment, the nucleotide sequence of which is SEQ ID NO: 2, is according to SEQ ID NO: 1 designing an upstream primer SEQ ID NO: 3 and the downstream primer SEQ ID NO: 4, obtaining the nucleotide sequence of SEQ ID NO: 2, which contains the T7 promoter. dsRNA was further synthesized using the kit.

SEQ ID NO: 2 application of synthetic dsRNA in pest control: the dsRNA is injected into the body cavity of the insect, and the result shows that: SEQ ID NO: 2 the synthesized dsRNA can specifically silence the tiger imago disc growth factor geneAiIDGFAnd causes the death of the black cutworm due to the infection with the disease bacteria.

Drawings

FIG. 1: 6-old black cutworm is injected with SEQ ID NO: 2, a pathogen-infected and dead phenotype after dsRNA synthesis, control injected with dsGFP on the left, control injected with SEQ ID NO: 2 synthetic dsRNA.

FIG. 2: the black cutworm is injected with the compound of SEQ ID NO: 2 synthetic dsRNA 24 hours later, adult disc growth factorAiIDGFThe silencing of the mRNA of (1),β-actinused as an internal reference gene. P<0.01。

Example 1

Gekko parvus imago disc growth factor geneAiIDGFObtaining of the sequence of

(1) Gekko parvus imago disc growth factor geneAiIDGFSearch of the sequence of (A) in the Gekko Swinhonis transcriptome database

Based on the black cutworm transcriptome database, the bioinformatics method is adopted to carry out on the black cutworm adult disc growth factor geneAiIDGFThe sequence of (1) is searched, and after sequence analysis and comparison, 1 whole of the Tilapia Feddei imago disc growth factor genes are obtainedAiIDGFThe sequence of (a).

(2) Gekko parvus imago disc growth factor geneAiIDGFVerification of the sequence of

Obtained black cutworm imago discGrowth factor geneAiIDGFThe primer is designed by using primer premier5.0 software to verify the full-length mRNA sequence. All primers used were synthesized by Shanghai Biometrics, Inc. Extracting total RNA of 6-year-old nymphs of the black cutworm, and performing reverse transcription to obtain a cDNA template for sequence retrieval. After PCR, the resulting product was purified, cloned into E.coli and sent for sequencing. After result analysis, the gecko imago disc growth factor gene is verifiedAiIDGFThe sequence of (1) is SEQ ID NO: 1.

example 2

Synthesis of Djessah adult disc growth factor gene dsRNA

(1) Design of Gekko parvus imago disc growth factor gene dsRNA primer

The sequence of the Gekko parvus imago disc growth factor gene obtained based on the research is SEQ ID NO: 1, designed by using Primereminer 5.0 software. Designing dsRNA primers, wherein the sequences of the dsRNA primers are respectively SEQ ID NO: 3 and SEQ ID NO: 4. all primers used were synthesized by Shanghai Biometrics, Inc.

(2) Synthesis of Gekko parvus imago disc growth factor gene dsRNA

The dsRNA primer is synthesized into a PCR product, purified by Wizard SV Gel and PCR Clean-Up System (Promega) kit and then transcribed in vitro to synthesize the dsRNA according to the instruction of the T7 RiboMAX Express RNAi System (Promega) kit. The dsRNA concentration was determined using a microplate reader SpectraMax 190 and concentrated to a final concentration of 3. mu.g/. mu.l.

Example 3

Application of agrotis ypsilon adult disc growth factor gene dsRNA in pest control

(1) DsRNA injection of Gekko parvus imago disc growth factor gene

mu.L (15 mu g) of dsRNA was injected between the seventh and eighth Versa segments of the 2 nd day larva of 6 th cutworm with a 25 mu L-gauge microinjector, and 30 total injections were made, each half male and female. The same volume concentration of dsGFP was injected into the control group. The injected black cutworm is placed in a constant temperature biochemical incubator at 27 ℃ for feeding, and soil matrix is added after 1 day.

(2) Detection of gene silencing efficiency of Gekko parvus imago disc growth factor

After 6-year old black cutworm dsRNA is injected, the silencing efficiency is detected 24h after the injection, the whole worm body is taken as an RNA extraction object, and 3 biological repeats are set in each group. Extracting total RNA of each sample, performing reverse transcription to obtain first strand cDNA, detecting target gene (AiIDGF) and housekeeping gene by Real-timePCR ((III))β-actin) To calculate the silencing efficiency of the target gene. As can be seen from FIG. 2, the gene silencing efficiency of the 24-hour adult disc growth factor of the black cutworm can reach 87.4%.

(3) Observation of 6-year old black cutworm phenotype after dsRNA injection

After 6-year old black cutworm larvae are injected with dsRNA for 1 day, the control group and the treatment group develop well without obvious discomfort symptoms. After the soil matrix is added, the larvae of the dsGFP control group can start to pupate before and after 6 days, and pupate successfully. However, after the dsRNA treatment group is added with the soil matrix, 30 nymphs have germ infection which is increased day by day, and when the number of the nymphs reaches 6 days, 17 larvae have growth retardation and body color blackens, and gradually die out of the graph (2), and finally only 8 larvae successfully pupate. After gene silencing, the larval mortality rate is improved by 73.3%.

Sequence listing

<110> institute for plant protection of academy of agricultural sciences of Shanxi province

Seq NO.1

TACGCGTCGTGGTGATCAGTCACATAGTATAGTAATTTATTTAGTCATGAATATTTTAATCGTCTTAGCCGGGTTTCTGGCTATAGCGGGTGCCGTTGGCCCCTCCACCAGTAAAGTCGTTTGCTACTACAACAGCAAGAGCTATGTCAGGGAATCTCAAGCGCGGATGCTGCCTCTGGACTTGGACCCGGCCCTGTCCTTCTGCACCCACCTGGTGTACGGATATGCTGGAGTCCAGCCCGACACCTACAAGATGGTGCCGCTCAACGAGAATCTGGATGTAGACCGCGCACACGCCAACTACAGGGCTATCACTAACTTCAAGACCAAGTACCCTGGCTTGAAGGTTCTGCTGTCTGTTGGAGGAGATGTCGACACTGAGTCACCAGAGAAGTACAACCTTTTGTTGGAGTCCCCACAAGCCCGTACGGCGTTTGTCAACTCTGGAGTGTTGTTGGCTGACCAGCACGGCTTTGACGGCATCGACCTTTCTTGGCAGTTCGCCAAGTACAAGCCAAAGAAGATCCGCTCCACTTGGGGATCCATCTGGCACGGCATCAAGAAGACCTTCGGCACCACCCCCGTGGATGAGAAGGAGGCTGAGCACCGTGAAGGTTTCACCGCTTTAGTCCGTGAGATGAAGCAGGCATTGAACGTCAAGCCTAACATGCAGCTGGCTATCAGTGTCCTCCCCAACGTCAACTCTTCCATTTACTACGACGTCCCTGCCATCATCAACTTGGTTGACATCGTGAACATTGGTGCCTACGACTTCGAGACCCCTGAGCGTAATCCTAAGGAGGCTGACTACGCCACCCCCTTGTACGCCCCCCAGAACCGCAACCCCCTGCTCAACGCTGACGCTGTCGTCTCTTACTGGCTCCAAGCCGGTGCCCCTGCCCAGAAGCTGATCCTGGCCATTCCTACTGCTGCTCGCACCTGGAAGCTGGATGCTGACAGCGAAATTGCTGGAGTTCCTCCCCTACACGCCGATGGACCTGGAGAAGCTGGTCCTTACACCAAAATCGAGGGTATCCTGAGCTACCCTGAGGTCTGCGCCAAGCTGATCAACCCCAACCACCAGAAGGGAATGCGTCCTCACCTTAGGAAGGTCACCGACCCCAGCAAGCGCTTCGGAACATACGCCTTCCGTCTCCCTGACGACAACGGTGATCCAGGTCTATGGGTGTCCTACGAGGATCCTGATACAGCCGGACAAAGGGCAGGTTACGTCAAGTCCAAGAACCTCGGTGGAGTATCCATCATTGACCTGTCCATGGATGACTTCCGTGGTCTCTGCACTGGGGACAAATACCCCATCCTCAGGGCTGCCAAATACCGTCTTTAAATATATAAAATATTTTTTCTCCAGTAACTTATACCTGTATTCTTTCAATCAATGGCGATGTAAAATTTTTATGAGTAAACTGTAACTTTTGCCCCCTTGCAGATATCACCTTCTATATATTTTGTAATCAGTCTTATATAAGCACCTTCTATAAACAAATCTTGAGTAGGTTACTGGTTATAATTTGCTATATAATAATAACTAAAATAAGTCACAGTTTAGTAAGATATTTTATATTAAAAGAACATTGTCATTTTCTGTG

Seq NO.2

dsRNA

TGGTGTACGGATATGCTGGAGTCCAGCCCGACACCTACAAGATGGTGCCG

CTCAACGAGAATCTGGATGTAGACCGCGCACACGCCAACTACAGGGCTAT

CACTAACTTCAAGACCAAGTACCCTGGCTTGAAGGTTCTGCTGTCTGTTG

GAGGAGATGTCGACACTGAGTCACCAGAGAAGTACAACCTTTTGTTGGAG

TCCCCACAAGCCCGTACGGCGTTTGTCAACTCTGGAGTGTTGTTGGCTGA＜＞

＜

CCAGCACGGCTTTGACGGCATCGACCTTTCTTGGCAGTTCGCCAAGTACA

AGCCAAAGAAGATCCGCTCCACTTGGGGATCCATCTGGCACGGCATCAAG

AAGACCTTCGGCACCACCCCCGTGGATGAGAAGGAGGCTGAGCACCGTGA

AGGTTTCACCGCTTTAGTCCGTGAGATGAAGCAGGCATTGAACGTCAAGC

CTAACATGCAGCTGGCTATCAGTGTCCTCCCCAACGTCAACTCTTCCAT

Seq NO. 3

Primer upstream

taatacgactcactatagggTGGTGTACGGATATGCTGGA

Seq NO. 4

Downstream of the primer

taatacgactcactatagggATGGAAGAGTTGACGTTGGG

<120> function of insect adult disc growth factor and application of dsRNA thereof

<160>0

<170>SIPOSequenceListing 1.0

Claims

1. An insect adult disc growth factor gene characterized by having the nucleotide sequence of SEQ ID NO: 1; it has the functions of raising the humoral immunity of insect and preventing germ infection.

2. An insect adult disc growth factor gene fragment, the nucleotide sequence of which is SEQ ID NO: 2; it is characterized in that both ends contain a T7 promoter.

3. The use of dsRNA synthesized from the adult disc growth factor gene segment of claim 2 for controlling pests.