CN103562394A - Down-regulating gene expression in insect pests - Google Patents

Down-regulating gene expression in insect pests Download PDF

Info

Publication number
CN103562394A
CN103562394A CN201280024260.1A CN201280024260A CN103562394A CN 103562394 A CN103562394 A CN 103562394A CN 201280024260 A CN201280024260 A CN 201280024260A CN 103562394 A CN103562394 A CN 103562394A
Authority
CN
China
Prior art keywords
seq
sequence
insect
nucleotide sequence
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201280024260.1A
Other languages
Chinese (zh)
Other versions
CN103562394B (en
Inventor
米里昂·贝吉恩
蒂埃里·博盖尔特
帕斯卡莱·费尔德曼
罗曼·雷马克斯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Devgen NV
Original Assignee
Devgen NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Devgen NV filed Critical Devgen NV
Priority to CN201910766343.1A priority Critical patent/CN110452908A/en
Publication of CN103562394A publication Critical patent/CN103562394A/en
Application granted granted Critical
Publication of CN103562394B publication Critical patent/CN103562394B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/60—Isolated nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The present invention relates to genetic control of infestation by insect pest species, particularly prevention and/or control of pest infestation of plants, using interfering ribonucleic acid (RNA) molecules. Compositions and combinations containing the interfering RNA molecules of the invention for use in topical applications, for example in the form of insecticides.

Description

Down-regulation of gene expression in insect pest
Invention field
Present invention relates in general to the Genetic Control to the invasion of insect pest species, particularly to the prevention of the infest of plant and/or control.More particularly, the present invention relates to lower by disturbance ribonucleic acid (RNA) molecule the expression of target gene in insect pest species.The composition and the combination that comprise disturbance RNA molecule of the present invention are also provided, and they are applicable to topical application, for example, be sterilant form.
background of invention
Exist and can infect or invade and harass the insect pest species of multiple environment and host organisms in a large number.Insect pest comprises a plurality of species in following insect order: Hemiptera (Hemiptera) (stinkbug class insect), Coleoptera (Coleoptera) (beetle), Siphonaptera (Siphonaptera) (flea), Dictyoptera (Dichyoptera) (cockroach and mantis), lepidopteran (Lepidoptera) (moth and butterfly), Orthoptera (Orthoptera) (for example grasshopper) and Diptera (Diptera) (fly).Infest can cause serious infringement.The insect pest of invading and harassing plant species is a problem especially in agricultural, because they can cause serious harm and significantly reduce plant biomass crop.The plant of number of different types is all responsive to infest, comprises cash crop, as paddy rice, cotton, soybean, potato and corn.
Traditionally, by prevent or control the invasion of insect pest with chemical insecticide.Yet these chemical are not always applicable to process crop, because they are may be to other species poisonous and can cause significant environmental damage.In decades recently, investigator has developed the more eco-friendly method that Control pests is invaded and harassed.For instance, used and expressed natively the microorganism to the poisonous protein of insect pest, as bacillus thuringiensis (Bacillus thuringiensis) bacterium.Scientist also isolates the gene of these insecticidal proteins of coding and produces genetically modified crops insect pest to resistance with them, and for example genetically engineered turns to corn and the vegetable lamb that produces Cry family protein.
Although bacteriotoxin is always extremely successful aspect the insect of some type of control, they are not all effective to all pest species.Therefore, investigators have searched out other insect control methods more targetedly, particularly RNA is disturbed or ' gene silencing ' as the method for the means of Control pests in hereditary level.
RNA disturb or ' RNAi ' be in order under cell or whole organism environment with a kind of method of sequence-specific mode down-regulation of gene expression.RNAi is in the art for inhibition or lowers a kind of proven technique of the genetic expression in multiple organism (comprising insect organism, as fungi, nematode and insect).In addition, research before shows, the target gene of lowering in insect pest species can be used as a kind of means that Control pests is invaded and harassed.
WO2007/074405 has described the method for the expression of target gene in inhibition invertebrates insect (comprising Colorado colorado potato bug).In addition, WO2009/091864 has described for suppressing composition and the method for the target gene of insect pest species (comprising the insect belonging to from lygus bug (Lygus)).
Although be well known in the art with the genetic expression that RNAi lowers in pest species, but this technology is depended on and selects optimal target gene as the success of insect measure of control, and afunction causes those genes of essential bioprocess havoc and/or organism death.Therefore, the present invention is directed to the particular target gene of lowering in insect is realized to insect pest invasion as a kind of means, particularly the insect pest of plant invasion more effectively prevents and/or controls.
Summary of the invention
The inventor attempts to identify for preventing and/or control the means of the improvement of insect pest invasion with genetic method.Specifically, they have studied with RNAi and have carried out in the following manner down-regulated gene: weaken insect pest survival, growth, surely grow specific environment and/or invade and harass the ability of host organisms and limit thus the infringement being caused by this insect.
Therefore, according to an aspect of the present invention, provide a kind of disturbance ribonucleic acid (RNA or double-stranded RNA), it plays the effect of the expression of lowering a kind of target gene in described insect pest after being taken in by a kind of insect pest species,
Wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the NO1 by SEQ ID, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in a kind of nucleotide sequence of any composition, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any one at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of nucleotide sequence of the fragment of 2000 or 3000 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any one at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of nucleotide sequence of the fragment of 2000 or 3000 continuous nucleotides, and wherein work as described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, in 389 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(vi) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 70% in 389, preferably at least 75%, 80%, 85%, 90%, 95%, 98% or 99% is consistent.
In a particular aspects of the present invention, disturbance RNA molecule of the present invention comprises at least one double stranded region, the silencing elements of RNA interfering typically, its one of comprising by annealing with the pairing of sense-rna chain complementary base has adopted RNA chain, and wherein the sense strand of dsRNA molecule comprises and a nucleotide sequence of a nucleotide sequence complementation that is positioned at the rna transcription thing of this target gene.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA or double-stranded RNA), it plays the effect of the expression of lowering the target gene in described insect pest after being taken in by a kind of insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when any in 230 to 233 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when the respective segments in any in 230 to 233 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, in 230 to 233 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% consistent or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, any coded aminoacid sequence at least 85% in 230 to 233, preferably at least 90%, 95%, 98% or 99% is consistent.
These target genes are coded in the protein in troponin/myofilament mixture.
In yet another embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA or double-stranded RNA), it plays the effect of the expression of lowering the target gene in described insect pest after being taken in by a kind of insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when any in 270 to 273 compared best and compares, described nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when the respective segments in any in 270 to 273 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, in 270 to 273 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, any coded aminoacid sequence at least 85% in 270 to 273, preferably at least 90%, 95%, 98% or 99% is consistent.
These target gene coding insect ribosomal proteins.
In certain embodiments, the present invention relates to a kind of disturbance RNA molecule, this disturbance RNA molecule comprises at least one double stranded region, the silencing elements of this disturbance RNA molecule typically, its one of comprising by annealing with the pairing of sense-rna chain complementary base has adopted RNA chain, wherein the sense strand of dsRNA molecule comprises one at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, the sequence of 2000 or 3000 continuous nucleotides, this sequence and the nucleotide sequence at least 75% being positioned at from the rna transcription thing of the target gene of troponin/myofilament mixture, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or 100% complementation.
In one embodiment, this target gene a kind of insect wings up A (Troponin I) albumen (for example a kind of insect straight homologues of CG7178Dm albumen) of encoding, described target gene is to be represented by SEQ ID NO1 and 2.In a preferred embodiment, this insect straight homologues and SEQ ID NO79 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene a kind of albumen (upheld protein) (for example a kind of insect straight homologues of CG7107Dm albumen) of supporting of encoding, described target gene is to be represented by SEQ ID NO121 and 130.In a preferred embodiment, this insect straight homologues and SEQ ID NO330 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, these target gene coding tropomyosin 1 albumen (for example a kind of insect straight homologues of CG4898Dm albumen) or tropomyosin 2 albumen (for example a kind of insect straight homologues of CG4843Dm albumen), described target gene is to be represented by SEQ ID NO123 and 132.In a preferred embodiment, this insect straight homologues and SEQ ID NO332 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding myoglobulin heavy chain (for example a kind of insect straight homologues of CG17927Dm albumen), described target gene is to be represented by SEQ ID NO122 and 131.In a preferred embodiment, this insect straight homologues and SEQ ID NO331 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding myosin light chain cytoplasm protein (for example a kind of insect straight homologues of CG3201Dm albumen), described target gene is to be represented by SEQ ID NO124 and 133.In a preferred embodiment, this insect straight homologues and SEQ ID NO333 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding shark's fin melon albumen (for example a kind of insect straight homologues of CG3595Dm albumen), described target gene is to be represented by SEQ ID NO125 and 134.In a preferred embodiment, this insect straight homologues and SEQ ID NO334 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding zipper protein (for example a kind of insect straight homologues of CG15792Dm albumen), described target gene is to be represented by SEQ ID NO126 and 135.In a preferred embodiment, this insect straight homologues and SEQ ID NO335 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding TnC (for example a kind of insect straight homologues of CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 or CG6514Dm albumen), described target gene is to be represented by SEQ ID NO127 and 136.In a preferred embodiment, this insect straight homologues and SEQ ID NO336 and 337 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.
According to another embodiment, the present invention relates to a kind of disturbance RNA molecule, this disturbance RNA molecule comprises at least one double stranded region, the silencing elements of this disturbance RNA molecule typically, its one of comprising by annealing with the pairing of sense-rna chain complementary base has adopted RNA chain, wherein the sense strand of dsRNA molecule comprises one at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, the sequence of 2000 or 3000 continuous nucleotides, this sequence and a nucleotide sequence at least 75% of rna transcription thing that is positioned at a kind of target gene of a kind of insect ribosomal protein of coding, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or 100% complementation.In one embodiment, this target gene coding ribosomal protein S3A (for example a kind of insect straight homologues of CG2168Dm albumen), described target gene is to be represented by SEQ ID NO11 and 12.In a preferred embodiment, this insect straight homologues and SEQ ID NO84 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L P1 (for example a kind of insect straight homologues of CG4087Dm albumen), described target gene is to be represented by SEQ ID NO3 and 4.In a preferred embodiment, this insect straight homologues and SEQ ID NO80 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S3 (for example a kind of insect straight homologues of CG6779Dm albumen), described target gene is to be represented by SEQ ID NO7 and 8.In one embodiment, the target gene coding ribosomal protein L 10Ab (for example a kind of insect straight homologues of CG7283Dm albumen) being represented by SEQ ID NO9 and 10.In a preferred embodiment, this insect straight homologues and SEQ ID NO83 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 8 (for example a kind of insect straight homologues of CG8900Dm albumen), described target gene is to be represented by SEQ ID NO13 and 14.In a preferred embodiment, this insect straight homologues and SEQ ID NO85 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 4 (for example a kind of insect straight homologues of CG5502Dm albumen), described target gene is to be represented by SEQ ID NO5 and 6.In a preferred embodiment, this insect straight homologues and SEQ ID NO81 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S27 (for example a kind of insect straight homologues of CG10423Dm albumen), described target gene is to be represented by SEQ ID NO15 and 16.In one embodiment, this target gene coding Ribosomal protein L6 (for example a kind of insect straight homologues of CG11522Dm albumen), described target gene is to be represented by SEQ ID NO17 and 18.In a preferred embodiment, this insect straight homologues and SEQ ID NO87 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 3 (for example a kind of insect straight homologues of CG13389Dm albumen), described target gene is to be represented by SEQ ID NO19 and 20.In a preferred embodiment, this insect straight homologues and SEQ ID NO88 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 12 (for example a kind of insect straight homologues of CG3195Dm albumen), described target gene is to be represented by SEQ ID NO21 and 22.In a preferred embodiment, this insect straight homologues and SEQ ID NO89 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 26 (for example a kind of insect straight homologues of CG6846Dm albumen), described target gene is to be represented by SEQ ID NO158 and 159.In a preferred embodiment, this insect straight homologues and SEQ ID NO343 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 21 (for example a kind of insect straight homologues of CG12775Dm albumen), described target gene is to be represented by SEQ ID NO165,166 and 167.In a preferred embodiment, this insect straight homologues and SEQ ID NO347 and 348 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 2 (for example a kind of insect straight homologues of CG11271Dm albumen), described target gene is to be represented by SEQ ID NO156 and 157.In a preferred embodiment, this insect straight homologues and SEQ ID NO342 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S28b (for example a kind of insect straight homologues of CG2998Dm albumen), described target gene is to be represented by SEQ ID NO160 and 161.In a preferred embodiment, this insect straight homologues and SEQ ID NO344 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 13 (for example a kind of insect straight homologues of CG4651Dm albumen), described target gene is to be represented by SEQ ID NO154 and 155.In a preferred embodiment, this insect straight homologues and SEQ ID NO341 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 10 (for example a kind of insect straight homologues of CG17521Dm albumen), described target gene is to be represented by SEQ ID NO163 and 164.In a preferred embodiment, this insect straight homologues and SEQ ID NO345 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 5 (for example a kind of insect straight homologues of CG17489Dm albumen), described target gene is to be represented by SEQ ID NO152 and 153.In a preferred embodiment, this insect straight homologues and SEQ ID NO340 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 5Aa (for example a kind of insect straight homologues of CG2033Dm albumen), described target gene is to be represented by SEQ ID NO150 and 151.In a preferred embodiment, this insect straight homologues and SEQ ID NO339 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 19 (for example a kind of insect straight homologues of CG2746Dm albumen) or ribosomal protein L 27 (for example a kind of insect straight homologues of CG4759Dm albumen).In one embodiment, this target gene coding line plastochondria cytochrome c oxidase subunit I I albumen (for example a kind of insect straight homologues of CG34069Dm albumen), described target gene is to be represented by SEQ ID NO25 and 26.In a preferred embodiment, this insect straight homologues and SEQ ID NO91 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding atp synthase-γ chain (for example a kind of insect straight homologues of CG7610Dm albumen), described target gene is to be represented by SEQ ID NO129 and 138.In a preferred embodiment, this insect straight homologues and SEQ ID NO338 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ubiquitin-5E (for example a kind of insect straight homologues of CG32744Dm albumen).In one embodiment, this target gene proteins encoded Mei TiβXing subunit (for example a kind of insect straight homologues of CG17331Dm albumen), this albumen is a kind of insect straight homologues of CG13704Dm albumen; For example, with Rpn12 albumen (a kind of insect straight homologues of CG4157Dm albumen).
According to a second aspect of the present invention, provide a kind of for preventing and/or control the composition that insect pest is invaded and harassed, said composition comprises at least one disturbance ribonucleic acid (RNA) and carrier, vehicle or thinner that at least one is suitable, wherein this RNA interfering plays the effect of lowering the expression of target gene in described insect after being taken in by insect
Wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any in 389 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389 is consistent.
Composition of the present invention can be invaded and harassed for prevention and/or Control pests.In certain embodiments, said composition can be as a kind of for plant or for the breeding of plant or the sterilant of reproductive material.In yet another aspect, at this, provide a kind of for the combination preventing and/or Control pests is invaded and harassed, this combination comprises composition of the present invention and at least one other promoting agent.
In yet another aspect, this provide a kind of for the expression of lowering insect pest species target gene so that the method that prevention and/or Control pests are invaded and harassed, the method comprises makes described pest species contact with at least one disturbance ribonucleic acid (RNA) of a kind of significant quantity, wherein this RNA interfering plays the effect of the expression of lowering a kind of target gene in described insect after being taken in by insect, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in a target nucleotide sequences at least in part a complementary nucleotide sequence or consisting of, and this target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ OD NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, in 389 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389, preferably at least 90%, 95%, 98% or 99% is consistent.
According to another aspect of the present invention, provide a kind of polynucleotide of separation, these polynucleotide are selected from lower group, and this group is comprised of the following:
(i) comprise as by SEQ ID N01, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence at least 21 of any represented a kind of nucleotide sequence, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide of 2000 or 3000 continuous nucleotides, or
(ii) by as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence at least 21 of any represented a kind of nucleotide sequence, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 a kind of polynucleotide that continuous nucleotide forms, or
(iii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of nucleotide sequence, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide of 2000 or 3000 continuous nucleotides, make when comparing best and compare two kinds of sequences described polynucleotide and SEQ ID NO1 thus, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of Nucleotide, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide of the fragment of 2000 or 3000 continuous nucleotides, and wherein said fragment or described complementary sequence have a kind of nucleotide sequence, when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) by as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of Nucleotide, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide that the fragment of 2000 or 3000 continuous nucleotides forms, and wherein said fragment or described complementary sequence have a kind of nucleotide sequence, when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(vi) encode a kind of a kind of polynucleotide of aminoacid sequence, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 70% in 389, preferably at least 75%, 80%, 85%, 90%, 95%, 98% or 99% is consistent, and
Wherein said polynucleotide are no longer than 10000,9000,8000,7000,6000,5000,4000,3000,2000 or 1500 Nucleotide.
The aminoacid sequence of being encoded by target gene of the present invention is accordingly by SEQ ID NO79,349,352,356,80,326,81,327,82,83,328,84,329,85,86,359,87 to 91,330,350,353,331,351,332 to 336,337,354,338 to 344,346,345,347,348,357,355,358,390 represented to 393.
Of the present invention one concrete aspect, these separated polynucleotide are parts of disturbance RNA molecule, a part for silencing elements typically, it comprises at least one double stranded region, one of comprising by annealing with the pairing of sense-rna chain complementary base in this double stranded region has adopted RNA chain, and wherein the sense strand of dsRNA molecule comprises and a nucleotide sequence of a nucleotide sequence complementation that is positioned at the rna transcription thing of this target gene.More particularly, these separated polynucleotide are in a kind of DNA construct, to make sense and antisense polynucleotide transcribe dsRNA molecule of rear formation with sense and antisense directed cloning, and this molecule plays the effect that suppresses or lower the expression of target gene in described insect after being taken in by insect.
In one embodiment, the present invention relates to a kind of polynucleotide of separation, these polynucleotide are in a kind of DNA construct, to make sense and antisense polynucleotide transcribe dsRNA molecule of rear formation with sense and antisense directed cloning, and this molecule plays the effect that suppresses or lower the expression of target gene in troponin/myofilament mixture after being taken in by insect.In one embodiment, this target gene a kind of insect wings up A (Troponin I) albumen (for example a kind of insect straight homologues of CG7178Dm albumen) of encoding, described target gene is to be represented by SEQ ID NO1 and 2.In a preferred embodiment, this insect straight homologues and SEQ ID NO79 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene a kind of albumen (for example a kind of insect straight homologues of CG7107Dm albumen) of supporting of encoding, described target gene is to be represented by SEQ ID NO121 and 130.In a preferred embodiment, this insect straight homologues and SEQ ID NO330 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, these target gene coding tropomyosin 1 albumen (for example a kind of insect straight homologues of CG4898Dm albumen) or tropomyosin 2 albumen (for example a kind of insect straight homologues of CG4843Dm albumen), described target gene is to be represented by SEQ ID NO123 and 132.In a preferred embodiment, this insect straight homologues and SEQ ID NO332 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding myoglobulin heavy chain (for example a kind of insect straight homologues of CG17927Dm albumen), described target gene is to be represented by SEQ ID NO122 and 131.In a preferred embodiment, this insect straight homologues and SEQ ID NO331 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding myosin light chain cytoplasm protein (for example a kind of insect straight homologues of CG3201Dm albumen), described target gene is to be represented by SEQ ID NO124 and 133.In a preferred embodiment, this insect straight homologues and SEQ ID NO333 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding shark's fin melon albumen (for example a kind of insect straight homologues of CG3595Dm albumen), described target gene is to be represented by SEQ ID NO125 and 134.In a preferred embodiment, this insect straight homologues and SEQ ID NO334 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding zipper protein (for example a kind of insect straight homologues of CG15792Dm albumen), described target gene is to be represented by SEQ ID NO126 and 135.In a preferred embodiment, this insect straight homologues and SEQ ID NO335 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding TnC (for example a kind of insect straight homologues of CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 or CG6514Dm albumen), described target gene is to be represented by SEQ ID NO127 and 136.In a preferred embodiment, this insect straight homologues and SEQ ID NO336 and 337 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.
According to other embodiment, the present invention relates to a kind of polynucleotide of separation, these polynucleotide are in a kind of DNA construct, to make sense and antisense polynucleotide transcribe dsRNA molecule of rear formation with sense and antisense directed cloning, and this molecule plays the effect of expression that suppresses or lower a kind of target gene of the insect ribosomal protein of encoding after being taken in by insect.
In one embodiment, this target gene coding ribosomal protein S3A (for example a kind of insect straight homologues of CG2168Dm albumen), described target gene is to be represented by SEQ ID NO11 and 12.In a preferred embodiment, this insect straight homologues and SEQ ID NO84 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L P1 (for example a kind of insect straight homologues of CG4087Dm albumen), described target gene is to be represented by SEQ ID NO3 and 4.In a preferred embodiment, this insect straight homologues and SEQ ID NO80 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S3 (for example a kind of insect straight homologues of CG6779Dm albumen), described target gene is to be represented by SEQ ID NO7 and 8.In one embodiment, the target gene coding ribosomal protein L 10Ab (for example a kind of insect straight homologues of CG7283Dm albumen) being represented by SEQ ID NO9 and 10.In a preferred embodiment, this insect straight homologues and SEQ ID NO83 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 8 (for example a kind of insect straight homologues of CG8900Dm albumen), described target gene is to be represented by SEQ ID NO13 and 14.In a preferred embodiment, this insect straight homologues and SEQ ID NO85 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 4 (for example a kind of insect straight homologues of CG5502Dm albumen), described target gene is to be represented by SEQ ID NO5 and 6.In a preferred embodiment, this insect straight homologues and SEQ ID NO81 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S27 (for example a kind of insect straight homologues of CG10423Dm albumen), described target gene is to be represented by SEQ ID NO15 and 16.In one embodiment, this target gene coding Ribosomal protein L6 (for example a kind of insect straight homologues of CG11522Dm albumen), described target gene is to be represented by SEQ ID NO17 and 18.In a preferred embodiment, this insect straight homologues and SEQ ID NO87 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 3 (for example a kind of insect straight homologues of CG13389Dm albumen), described target gene is to be represented by SEQ ID NO19 and 20.In a preferred embodiment, this insect straight homologues and SEQ ID NO88 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 12 (for example a kind of insect straight homologues of CG3195Dm albumen), described target gene is to be represented by SEQ ID NO21 and 22.In a preferred embodiment, this insect straight homologues and SEQ ID NO89 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 26 (for example a kind of insect straight homologues of CG6846Dm albumen), described target gene is to be represented by SEQ ID NO158 and 159.In a preferred embodiment, this insect straight homologues and SEQ ID NO343 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 21 (for example a kind of insect straight homologues of CG12775Dm albumen), described target gene is to be represented by SEQ ID NO165,166 and 167.In a preferred embodiment, this insect straight homologues and SEQ ID NO347 and 348 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 2 (for example a kind of insect straight homologues of CG11271Dm albumen), described target gene is to be represented by SEQ ID NO156 and 157.In a preferred embodiment, this insect straight homologues and SEQ ID NO342 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S28b (for example a kind of insect straight homologues of CG2998Dm albumen), described target gene is to be represented by SEQ ID NO160 and 161.In a preferred embodiment, this insect straight homologues and SEQ ID NO344 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 13 (for example a kind of insect straight homologues of CG4651Dm albumen), described target gene is to be represented by SEQ ID NO154 and 155.In a preferred embodiment, this insect straight homologues and SEQ ID NO341 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 10 (for example a kind of insect straight homologues of CG17521Dm albumen), described target gene is to be represented by SEQ ID NO163 and 164.In a preferred embodiment, this insect straight homologues and SEQ ID NO345 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 5 (for example a kind of insect straight homologues of CG17489Dm albumen), described target gene is to be represented by SEQ ID NO152 and 153.In a preferred embodiment, this insect straight homologues and SEQ ID NO340 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein S1 5Aa (for example a kind of insect straight homologues of CG2033Dm albumen), described target gene is to be represented by SEQ ID NO150 and 151.In a preferred embodiment, this insect straight homologues and SEQ ID N0339 have at least 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% consistence.In one embodiment, this target gene coding ribosomal protein L 19 (for example a kind of insect straight homologues of CG2746Dm albumen) or ribosomal protein L 27 (for example a kind of insect straight homologues of CG4759Dm albumen).
Preferably, method of the present invention can be applied to prevention and/or control insect pest and invade and harass, and particularly controls the infest of following crop plants: for example draw (but being not limited to) cotton, potato, paddy rice, strawberry, clover, soybean, tomato, Kano, Sunflower Receptacle, Chinese sorghum, pearl millet, corn, eggplant, pepper and tobacco.In addition can RNA interfering of the present invention be incorporated in plant to be protected by conventional gene engineering.
Of the present invention all aspect, in a preferred embodiment, this target gene
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when any in 230 to 233 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when the respective segments in any in 230 to 233 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, in 230 to 233 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, any coded aminoacid sequence at least 85% in 230 to 233, preferably at least 90%, 95%, 98% or 99% is consistent.
These target genes are coded in the protein in troponin/myofilament mixture.
Of the present invention all aspect, in a preferred embodiment, this target gene
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 1167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when any in 270 to 273 compared best and compares, described nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when the respective segments in any in 270 to 273 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, in 270 to 273 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, any coded aminoacid sequence at least 85% in 270 to 273 is consistent.
These target gene coding insect ribosomal proteins.
Of the present invention all aspect, in a preferred embodiment, this target gene (i) is selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when any in 310 to 313 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when the respective segments in any in 310 to 313 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, in 310 to 313 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313, preferably at least 90%, 95%, 98% or 99% is consistent.
form and brief description of drawings
Table 1 is by the novel target of the beanpod lygus bug of Screening and Identification (Lygus hesperus) for the first time.
The novel target of the beanpod lygus bug of table 1B in Lh594 approach.
Table 1C is by the second novel target of beanpod lygus bug of taking turns Screening and Identification.
The polynucleotide sequence of the target gene that table 2 is identified in beanpod lygus bug.
The aminoacid sequence of the target gene that table 3 is identified in beanpod lygus bug.
Table 4 is corresponding to the dsRNA (sense strand being represented by equivalent DNA sequence dna) of beanpod lygus bug target gene with for generation of the primer of these dsRNA.
Table 5 is compared and is carried out the beanpod lygus bug target of classification according to dose response curve (DRC) and with basic target Lh423 and Lh105.
Table 6 is from the second beanpod lygus bug target of taking turns screening-compare and carry out classification according to DRC and with basic target Lh423 and Lh594.
The polynucleotide sequence of the target gene that table 7 is identified in Colorado colorado potato bug (CPB).
The aminoacid sequence of the target gene that table 8 is identified in CPB.
Table 9 is corresponding to the dsRNA (sense strand being represented by equivalent DNA sequence dna) of CPB gene with for generation of the primer of these dsRNA.
The polynucleotide sequence of the target gene that table 10 is identified in brown plant hopper (BPH).
The aminoacid sequence of the target gene that table 11 is identified in BPH.
Table 12 is corresponding to the dsRNA (sense strand being represented by equivalent DNA sequence dna) of BPH gene with for generation of the primer of these dsRNA.
Table 13 is based on pea aphid genome sequence and for the primer of the aphid cDNA that increases.
The polynucleotide sequence of the target gene that table 14 is identified in aphid.
The aminoacid sequence of the target gene that table 15 is identified in aphid.
Table 16 is corresponding to the dsRNA (sense strand being represented by equivalent DNA sequence dna) of aphid target gene with for generation of the primer of these dsRNA.
Table 17 is for the degenerated primer of the CPB Ld594cDNA that increases
Table 18 is for the degenerated primer of the BPH cDNA that increases
Table 19: from the novel target of colorado potato beetles (Leptmotarsa decemlineata) of this screening.
Table 20: the target that the novelty of brown paddy plant hopper (Nilaparvata lugens) is identified.
Table 21: the target that the novelty of acyrthosiphum pisim (Acyrthosiphon pisum) is identified.
Fig. 1: the confirmation for the second time of plate Lh001_009 is measured.The filaments of sun: the mortality ratio at the 3rd day to the 6th day; Bright wisp: the mortality ratio at the 6th day to the 8th day.Use " Lygxxx " screening code and " Lhxxx " target name code that candidate clone is named.
Fig. 2: the confirmation for the second time of plate Lh010_020 is measured.The filaments of sun: the mortality ratio at the 3rd day to the 6th day; Bright wisp: the mortality ratio at the 6th day to the 8th day.To use " Lygxxx " screening code and " Lhxxx " target name code that candidate clone is named.
Fig. 3: the mortality analysis from plate Lh001 to the novel target of lygus bug of Lh009, represents with the mortality ratio % in the time period at 10 days.Contrast is to be represented by dotted lines.Positive control: Lh423dsRNA (RpL19).Negative control: GFP dsRNA and only feed (contrast).
Fig. 4: the mortality analysis from plate Lh010 to the novel target of lygus bug of Lh020, represents with the mortality ratio % in the time period at 10 days.Contrast is to be represented by dotted lines.Positive control: Lh423 (RpL19).Negative control: GFP and only feed (contrast).
Fig. 5 is to the dose response curve (in the figure, unit " μ g/ μ l " is not shown) the synthetic dsRNA concentration of the purifying of novel targets of 9 beanpod lygus bugs-within the scope of from 0.4 to 0.025 μ g/ μ l.Use GFP dsRNA and millQ water as negative control.The dsRNA of target be use as example part 1.1 described in primer generation.
Lh594 dose response curve the dsRNA concentration of Figure 10 within the scope of from 0.05 to 0.001 μ g/ μ l.Use GFP dsRNA and millQ water as negative control.
Figure 11 A dsRNA in the biological assay of beanpod lygus bug in the situation that not there is not tRNA is active: do not have tRNA Lh594 (5 μ g/ μ l); Positive control: Lh423 (5 μ g/ μ l); Negative control: GFP dsRNA (5 μ g/ μ l) and millQ water; B is used the evaluation of the active limit of Lh594 of the dsRNA (from 5 μ g to 0.25 μ g) of the concentration of successively decreasing.Negative control: GFP dsRNA (5 μ g/ μ l) and millQ water.
The plate Lh010 of Figure 12 programmed screening target measures to the confirmation for the second time of Lh020.The filaments of sun: the mortality ratio at the 4th day to the 8th day; Bright wisp: the mortality ratio at the 4th day to the 6th day.Use " Lygxxx " screening code and " Lhxxx " target name code that candidate clone is named.
The measurement result of the lygus bug troponin approach target that Figure 13 tests under 0.5 fixing μ g/ μ l.
Figure 14 A-B is from the dose response curve (in the figure, unit " μ g/ μ l " is not shown all the time) the synthetic dsRNA concentration of the purifying of the novel target of the beanpod lygus bug of troponin approach-within the scope of from 0.4 to 0.025 μ g/ μ l.Use GFP dsRNA and millQ water as negative control.
Dose response curve the synthetic dsRNA concentration of the purifying of the novel target of the beanpod lygus bug of Figure 15 A-D programmed screening target-within the scope of from 0.5 to 0.05 μ g/ μ l.Use GFP dsRNA and millQ water as negative control.
The survival rate analysis of dsRNA Ld594, the Ld619 of 1 μ g and the CPB larva of Ld620 processing for Figure 16.Positive control comprises the 1 μ g dsRNA of basic target Ld513 and Ld049.Negative control comprises millQ water and FP.
Figure 17 compares with untreated contrast (UTC), the impact that Ld594, Ld619 and Ld620dsRNA are pupated on CPB4 instar larvae.To insect, feed to be distributed in the dsRNA of 1 μ g in leaf of potato dish, then feed with untreated leaf of potato (A) and continue 4 days, be then placed on vermiculite.In order to assess the effect of dsRNA, from vermiculite, dig out dead insect (because the strong effect that Ld594dsRNA induces can not be recovered to pupa, and therefore, not obtain the image of this target dsRNA from vermiculite) (B).
Figure 18 CPB Ld594,619 and 620dsRNA to the survival rate of CPB adult and healthy effect.At the 4th, 6,7,8,11 and 13 days, assess.Contrast MQ:millQ water.
Figure 19 is the activity in brown plant hopper from the dsRNA of N1594 approach.CHAPSO 0.1% tests the DsRNA of 0.5 μ g/ μ l under existing.Positive control: N1537dsRNA (0.5 μ g/ μ l); Negative control: GFP dsRNA (0.5 μ g/ μ l) and only feed.
Figure 20 is the activity to acyrthosiphum pisim from the dsRNA of Ap594, Ap423, Ap537 and Ap560.Under existing, tests the tRNA of 5 μ g/ μ l the DsRNA of 0.5 μ g/ μ l.Negative control: GFPdsRNA (0.5 μ g/ μ l).
Figure 21 colorado potato beetles larva is about the mortality ratio per-cent of the artificial diet with dsRNA processing.Ld583, Ld584, Ld586 and Ld588 represent target clone.Positive control: Ld513; Negative control: FP.
detailed description of the invention
Ladies and gentlemen contriver have been found that by RNAi, lower the expression of particular target gene in insect pest species can be for effectively preventing and/or controlling described insect pest and invade and harass.
As used herein, term " control " infest refer to insect is produced be used for restriction and/or reduce the number of insect organism and/or any effect of the infringement that caused by insect.Therefore, preferred target gene be control or regulation and control insect pest in one or more must biological function indispensable gene, these must biological function be such as cell fission, reproduction, energy metabolism, digestion, neural function etc.By RNAi technology, lower the death that these indispensable genes can cause insect, or with retarding of growing and the growth or weaken insect surely grow or invade and harass the ability of host organisms in environment significantly of other mode.
Ladies and gentlemen contriver has now identified the good target gene of the insect pest species that belong to lygus bug genus, colorado potato beetles genus, brown paddy plant hopper genus and pea Aphis, and these targets are conceived to individually or combine as RNAi mediation property control example as a kind of effective means of the insect infestation of important crops on agronomy.The straight homologues of the target gene of these new evaluations can in other insect species to control the infest of corresponding relevant crop.
More particularly, the gene that ladies and gentlemen contriver has described the protein of coding troponin/myofilament mixture at this has formed for suppressing by RNA the splendid target gene that mechanism suppresses.A kind of coding insect Troponin I albumen (wings up A) in these target genes, it is a kind of straight homologues of fruit bat CG7178 albumen.This protein is involved in Muscle contraction and belongs to a kind of physiological pathway, and this physiological pathway is not controlled and fully explored for suppress to carry out (insect) insect by RNA.In addition, because this protein complex has animal specificity, there is no known plant gene homologue or straight homologues, so while expressing target dsRNA in plant, reduced the risk of special-shaped strain (off-type plant) phenotype.In addition, in fruit bat, in fruit bat, Troponin I is described to a kind of gene of haplo-insufficiency, presents a kind of mutation type surface in heterozygote state.This genoid is to the reduction of mrna expression level especially sensitivity and therefore can be regarded as desirable RNAi target.
Other interested target genes in this troponin/myofilament mixture have below been listed.
Annotation ID Cytology Dm identifier
up Support albumen CG7107
Tm1 Tropomyosin 1 CG4898
Tm2 Tropomyosin 2 CG4843
Mhc Myoglobulin heavy chain CG17927
Mlc-c Myosin light chain tenuigenin CG3201
sqh Shark's fin melon CG3595
zip Slide fastener CG15792
Thereby, according to an embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), it plays the effect of the expression of lowering the target gene in described insect pest after being taken in by a kind of insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when any in 230 to 233 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when the respective segments in any in 230 to 233 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, in 230 to 233 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ 1D NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, any coded aminoacid sequence at least 85% in 230 to 233, preferably at least 90%, 95%, 98% or 99% is consistent.
In a preferred embodiment, a kind of insect protein that is selected from troponin/myofilament mixture of this target gene coding, this mixture is selected from lower group, and this group comprises Troponin I (for example a kind of insect straight homologues of CG7178Dm albumen), support albumen (for example a kind of insect straight homologues of CG7107Dm albumen), tropomyosin 1 albumen (for example a kind of insect straight homologues of CG4898Dm albumen), tropomyosin 2 albumen (for example a kind of insect straight homologues of CG4843Dm albumen), myoglobulin heavy chain (for example a kind of insect straight homologues of CG17927Dm albumen), myosin light chain cytoplasm protein (for example a kind of insect straight homologues of CG3201Dm albumen), shark's fin melon albumen (for example a kind of insect straight homologues of CG3595Dm albumen), zipper protein (for example a kind of insect straight homologues of CG15792Dm albumen), TnC (CG2981 for example, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, a kind of insect straight homologues of CG12408 or CG6514Dm albumen)
In other embodiments, the present invention relates to a kind of disturbance ribonucleic acid (RNA), the expression that this disturbance ribonucleic acid works to lower the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when any in 270 to 273 compared best and compares, described nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when the respective segments in any in 270 to 273 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, in 270 to 273 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, any coded aminoacid sequence at least 85% in 270 to 273, preferably at least 90%, 95%, 98% or 99% is consistent.
In a preferred embodiment, target gene a kind of insect ribosomal protein of encoding, this insect ribosomal protein is selected from lower group, this group comprises ribosomal protein S3A (for example a kind of insect straight homologues of CG2168Dm albumen), ribosomal protein L P1 (for example a kind of insect straight homologues of CG4087Dm albumen), ribosomal protein S3 (for example a kind of insect straight homologues of CG6779Dm albumen), ribosomal protein L 10Ab (for example a kind of insect straight homologues of CG7283Dm albumen), ribosomal protein S1 8 (for example a kind of insect straight homologues of CG8900Dm albumen), ribosomal protein L 4 (for example a kind of insect straight homologues of CG5502Dm albumen), ribosomal protein S27 (for example a kind of insect straight homologues of CG10423Dm albumen), Ribosomal protein L6 (for example a kind of insect straight homologues of CG11522Dm albumen), ribosomal protein S1 3 (for example a kind of insect straight homologues of CG13389Dm albumen) and ribosomal protein L 12 (for example a kind of insect straight homologues of CG3195Dm albumen), ribosomal protein L 26 (for example a kind of insect straight homologues of CG6846Dm albumen), ribosomal protein L 21 (for example a kind of insect straight homologues of CG12775Dm albumen), ribosomal protein S1 2 (for example a kind of insect straight homologues of CG11271Dm albumen), ribosomal protein S28b (for example a kind of insect straight homologues of CG2998Dm albumen), ribosomal protein L 13 (for example a kind of insect straight homologues of CG4651Dm albumen), ribosomal protein L 10 (for example a kind of insect straight homologues of CG17521Dm albumen), ribosomal protein L 5 (for example a kind of insect straight homologues of CG17489Dm albumen), ribosomal protein S1 5Aa (for example a kind of insect straight homologues of CG2033Dm albumen), ribosomal protein L 19 (for example a kind of insect straight homologues of CG2746Dm albumen), ribosomal protein L 27 (for example a kind of insect straight homologues of CG4759Dm albumen)
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when any in 310 to 313 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when the respective segments in any in 310 to 313 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, in 310 to 313 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ 1D NO1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO141,11,12 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO141,11,12 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO141, 11, 12 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO141, 11, when any in 12 compared best and compares, described nucleotide sequence and SEQ ID NO141, 11, 12 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO141, 11, 12 or its complementary sequence in any nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO141, 11, when the respective segments in any in 12 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO141, 11, 12 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene have comprise SEQ ID NO141,11,12 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with in SEQ ID NO141,11,12 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO141,11,12, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO17,18 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO17,18 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have comprise SEQ ID NO17,18 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when any in the described gene that comprises described fragment and SEQ ID NO17,18 being compared best and relatively time, described nucleotide sequence and SEQ ID NO17,18 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have comprise SEQ ID NO17,18 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when the respective segments in any in described fragment and SEQ ID NO17,18 being compared best and relatively time, the described nucleotide sequence of described fragment and SEQ ID NO17,18 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene have comprise SEQ ID NO17,18 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with in SEQ ID NO17,18 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO17,18, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO19,20 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO19,20 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have comprise SEQ ID NO19,20 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when any in the described gene that comprises described fragment and SEQ ID NO19,20 being compared best and relatively time, described nucleotide sequence and SEQ ID NO19,20 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have comprise SEQ ID NO19,20 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when the respective segments in any in described fragment and SEQ ID NO19,20 being compared best and relatively time, the described nucleotide sequence of described fragment and SEQ ID NO19,20 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene have comprise SEQ ID NO19,20 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with in SEQ ID NO19,20 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO19,20, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO165,166,167 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO165,166,167 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO165, 166, 167 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO165, 166, when any in 167 compared best and compares, described nucleotide sequence and SEQ ID NO165, 166, 167 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO165, 166, 167 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO17, when the respective segments in any in 18 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO165, 166, 167 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene have comprise SEQ ID NO165,166,167 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, in the sequence that this straight homologues has and SEQ ID NO165,166,167 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO165,166,167, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO143,121,142,176,182,130,177,183 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO143,121,142,176,182,130,177,183 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO143, 121, 142, 176, 182, 130, 177, 183 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO143, 121, 142, 176, 182, 130, 177, when any in 183 compared best and compares, described nucleotide sequence and SEQ ID NO143, 121, 142, 176, 182, 130, 177, 183 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO143, 121, 142, 176, 182, 130, 177, 183 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO143, 121, 142, 176, 182, 130, 177, when the respective segments in any in 183 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO143, 121, 142, 176, 182, 130, 177, 183 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO143, 121, 142, 176, 182, 130, 177, 183 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has and SEQ ID NO 143, 121, 142, 176, 182, 130, 177, in 183 represented these sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO143,121,142,176,182,130,177,183, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO145,122,144,178,131,179 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO145,122,144,178,131,179 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO145, 122, 144, 178, 131, 179 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO145, 122, 144, 178, 131, when any in 179 compared best and compares, described nucleotide sequence and SEQ ID NO145, 122, 144, 178, 131, 179 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO145, 122, 144, 178, 131, 179 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO145, 122, 144, 178, 131, when the respective segments in any in 179 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO145, 122, 144, 178, 131, 179 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO145, 122, 144, 178, 131, 179 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has and SEQ ID NO145, 122, 144, 178, 131, in 179 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO145,122,144,178,131,179, preferably at least 90%, 95%, 98% or 99% is consistent.
In one embodiment, the present invention relates to a kind of disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species, wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with target gene in target nucleotide sequences complementary nucleotide sequence or consisting of, and this target gene wherein at least in part
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO128,149,184,137 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, in this nucleotide sequence and SEQ ID NO 128,149,184,137 or its complementary sequence any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO128, 149, 184, 137 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO128, 149, 184, when any in 137 compared best and compares, described nucleotide sequence and SEQ ID NO128, 149, 184, 137 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO128, 149, 184, 137 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO128, 149, 184, when the respective segments in any in 137 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO128, 149, 184, 137 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene have comprise SEQ ID NO128,149,184,137 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, in the sequence that this straight homologues has and SEQ ID NO128,149,184,137 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence and any the coded aminoacid sequence at least 85% in SEQ ID NO128,149,184,137, preferably at least 90%, 95%, 98% or 99% is consistent.
In other embodiment again, the present invention relates to a kind of disturbance ribonucleic acid (RNA or double-stranded RNA), the expression that its suppresses or lowers a kind of target gene, this target gene a kind of mitochondrial cytochrome c oxidase subunit II albumen (for example a kind of insect straight homologues of CG34069Dm albumen) of encoding.
Therefore, in one aspect, the invention provides a kind of disturbance ribonucleic acid (RNA), it plays the effect of the expression of lowering the target gene in described insect pest after being taken in by insect pest species.
As used in this, " target gene " comprises any gene that intention is lowered in insect.In a preferred embodiment, lower target gene with for example by destroying the essential bioprocess occurring in insect, or by reducing the pathogenic of insect, carry out Control pests invasion.Therefore, preferred target gene include, but is not limited to ingest in regulation and control, survive, growth, growth, reproduction, invade and harass and infect aspect those genes of performance keying action.According to an embodiment, this target gene makes when its expression is lowered or be suppressed, and insect pest is killed.According to another embodiment, this target gene makes, when its expression is lowered or be suppressed, to stop or delay or hinder or postpone or hindered the growth of insect, has stoped insect reproduction, or has stoped insect to change by life cycle.According to still another embodiment of the invention, this target gene makes to express and to be lowered or when suppressed when it, and the infringement being caused by insect and/or insect are infected or the ability of invading and harassing environment, surface and/or plant or crop species reduces; Or insect stops ingesting from its natural food resource (as plant and plant product).Term " is invaded and harassed (infest) " and " infecting (infect) " or " invading and harassing (infestation) " and " infecting (infection) " used interchangeably in the whole text generally.
These target genes can be expressed in all or some of insect pest cell.In addition, these target genes can be only expressed by it in the specified phase of the life cycle of insect pest, for example ripe adult stage, immature nymph or larval stage or the avette phase.
As used herein, " insect " species preferably cause and infect or invade and harass, and preferably cause the insect species that infects or invade and harass of plant.Insect species can comprise and belongs to following object species: Coleoptera, lepidopteran, Diptera, Dictyoptera, Orthoptera, Hemiptera or Siphonaptera.
Preferred plant pathogenic insect according to the present invention is to be selected from the plant insect of lower group, and this group is comprised of the following: colorado potato beetles belong to (Leptinotarsa spp.) (for example colorado potato beetles (L.decemlineata) (Colorado colorado potato bug), pseudo-colorado potato beetles (L.juncta) (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (L.texana) (the pseudo-colorado potato bug in Texas)); Brown paddy plant hopper belongs to (Nilaparvata spp.) (for example brown paddy plant hopper (N.lugens) (brown plant hopper)); Small brown rice planthopper belongs to (Laodelphax spp.) (for example small brown rice planthopper (L.striatellus) (the little plant hopper of brown)); Rice green leafhopper belongs to (Nephotettix spp.) (for example nephotettix bipunctatus (N.virescens) or rice green leafhopper (N.cincticeps) (green leafhopper) or two rice green leafhoppers (N.nigropictus) (rice leafhopper)); Sogatella (Sogatellaspp.) (for example white backed planthopper (S.furcifera) (white backed planthopper)); Straw borer spp (Chilo spp.) (for example striped rice borer (C.suppressalis) (rice-stem borer), goldrimmed moth (C.auricilius) (gold thread striped rice borer) or rice Dolly snout moth's larva (C.polychrysus) (blackhead stem snout moth's larva)); Moth stem Noctua (Sesamia spp.) (for example pink rice borer (S.inferens) (pink rice borer)); Moth standing grain snout moth's larva belongs to (Tryporyza spp.) (for example white snout moth's larva of rice (T.innotata) (white rice borer) or yellow rice borer (T.incertulas) (yellow rice borer)); Flower resembles genus (Anthonomus spp.) (for example anthonomus grandis (A.grandis) (boll weevil)); Phaedon (Phaedon spp.) (for example horseradish ape chrysomelid (P.cochleariae) (the chrysomelid worm of leaf mustard)); Epilachna genus (Epilachna spp.) (for example mexican bean ladybird (E.varivetis) (Mexico beans beetle)); Tribolium (Tribolium spp.) (for example red flour beetle (T.castaneum) (red floor beetle)); (for example west Zea mays root firefly chrysomelid (D.virgifera virgifera) (west corn rootworm), Pasteur's root firefly chrysomelid (D.barberi) (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (D.undecimpunctata howardi) (southern corn rootworm), zea mexicana root firefly chrysomelid (D.virgifera zeae) (zea mexicana rootworm) to root Galeruca (Diabrotica spp.); Ostrinia spp (Ostrinia spp.) (for example European corn borer (O.nubilalis) (European corn borer (European corn borer))); Slow-witted Thrips (Anaphothrips spp.) (for example slow-witted thrips (A.obscrurus) (careless thrips) of maize); Pectinophora gossypiella belongs to (Pectinophora spp.) (for example pink bollworm (P.gossypiella) (pink bollworm)); Heliothis (Heliothis spp.) (for example Heliothis virescens (H.virescens) (tobacco aphid)); Aleyrodes (Trialeurodes spp.) (for example line wing aleyrodid (T.abutiloneus) (knot wing aleyrodid), Trialeurodes vaporariorum Westwood (T.vaporariorum) (greenhouse whitefly)); Little Aleyrodes (Bemisia spp.) (for example Bemisia argentifolii (B.argentifolii) (silver leaf trialeurodes vaporariorum)); Aphis (Aphis spp.) (for example cotten aphid (A.gossypii) (cotton aphid)); Lygus bug belongs to (Lygus spp.) (for example tarnished plant bug (L.lineolaris) (without damp fleahopper) or beanpod lygus bug (L.hesperus) (west is without damp fleahopper)); America stinkbug belongs to (Euschistus spp.) (for example spot America stinkbug (E.conspersus) (consperse stinkbug)); Chlorochroa (for example helping Jing Shi stinkbug (C.sayi) (assistant Jing Shi stinkbug (Say stinkbug))); Bemisia spp (Nezara spp.) (for example Nezara viridula smaragdula Fabricius. (N.viridula) (southern green stinkbug)); Thrips (Thrips spp.) (for example onion thrips (T.tabaci) (onion thrips)); Flower thrips belongs to (Frankliruella spp.) (for example tobacco brown thrip (F.fusca) (onion thrips) or Frankliniella occidentalis (F. occidentalis) (Frankliniella occidentalis)); Cricket spp (Acheta spp.) (for example acheta domestica (A.domesticus) (indoor cricket)); Tumor aphid genus (Myzus spp.) (for example black peach aphid (Mpersicae) (green black peach aphid)); Long tube Aphis (Macrosiphum spp.) (for example potato aphid (M euphorbiae) (potato aphid)); Soil chinch bug belongs to (Blissus spp.) (for example China bug (B.leucopterus leucopterus) (chinch bugs)); Intend coried and belong to (Acrosternum spp.) (for example intending green stinkbug (A.hilare) (green stinkbug)); Rice borer belongs to (Chilotraea spp.) (for example rice Dolly snout moth's larva (C.polychrysa) (purplish stem borer)); Rice water resembles genus (Lissorhoptrus spp.) (for example rice water weevil (L.oryzophilus) (rice water weevil)); Rhopalosiphum (Rhopalosiphum spp.) (for example corn leaf aphids (R.maidis) (corn tree louse)); And rounded tail Aphis (Anuraphis spp.) (for example corn root aphid (A.maidiradicis) (corn root aphid)).
According to embodiment more specifically, the present invention is applicable to the species that belong to Chrysomelidae or leaf Staphylinidae.Leaf beetle section beetle (as Colorado colorado potato bug, flea beetle, corn rootworm) and Curculionidae (as clover weevil) are the insects of particularly important.The specific colorado potato beetles species of controlling according to the present invention comprises Colorado colorado potato bug (colorado potato beetles) and pseudo-colorado potato bug (pseudo-colorado potato beetles).CPB be for our domestic potato, other cultivations with wild with stem tuber and not with the potato species of stem tuber and other Solanums (nightshade) plant species a class (serious) insect, these species comprise crop species tomato, eggplant, pepper, tobacco (Nicotiana species, comprise ornamental plant), ground-cheery, paddy rice, corn or cotton; And weeds/medicinal herbs species, Carolina eggplant, common nightshade, thorn apple, Semen Hyoscyami and thorn calyx eggplant.Corn rootworm is included in the species (for example cucumber 11 asterophyllite first (D.undecimpunctata undecimpunctata), cucumber 11 asterophyllite first food root subspecies, long angle cucumber beetle (D.longicornis), west corn may-bug (D.virgifera) and cucumber strip chrysomelid (D.balteata)) of finding in root Galeruca.Corn rootworm is to corn and the melon extensive damage that caused.
According to an embodiment more specifically, the present invention is applicable to the species that belong to Hemiptera (Aphidoidea), as black peach aphid (green black peach aphid, black bean aphid (Aphis fabae) (black soya bean aphid), acyrthosiphum pisim (Acyrthosiphum pisum) (pea aphid), brevicoryne brassicae (Brevicoryne brassicae) (cabbage aphid), grain aphid (Sitobion avenae) (grain aphid), dust two tail aphids (Cavariella aegopodii) (Radix Dauci Sativae aphid), bean aphid (Aphis craccivora) (Semen arachidis hypogaeae aphid), cotten aphid (Aphis gossypu) (cotton aphid), black citrus aphid (Toxoptera aurantii) (black citrus aphid), two tail Aphis (Cavariella spp) (willow louse), hair Aphis (Chaitophorus spp) (willow leaf aphid), considerable large Aphis (Cinara spp.) (black pine aphid), the long sickle pipe of maple aphid (Drepanosiphum platanoides) (Platanus occidentalis aphid), high Aphis (Elatobium spp) (Spruce budworm), they cause damage to following plant: as Prunus tree, particularly peach, apricot and Japanese plum, the main tree of cultivating for the production of timber, as willow and white poplar, row crop, as corn, cotton, soya bean, wheat and paddy rice, Solanaceae, Chenopodiaceae, composite family, Cruciferae and vegetable crop cucurbitaceous, include, but is not limited to choke, asparagus, Kidney bean, beet, cabbage, brussels sprouts, wild cabbage, Radix Dauci Sativae, Cauliflower, muskmelon, celery, corn, cucumber, sweet fennel, kale, black salted turnip, turnip, eggplant, lettuce, leaf mustard, gumbo, parsley, parsnip, pea, pepper, potato, radish, spinach, pumpkin, tomato, turnip, watercress and watermelon, or field crop, as (but being not limited to) tobacco, sugar beet and Sunflower Receptacle, flowers crop or other ornamental plants, as pine tree and softwood tree.Other hemipterans belong to brown paddy plant hopper and belong to (for example brown paddy plant hopper, white backed planthopper) and rice plants is caused damage.Other hemipterans belong to other plant-feed insect species that lygus bug belongs to (for example beanpod lygus bug, the lygus bug that becomes mildewed (Lygus rugulipennis), tarnished plant bug, Lygus sully) and Miridae, and following plant is caused damage: draw cotton, potato plants, strawberry, cotton, clover, Kano, peach, Japanese plum, grapevine, lettuce, eggplant, onion, green soya bean.Some Mediterranean Sea tree and somely view and admire tree too, as elm (Elm (Ulmus spp.)), pinenut (Italian umbrella loose (Pinus Pinea)), London plane (two ball plane trees (Platanus Acerifolia)), trillium chaste tree (Malus alba)).Other hemipterans belong to Pentatomiddae, they are commonly referred to as shield worm, look into this special smell worm (chust bug) and stinkbug (brown marble grain stinkbug (tea wing stinkbug (Halyomorpha halys)) for example, consperse stinkbug (spot America stinkbug), south green stinkbug (Nezara viridula smaragdula Fabricius. (Nezara viridula)), the red stinkbug of forest (the true stinkbug of red foot (Pentatoma rufipes)), harlequin bug (harlequin bug (Murgantia histrionica)), rice stinkbug (America rice stinkbug (Oebalus pugnax))) and the following is caused damage: fruit, comprise apple, peach, Fructus Fici, Sang mulberry, citrus fruits and persimmon, blackberry, blueberry, and vegetables, comprise sweet corn, tomato, soybean, lima bean and green pepper, wild cabbage, Cauliflower, turnip, horseradish, kale (collard), leaf mustard, brussels sprouts, potato, eggplant, gumbo, Kidney bean, asparagus, beet, weeds, fruit tree, and field crop, for example field corn and soybean.Stinkbug is also a kind of insect of grass, Chinese sorghum and paddy rice.
There are the plant or the transgenic plant according to the present invention that are ready to use in method of the present invention to contain any plant, but the kind of plant to the invasion sensitivity of plant pathogenic insect preferably.
Therefore, the present invention expands to plant as the described herein and method, and wherein this plant is selected from the group of following plant (or crop): clover, apple, apricot, choke, asparagus, avocado, banana, barley, Kidney bean, beet, blackberry, blueberry, blueberry, Caulis et Folium Brassicae capitatae, brussels sprouts, wild cabbage, draw Kano, Radix Dauci Sativae, cassava, Cauliflower, cereal, celery, cherry, citrus, the little oranges and tangerines of Ke Laimenshi (clementine), coffee, corn, cotton, cucumber, eggplant, witloof, eucalyptus, Fructus Fici, grape, natsudaidai, Semen arachidis hypogaeae, ground-cheery, kiwi fruit, lettuce, leek, lemon, bitter orange, pine tree, Zea mays, mango, muskmelon, grain, mushroom, nut oat, gumbo, onion, orange, ornamental plant or flowers or tree, papaya, parsley, pea, peach, peanut, pea (peat), pepper, persimmon, pineapple, psyllium, plum, pomegranate, potato, pumpkin, witloof, radish, Semen Brassicae campestris, raspberry, paddy rice, rye, Chinese sorghum, soya bean, soybean, spinach, strawberry, sugar beet, sugarcane, Sunflower Receptacle, sweet potato, orange, tea, tobacco, tomato, vine, watermelon, wheat, Chinese yam and little summer squash.
In a particular embodiment, the invention provides target gene, these target genes coding relates to wings up A (Troponin I), mitochondrial cytochrome c oxidase subunit II albumen or as the protein of the function of a kind of ribosomal protein specified in table 1.
In a preferred embodiment, the invention provides target gene, these target genes are selected from the group of following gene, and these genes (i) have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20,63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (ii) have the NO1 by SEQ ID, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149,184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in a kind of nucleotide sequence of any composition, or (iii) there is the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309,318 to 321, 386, 387, 388, 389 or its complementary series in any one at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of nucleotide sequence of the fragment of 2000 or 3000 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1,174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (iv) have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176,182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any one at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of nucleotide sequence of the fragment of 2000 or 3000 continuous nucleotides, and wherein work as described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213,290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162,164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (v) have a kind of nucleotide sequence of a kind of amino acid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this amino acid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded amino acid sequence at least 70% in 389, preferably at least 75%, 80%, 85%, 90%, 95%, 98% or 99% is consistent,Or (vi) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20,63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 178, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, in 389 represented sequences any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent,
And the nucleotide sequence of wherein said gene is no longer than 10000,9000,8000,7000,6000,5000,4000,3000,2000 or 1500 Nucleotide.
By the coded aminoacid sequence of target gene of the present invention by SEQ ID NO79,349,352,356,80,326,81,327,82,83,328,84,329,85,86,359,87 to 91,330,350,353,331,351,332 to 336,337,354,338 to 344,346,345,347,348,357,355,358,390 represented to 393.
As used herein, term " has " with " comprising " and has an identical meanings.
As used in this, term " sequence identity " is for describing the sequence relation between two or more Nucleotide or aminoacid sequence." sequence identity " per-cent between two sequences is to measure by compare the sequences of two best comparisons in a comparison window (position of restricted number), insertion or disappearance (that is, breach) that wherein the part of the sequence in this comparison window can comprise as compared with canonical sequence are compared to realize the best.Sequence identity per-cent is to calculate in the following manner: be determined at the number of the position that occurs consistent nucleotide base or amino-acid residue in two sequences to obtain the number of ' coupling ' position, with the number of matched position, divided by the total number of positions in comparison window and result, be multiplied by 100.For measuring method and the software of sequence identity, be obtainable in the art and comprise Blast software and GAP analysis.For nucleic acid, preferably by BlastN comparison instrument, calculate consistence per-cent, rely on this comparison instrument to calculate the consistence per-cent in the total length of the nucleotide sequence of inquiring.
Those of ordinary skill in the art will recognize, can identify the NO1 by SEQ ID, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, the homologue of any the represented target gene in 389 or straight homologues (being present in the homologue in different plant species).These insect homologues and/or straight homologues are also within the scope of the invention.Preferred homologue and/or straight homologues are some such genes, and they make when comparing best and compare two kinds of genes at the similarity degree aspect nucleotide sequence, the sequence that this homologue and/or straight homologues have and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80% or 85%, more preferably at least 90% or 95%, and most preferably consistent at least about 99%.Similarly, same preferred homologue and/or straight homologues are some such protein, they make when comparing best and compare two seed amino acid sequences at the similarity degree aspect aminoacid sequence, the sequence that this homologue and/or straight homologues have and SEQ ID NO79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87 to 91, 330, 350, 353, 331, 351, 332 to 336, 337, 354, 338 to 344, 346, 345, 347, 348, 357, 355, 358, in 390 to 393 any at least 75%, preferably at least 80% or 85%, more preferably at least 90% or 95%, and most preferably consistent at least about 99%.
Other homologues are some such genes, and they are to comprise as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, the allelotrope of the gene of any the represented sequence in 389.Other preferred homologues are than comprising as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, the gene of any the represented sequence in 389, the gene that comprises at least one single nucleotide polymorphism (SNP).
' disturbance ribonucleic acid (RNA) ' of the present invention contained the RNA molecule that can make the down-regulated expression of target gene or any type of ' silence ', included, but is not limited to adopted RNA, sense-rna, short interfering rna (siRNA), Microrna (miRNA), double-stranded RNA (dsRNA), hairpin RNA (RNA) etc.Method for measurement function disturbance RNA molecule is well-known in the art and is disclosed in the elsewhere at this.
Disturbance RNA molecule of the present invention is realized the sequence-specific of expression of target gene and is lowered by being incorporated into target nucleotide sequences in target gene.It in conjunction with the reason occurring, is the base pairing between the complementary district of RNA interfering and target nucleotide sequences.As used in this, term ' silencing elements ' refer to comprise with target gene in target nucleotide sequences complementary or at least in part complementary nucleotide sequence or consisting of part or the region of RNA interfering, and the downward of described expression of target gene is worked to instruct in this part or region as the active part of RNA interfering.In one embodiment of the invention, this silencing elements comprise with target gene in target nucleotide sequences complementation there are at least 17 continuous nucleotides, preferred at least 18 or 19 continuous nucleotides, more preferably at least 21 continuous nucleotides, even more preferably the sequence of at least 22,23,24 or 25 continuous nucleotides or consisting of.
As used in this, " expression of target gene " refers to that transcribing of the rna transcription thing of being encoded by target gene and accumulation and/or mRNA translate into protein.Term ' downward ' refers to disturbance RNA molecule so as to reducing any in oneself method known of this area of elementary rna transcription thing, mRNA or the protein level produced by target gene.In certain embodiments, lower the RNA refer to so as to making to be produced by a kind of gene or the level of protein and reduce at least 10%, preferably at least 33%, more preferably at least 50%, more preferably a kind of situation of at least 80% again.In particularly preferred embodiment, downward refers to for example, to be compared as the insect pest with suitable control (be not yet exposed to RNA interfering or be exposed to the insect pest of the disturbance RNA molecule contrasting), at least 80% of the RNA being produced by a kind of gene in insect pest cell or the level of protein, preferably at least 90%, more preferably at least 95%, and most preferably at least 99% reduction.Method for detection of the reduction of RNA or protein level is well-known in the art, and comprises RNA solution hybridization, Northern hybridization, reverse transcription (for example quantitative RT-PCR analysis), microarray analysis, antibodies, enzyme-linked immunosorbent assay (ELISA) and Western trace.In another embodiment of the present invention, lower the insect control referring to as with suitable and compare, RNA or protein level are reduced to the detectable variation that is enough to cause insect phenotype, stop etc. such as necrocytosis, growth.Therefore, can use the routine techniques in this area, by the phenotype analytical of insect pest, measure downward.
In a preferred embodiment of the invention, RNA interfering is disturbed by RNA or RNAi carrys out down-regulation of gene expression.RNAi is a kind of sequence-specific gene regulating method typically being mediated by double stranded rna molecule (as short interfering rna (siRNA)).One of comprising by annealing with sense-rna chain complementary base pairing of siRNA has adopted RNA chain.The sense strand of siRNA molecule or ' guiding chain ' comprise and the nucleotide sequence of nucleotide sequence complementation that is positioned at the rna transcription thing of target gene.Therefore, the sense strand of siRNA can be annealed by (Waston-Crick-type) base pairing of Wo Sen-Ke Rieke type and rna transcription thing, and this RNA of target to degrade within being called RNAi and inducing the cell complexes of reticent mixture or RISC.Therefore, the in the situation that of preferred disturbance RNA molecule of the present invention, if silencing elements mentioned herein can be the double stranded region of the complementary strand that comprises annealing, wherein at least one chain comprise with target gene in target nucleotide sequences complementary or at least in part complementary nucleotide sequence or consisting of.In one embodiment, this double stranded region has the length of at least 21,22,23,24,25,30,35,40,50,55,60,70,80,90,100,125,150,175,200,300,400,500,600,700,800,900,1000,1100,1200,1300,1400,1500,2000 or 3000 base pairs.
Also considered within the scope of the invention longer double-stranded RNA (dsRNA) molecule, these molecules comprise one or more as this described functional double-stranded silencing elements of elsewhere and can there is the gene silencing of RNAi mediation.The dsRNA molecule that this class is longer comprises at least 80,200,300,350,400,450,500,550,600,700,800,900,1000,, 100,1200,1300,1400,1500,2000 or 3000 base pairs.These dsRNA molecules can serve as the precursor of active siRNA molecule, these active siRNA molecules guiding rna transcription things to RISC mixture to carry out degraded subsequently.Be present in dsRNA molecule in organism or its pericellular environment could absorb and be called as Dicer enzyme by organism and process to obtain siRNA molecule.Alternately, dsRNA can produce in vivo, for example, by one or more polynucleotide that are present in this dsRNA of coding in cell (bacterial cell or vegetable cell), transcribed, and after having taken in longer precursor dsRNA, then by processing at the intracellular Dicer of insect pest in host cell or preferably.Two independent (sense and antisense) RNA chain formation that this dsRNA can anneal by matching by means of complementary base.Alternately, dsRNA can be a strand, and it can self be folded to form hairpin RNA (RNA) or loop-stem structure again.In the situation of a RNA, double stranded region or ' stem ' are to be formed by two regions of this RNA or section, and these regions or section are inverted repeats each other substantially and have enough complementarity to allow to form a double stranded region.In this ' stem region ' of this molecule, can there are one or more functional double-stranded silencing elements.Inverted repeat region is typically called ‘Huan’ district region or section in RNA separate.This region can comprise any nucleotide sequence of enough flexibilities with permission oneself pairing of generation between the flank complementary region of RNA of giving.In general ，Gai Huan district be in fact strand and serve as the spacer element between inverted repeats.
All disturbance RNA molecules of the present invention are realized the sequence-specific of expression of target gene and are lowered by being incorporated into target nucleotide sequences in target gene.In conjunction with the reason occurring, be silencing elements and the pairing of the complementary base between target nucleotide sequences of RNA interfering.Disturbance RNA molecule of the present invention comprises at least one or at least two silencing elements.In one embodiment of the invention, this target nucleotide sequences comprises nucleotide sequence or its fragment as represented in the rna transcription thing by target gene, this fragment at least 17 Nucleotide preferably wherein, more preferably at least 18, 19 or 20 Nucleotide, or most preferably at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, , 100, 1200, 1300, 1400, 1500, 2000 or 3000 Nucleotide.In a preferred embodiment of the invention, target nucleotide sequences comprises a kind of nucleotide sequence being equivalent to by the coded rna transcription thing of any polynucleotide that is selected from lower group, and this group is comprised of the following: (i) comprise as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence at least 21 of any represented a kind of nucleotide sequence, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, a kind of polynucleotide of 1100 or 1115 continuous nucleotides, or (ii) by as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence at least 21 of any represented a kind of nucleotide sequence, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 a kind of polynucleotide that continuous nucleotide forms,
Or (iii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of nucleotide sequence, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide of 2000 or 3000 continuous nucleotides, make when comparing best and compare two kinds of sequences described polynucleotide and SEQ ID NO1 thus, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (iv) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of Nucleotide, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide of the fragment of 2000 or 3000 continuous nucleotides, and wherein said fragment or described complementary sequence have a kind of nucleotide sequence so that when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent,
Or (v) by as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any at least 21 of represented a kind of Nucleotide, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotide that the fragment of 2000 or 3000 continuous nucleotides forms, and wherein said fragment or described complementary sequence have a kind of nucleotide sequence, when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (vi) encode a kind of a kind of polynucleotide of aminoacid sequence, when comparison best and relatively during two seed amino acid sequences, and this aminoacid sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 70% in 389, preferably at least 75%, 80%, 85%, 90%, 95%, 98% or 99% is consistent.In an above preferred embodiment, described polynucleotide are no longer than 10000,9000,8000,7000,6000,5000,4000,3000,2000 or 1500 Nucleotide.
Preferably, disturbance RNA molecule of the present invention comprises at least one double stranded region, the silencing elements of this RNA interfering typically, it comprises has an adopted RNA chain by what anneal with sense-rna chain complementary base pairing, and wherein the sense strand of dsRNA molecule comprises and the nucleotide sequence of nucleotide sequence complementation that is positioned at the rna transcription thing of target gene.
Silencing elements or its at least one chain (when silencing elements is two strands) can be fully complementary or partly complementary with the target nucleotide sequences of target gene.As used in this, all bases that term " fully complementary " means silencing elements nucleotide sequence all with base complementrity or ' coupling ' of target nucleotide sequences.Term " at least in part complementary " means existence between the base of silencing elements and the base of target nucleotide sequences and is less than 100% mate.It will be apparent to one skilled in the art that in order to mediate the downward of expression of target gene, silencing elements only needs with target nucleotide sequences complementary at least in part.Known in the art, the RNA sequence with respect to target sequence with insertion, disappearance and mispairing is still can be effective aspect RNAi.According to the present invention, preferably, the sequence identity of the target nucleotide sequences total at least 80% or 85% of silencing elements and target gene, preferred at least 90% or 95% sequence identity, or more preferably at least 97% or 98% sequence identity and more more preferably at least 99% sequence identity.Alternately, at 24, partly in each length of complementary Nucleotide, as compared with target nucleotide sequences, silencing elements can comprise 1,2 or 3 mispairing.
Those of ordinary skill in the art will understand, and between silencing elements and target nucleotide sequences, total complementary degree can depend on and needs the target gene lowered or depend on genetic expression to have insect pest species to be controlled and change.
In another embodiment of the present invention, silencing elements comprises a kind of nucleotide sequence, and this nucleotide sequence is the RNA equivalent that is selected from any polynucleotides of lower group, and this group is comprised of the following: comprise as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series at least 21 of any represented a kind of nucleotide sequence, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, , a kind of polynucleotides of 100 or 1115 continuous nucleotides, or (ii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175,181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any at least 21 of represented a kind of nucleotide sequence, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, a kind of polynucleotides of 2000 or 3000 continuous nucleotides, make when comparing best and compare two kinds of sequences described polynucleotides and SEQ ID NO1 thus, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139,5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, or (iii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 1121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179,210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary series in any at least 21 of represented a kind of nucleotides, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, , 100, 1200, 1300, 1400, 1S00, a kind of polynucleotides of the fragment of 2000 or 3000 continuous nucleotides, and wherein said fragment or described complementary series have a kind of nucleotide sequence so that when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133,218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168,170,169,274 to 277,172,173,278 to 281,200,201,314 to 317,186,202,187,203,306 to 309,318 to 321,386,387,388,389 or its complementary series in any described respective segments at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% is consistent, and wherein said polynucleotides are no longer than 10000,9000,8000,7000,6000,5000,4000,3000,2000 or 1500 nucleotides.Should be appreciated that, in such embodiments, silencing elements can comprise a double-stranded RNA region or consisting of, the complementary strand of this district inclusion annealing, a chain wherein, i.e. sense strand, comprise with target gene in target nucleotide sequences complementary nucleotide sequence at least in part.
Target nucleotide sequences can be selected from any appropriate area or the nucleotide sequence of target gene or its rna transcription thing.For instance, target nucleotide sequences can be positioned at 5UTR or the 3UTR of target gene or rna transcription thing, or in the exon of gene or intron region.
Those skilled in the art knows the method for identifying most suitable target nucleotide sequences under total length target gene background.For instance, can the multiple silencing elements of target target gene different zones be synthesized and be tested.Alternately, with can be used to determine the site of the upper conformation of RNA to gene silencing sensitivity as enzymic digestion rna transcription things such as RNAse H.Target site also can be used computer simulation (in silico) method, for example, by the different loci being designed to based in target full-length gene, come the computerized algorithm of the reticent effect of predicted gene to identify.
RNA interfering of the present invention can comprise a silencing elements or a plurality of silencing elements, wherein each silencing elements comprise with target gene in target nucleotide sequences at least in part complementary nucleotide sequence or consisting of, and after being taken in by insect pest species, play the effect of the expression of lowering described target gene.Be combined in by reference in this WO2006/046148 and described such concatermer RNA construct.In the context of the present invention, term ' a plurality of ' means at least two, and at least three, at least four grades and until at least 10,15,20 or at least 30.In one embodiment, a plurality of copies that RNA interfering comprises single silencing elements, are incorporated into the repetition of the silencing elements of an intragenic particular target nucleotide sequence of particular target.In another embodiment, the silencing elements in RNA interfering comprise from the different IPs nucleotide sequence of different target nucleotide sequences complementations or consisting of.The combination that is noted that a plurality of copies of the identical silencing elements combining from the silencing elements that is incorporated into different target nucleotide sequences is within the scope of the invention.
In order to realize the improvement of the downward of particular target gene in insect pest species, different target nucleotide sequences can derive from the single target gene in a kind of insect pest species.In this case, the original order combination that silencing elements can exist by target nucleotide sequences in RNA interfering in target gene, or as compared with the order of target nucleotide sequences in target gene, silencing elements can be upset and combine randomly by any rank order in the environment of RNA interfering.
Alternately, different target nucleotide sequences are representing single target gene, but derive from different insects pest species.
Alternately, different target nucleotide sequences can derive from different target genes.If RNA interfering is invaded and harassed for prevention and/or Control pests, so preferably, different target genes are the groups of gene that are selected from the essential biological function of regulation and control insect pest species, and these biological functions include, but is not limited to survival, growth, growth, reproduction and pathogenic.Target gene can regulate and control identical or different biological approach or process.In one embodiment, at least one silencing elements comprise with target gene in target nucleotide sequences at least in part complementary nucleotide sequence or consisting of, wherein this target gene is selected from the group of gene as described in more early.
In another embodiment of the present invention, the different genes by different silencing elements targets derives from identical insect pest species.This method is designed to realize the attack for the enhancing of single insect pest species.Specifically, different target genes can be in the different steps of insect life cycle, and for example ripe adult stage, immature larval stage and the avette phase differentially expresses.Therefore, RNA interfering of the present invention can be for more than one prevention and/or the invasion of control insect pest in the stage in insect life cycle.
In an alternate embodiment of the present invention, by the different genes of different silencing elements targets, derive from different insect pest species.Therefore, RNA interfering of the present invention can be for prevent and/or control the invasion of more than one insect pest species simultaneously.
Silencing elements can be arranged to a successive zone of RNA interfering or can be separated by the existence of joint sequence.Joint sequence can comprise not the short random nucleotide sequence with any target nucleotide sequences or target gene complementation.In one embodiment, this joint is conditionality self-cleaving RNA sequences, preferably pH susceptibility joint or hydrophobic susceptibility joint.In one embodiment, this joint comprises the nucleotide sequence with intron sequences equivalence.The length of joint sequence of the present invention can from approximately 1 base pair in the scope of approximately 10000 base pairs, its condition is that this joint can not weaken the ability that RNA interfering is lowered the expression of target gene.
Except these one or more silencing elements and any joint sequence, RNA interfering of the present invention can also comprise at least one other polynucleotide sequence.In different embodiments of the invention; this other sequence is selected from (i) and can protects RNA interfering to avoid the sequence of RNA processing; (ii) affect the sequence of the stability of RNA interfering; (iii) allow protein bound for example to promote RNA interfering by the sequence of the cellular uptake of insect pest species; (iv) promote the extensive sequence that produces RNA interfering; (v) as being incorporated into acceptor or being incorporated into molecule on the insect pest cell surface fit sequence to promote to take in, or (v) processing of RNA interfering strengthen thus the sequence of the effect of RNA interfering in catalysis insect pest cell.For strengthening the structure of the stability of RNA molecule, be well-known in the art and further describe at W02006/046148, this case is combined in this by reference.
The length of RNA interfering of the present invention need to be enough to by the cellular uptake of insect pest species and the target gene in insect is lowered, as described in the elsewhere at this.Yet the upper limit of length can depend on (i) RNA interfering, and by the requirement of insect cellular uptake with (ii), RNA interfering is processed to pass through the requirement of RNAi approach mediated gene silencing in insect cell.Also can to the preparation of cell, formulate length by production method with for sending RNA interfering.Preferably, the length of RNA interfering of the present invention will be between 21 and 10000 Nucleotide, and preferably, between 50 and 5000 Nucleotide or between 100 and 2500 Nucleotide, more preferably length is between 80 and 2000 Nucleotide.
The non-natural skeleton that this RNA interfering can comprise DNA base, non-natural base or sugar-phosphoric acid skeleton connects or modifies, for example, to strengthen the stability between the shelf lives or to strengthen the resistance to nuclease degradation.In addition, this RNA interfering can be by those of ordinary skill in the art by producing manually or automatically reactive chemistry ground or enzymatic.Alternately, this RNA interfering can be transcribed by its polynucleotide of coding.Therefore, at this, any a kind of polynucleotide of separation of encoding in RNA interfering of the present invention are provided.
In this further provides an isolated polynucleotide , the polynucleotide selected from the group consisting of the group consisting of the following : (I) comprising as indicated by SEQ ID NO1, 174,180,188,2, 175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6,35 to 38,140,7,8,39 to 42 , 9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62 , 19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 301,145,122,144,178,131,179,210 to 293,123,132,214 to 217,124,133,218 to 221,146,125 , 134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257,158,159,258 to 261,160,161,262 to 265 , 163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173,278 to 281,200,201,314 into 317,186,202 , 187,203,306 to 309,318 to 321,386,387,388,389 or a complementary sequence of any one of the nucleotide sequence represented by at least 21 , preferably at least 22, 23 , 25,26,27,28,29,30,35,40,45,50,55,60,70,80,90,100,110,125,150,175,200,225,250,300,350 , 400,450,500,550,600,700,800,900,1000,1100,1200,1300,1400,1500,2000 or 3000 contiguous nucleotides of a polynucleotide , or (ii) as indicated by the SEQ, IDNO, 1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6 , 35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121 , 142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 301,145,122,144,178,131,179,210 to 293,123,132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185 , 234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257,158 , 159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170 , 169,274 to 277,172,173,278 281,200,201,314 to the complementary sequence of any one or to 309,318 to 317,186,202,187,203,306 321,386,387,388,389 a nucleotide represented by a sequence of at least 21 , preferably at least 22,23,24,25,26,27,28,29,30,35,40,45,50,55,60,70,80,90,100,110,125 , 150,175,200,225,250,300,350,400,450,500,550,600,700,800,900,1000,1100 or 1115 consecutive nucleotides of a polynucleotide , or ( iii) contains as in SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 34,139 to 313,3,4,31 , 5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16 , 205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78 , 143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 293,123 to 301,145,122,144,178,131,179,210 , 132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184 , 137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257,158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172 , 281,200,201,314 to 173,278 to 309,318 to 317,186,202,187,203,306 321,386,387,388,389 or complementary to any one of the sequences represented in the 21 at least one nucleotide sequence ,Preferably at least 22,23,24,25,26,27,28,29,30,35,40,45,50,55,60,70,80,90,100,110,125,150,175,200 , 225,250,300,350,400,450,500,550,600,700,800,900,1000,1100 or 1115 consecutive nucleotides of a polynucleotide , or (iii) as contained in SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58 , 322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121,142 , 176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 301,145,122,144,178,131,179,210 to 293,123,132,214 to 217 , 124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 into 257,158,159 , 258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173,278 to 281 , 200,201,314 to 309,318 to 317,186,202,187,203,306 321,386,387,388,389 to any one of the nucleotide sequence or a complementary sequence as represented in at least 21 , preferably at least 22, 23 or 24,25,26,27,28,29,30,35,40,45,50,55,60,70,80,90,100,110,125,150 , 175,200,225,250,300,350,400,450,500,550,600,700 , 800,900,1000,1100,1200,1300,1400,1500,2000 or 3000 contiguous nucleotides a polynucleotide , thereby optimally than when comparing the two sequences and the polynucleotide SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46 , 141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66 , 21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 301,145,122,144,178,131,179,210 to 213,290 to 293,123,132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147 , 126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257,158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173,278 to 281,200,201,314 to 317,186,202,187,203,306 to 309 , 321,386,387,388,389 or 318 to any one of the complementary sequence of at least 75% , preferably at least 80% , 85% , 90% , 95% , 98% or 99 % identical, or (iv) contain as in SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6 35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121 , 142,176,182,130,177,183,206 to 209,286 to 289,298 to 301,145,122 , 144,178,131,179,210 to 213,290 to 293,123,132 , 214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137 , 185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257 , 158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173 , 278 to 281,200,201,314 to 317,186,202,187,203,306 to 309,318 to 321,386,387,388,389A polynucleotide according to any one of at least 21 , or a complementary sequence as represented , preferably at least 22, 23 or 24,25,26,27,28,29,30,35,40,45,50 , 55,60,70,80,90,100,110,125,150,175,200,225,250,300,350,400,450,500,550,600,700,800,900,1000,1100 , 1200,1300,1400,1500,2000 , or 3000 contiguous nucleotides of a polynucleotide fragment , and wherein said fragment or said sequence having a nucleotide sequence complementary to the fragment so that when the and SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6 35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121 , 142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 293,123,132,214 to 301,145,122,144,178,131,179,210 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185 , 234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257 , 158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173 , 317,186,202,187,203,306 278 to 281,200,201,314 to 309,318 to 321,386,387,388,389 to any one of the corresponding fragment and the ratio of the best comparative when The nucleotide sequence of SEQ, ID, NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34 , 139,5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204 , 16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 293 to 301,145,122,144,178,131,179,210 , 123,132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149 , 4,237,302 to 305,129,138,238 184,137,185,234 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to the 253,156,157 254 to 257,158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277 , 172,173,278 to 281,200,201,314 to 309,318 to 317,186,202,187,203,306 321,386,387,388,389 or a complementary sequence to any one of the to a corresponding fragment of at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical, or (v) if the SEQ ID NO1, 174,180,188,2,175 , 181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6,35 to 38,140,7,8,39 to 42,9 , 10,43 to 46,141,11,12,47 to 50,13,14, 51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62, 19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 213,290 to 301,145,122,144,178,131,179,210 to 293,123,132,214 to 217,124,133,218 to 221,146,125, 134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257,158,159,258 to 261,160,161,262 to 265, 163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173,278 to 281,200,201,314 to 317,186,202, 187,203,306 to 309,318 to 321,386,387,388,389 A polynucleotide according to any one of at least 21, or a complementary sequence as represented, preferably at least 22, 23 or 24,25,26,27,28,29,30,35,40,45,50 , 55,60,70,80,90,100,110,125,150,175,200,225,250,300,350,400,450,500,550,600,700,800,900,1000,1100 , 1200,1300,1400,1500,2000, or 3000 contiguous nucleotides of a polynucleotide fragment thereof, and wherein said fragment or said sequence having a nucleotide sequence complementary to that when the fragment SEQ ID NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5, 6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54,15,204,16,205, 55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25,26,75 to 78,143, 121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 301,145,122,144,178,131,179,210 to 213,290 to 293,123,132 , 214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233,128,149,184,137 , 185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253,156,157,254 to 257 , 158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273,168,170,169,274 to 277,172,173 , any one of the 278 to 281,200,201,314 to 317,186,202,187,203,306 to 309,318 in the corresponding fragment into 321,386,387,388,389 best alignment and when comparing the nucleotide sequence of SEQ, ID, NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4, 31 to 34,139,5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13,14,51 to 54, 15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24,71 to 74,25, 26.75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 301,145,122,144,178,131,179,210 to 213, 290 to 293,123,132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148,136,230 to 233, 128,149,184,137,185,234 to 4,237,302 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154,155,250 to 253, 156,157,254 to 257,158,159,258 to 261,160,161,262 to 273,168,170,169 to 265,163,162,164,266 to 269,165,167,166,270, or a sequence complementary to any of 274 to 281,200,201,314 277,172,173,278 to 309,318 to 317,186,202,187,203,306 to 321,386,387,388,389 at least one of said corresponding segment of 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical, or (vi) a polynucleotide encoding an amino acid sequence, with the most good than to compare two amino acid sequences and the amino acid sequence of SEQ, ID, NO1, 174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313,3,4,31 to 34,139,5,6,35 to 38,140,7,8,39 to 42,9,10,43 to 46,141,11,12,47 to 50,13, 14,51 to 54,15,204,16,205,55 to 58,322 to 325,17,18,59 to 62,19,20,63 to 66,21,22,67 to 70,23,24, 71 to 74,25,26,75 to 78,143,121,142,176,182,130,177,183,206 to 209,286 to 289,298 to 301,145,122,144,178,131, 179,210 to 213,290 to 293,123,132,214 to 217,124,133,218 to 221,146,125,134,222 to 225,147,126,135,226 to 229,127,148, 136,230 to 4,237,302 to 233,128,149,184,137,185,234 to 305,129,138,238 to 241,150,151,242 to 245,152,153,246 to 249,154, 155,250 to 253,156,157,254 to 257,158,159,258 to 261,160,161,262 to 265,163,162,164,266 to 269,165,167,166,270 to 273, 168,170,169,274 to 277,172,173,278 to 281,200,201,314 to 317,186,202,187,203,306 to 309,318 in the 321,386,387,388,389 any one of at least 70% amino acid sequence encoded by, preferably at least 75%, 80%, 85%, 90%, 95%, 98% or 99% identical, and wherein the polynucleotide is not longer than 10000,9000,8000 , 7000,6000,5000,4000,3000,2000, or 1500 nucleotides.
In a preferred embodiment, these separated polynucleotide are parts of disturbance RNA molecule, a part for silencing elements typically, it comprises at least one double stranded region, this double stranded region comprises has an adopted RNA chain by what anneal with sense-rna chain complementary base pairing, and wherein the sense strand of dsRNA molecule comprises and the nucleotide sequence of nucleotide sequence complementation that is positioned at the rna transcription thing of target gene.Therefore, the sense strand of dsRNA can be with rna transcription thing annealing and this RNA of target to induce in reticent mixture or RISC and to degrade at RNAi.
Polynucleotide of the present invention can be inserted in DNA construct as known in the art or carrier by conventional molecule clone technology.Therefore,, according to an embodiment, provide the DNA construct that comprises any polynucleotide of the present invention.A kind of DNA construct of the polynucleotide that comprise a kind of at least one RNA interfering of the present invention of encoding preferably, is provided at this.This DNA construct can be recombinant DNA carrier, for example bacterium, virus or yeast vector.In a preferred embodiment of the invention, DNA construct is that a kind of expression construct and this polynucleotide are operably connected to the regulating and controlling sequence that at least one can drive the expression of polynucleotide sequence.Term ' regulating and controlling sequence ' should be got broad sense and be intended to refer to affect any nucleotide sequence of the expression of be operably connected polynucleotide, includes, but is not limited to transcriptional activation element promotor, enhanser and other natural generations or synthetic.Regulating and controlling sequence can be positioned at 5 of this polynucleotide sequence ' or 3 ' end.Term ' is operably connected ' and refers to functional connection the between regulating and controlling sequence and polynucleotide sequence, and this connection makes this regulating and controlling sequence drive the expression of these polynucleotide.The element being operably connected can be continuous or discontinuous.
Preferably, this regulating and controlling sequence is a kind of promotor, and this promotor is selected from lower group, and this group includes, but is not limited to: constitutive promoter, inducible promoter, tissue-specific promoter and growth/etap specificity promoter.In one embodiment, polynucleotide are placed under the control of strong constitutive promoter, this promotor is that this group comprises: CaMV35S promotor, two CaMV35S promotor, ubiquitin promoter, actin promoter, carboxydismutase promotor, GOS2 promotor, figwort mosaic virus 34S promotor as being selected from lower group any.
Optionally, one or more transcription termination sequences can be integrated in expression construct of the present invention.Term ' transcription termination sequence ' is encompassed in the control sequence of transcriptional units end, and it sends Transcription Termination, the 3 ' processing of primary transcript and the signal of Polyadenylation.Other controlling element, includes, but is not limited to transcribe or translational enhancer, can be integrated in expression construct, for example the same with two enhancing CaMV35S promotors.
A kind of method for generation of any RNA interfering of the present invention has also been contained in the present invention, comprises the following steps: (i) make the to encode polynucleotide of described RNA interfering or the DNA construct that comprises these polynucleotide contact with not celliferous component; Or (ii) polynucleotide of the described RNA interfering of coding or the DNA construct that comprises these polynucleotide are introduced to (for example, by conversion, transfection or injection) in cell.
Therefore, the invention still further relates to by polynucleotide described here and express any double-stranded ribonucleotide producing.
Therefore, at this, also provide a kind of host cell transforming with any polynucleotide described here.The host cell of the DNA construct that comprises any RNA interfering of the present invention, any polynucleotide of the present invention or comprise these polynucleotide has further been contained in the present invention.This host cell can be a kind of prokaryotic cell prokaryocyte, includes, but is not limited to Gram-positive and gram negative bacterium cell; Or a kind of eukaryotic cell, include, but is not limited to yeast cell or vegetable cell.Preferably, described host cell is a kind of bacterial cell or a kind of vegetable cell.Bacterial cell can be selected from lower group, this group includes, but is not limited to Gram-positive and gram-negative cells, comprises Escherichia (Escherichia spp.) (for example intestinal bacteria), bacillus (Bacillus spp.) (for example bacillus thuringiensis), rhizobium (Rhizobium spp.), lactobacillus (Lactobacillus spp.), lactococcus (Lactococcus spp.), Rhodopseudomonas (Pseudomonas spp.) and Agrobacterium (Agrobacterium spp.).Polynucleotide of the present invention or DNA construct can be used as extra-chromosomal element and exist or maintain in host cell, or can stably merge in host cell gene group.Interested especially feature in the host cell of selecting for the purposes of the present invention comprises that the polynucleotide of coded interference RNA or DNA construct be directed into the easiness in host, the compatible operability of expression system, the efficiency of expression and the RNA interfering stability in host.
Preferably, RNA interfering of the present invention is expressed in plant host cell.Preferred interested plant includes, but is not limited to that cotton, potato, paddy rice, tomato, Kano are drawn, soya bean, Sunflower Receptacle, Chinese sorghum, pearl millet, corn, clover, strawberry, eggplant, pepper and tobacco.
In RNA interfering, in the situation that express in host cell and/or be used to prevention and/or control the infest of host organisms, preferably RNA interfering does not show the effect of ' missing the target ' significantly, and RNA interfering does not affect the genetic expression in host.Preferably, silencer do not represent with set target nucleotide sequences except target gene the remarkable complementarity of nucleotide sequence.In one embodiment of the invention, silencing elements demonstrate with any gene of host cell or organism be less than 30%, be more preferably less than 20%, be more preferably less than 10% and be even more preferably less than 5% sequence identity.If the genomic sequence data of host organisms is available, people can use the information biology instrument crosscheck of standard and the consistence of silencing elements so.In one embodiment, in having the region of 17 continuous nucleotides, more preferably in having the region of 18 or 19 continuous nucleotides, and most preferably in having the region of 20 or 21 continuous nucleotides, silencing elements and from there not being sequence identity between the gene of host cell or host organisms.
In practicable application of the present invention, RNA interfering of the present invention can and/or be controlled any insect pest that belongs to Coleoptera, lepidopteran, Diptera, Dictyoptera, Orthoptera, Hemiptera and Siphonaptera for prevention.
In addition, according to another aspect of the present invention, at this, provide a kind of for preventing and/or control the composition that insect pest is invaded and harassed, said composition comprises at least one disturbance ribonucleic acid (RNA) and optionally at least one suitable carrier, vehicle or thinner, and wherein this RNA interfering plays the effect of lowering a kind of expression of target gene in described insect after being taken in by insect.This RNA interfering can be any in disclosed those of this elsewhere.Preferably, this RNA interfering comprise at least one silencing elements or consisting of, and described silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein a chain (sense strand) comprise with target gene in an a target nucleotide sequences complementary nucleotide sequence at least in part.' target gene ' can be any in insect target gene as disclosed in the elsewhere at this, includes, but is not limited to be involved in the survival of regulation and control insect, growth, growth, reproduction and pathogenic gene.Alternately, said composition comprises at least one host cell, the DNA construct that this host cell comprises at least one disturbance RNA molecule or this disturbance RNA molecule of encoding and optionally at least one suitable carrier, vehicle or thinner, wherein, after this host cell is taken in by insect pest, this RNA interfering plays the effect of lowering a kind of expression of target gene in described insect.
In practicable application of the present invention, said composition can and/or be controlled for prevention and belong to any insect pest of following object: Coleoptera, lepidopteran, Diptera, Dictyoptera, Orthoptera, Hemiptera and Siphonaptera.Therefore, said composition can be and is administered to insect pest or is administered to any suitable form to matrix and/or organism, the especially plant of the invasion sensitivity of described insect pest.In one embodiment, said composition is applicable to prevention and/or controls plant or the breeding of plant or the infest of reproductive material, and is therefore for the insect pest species of invading and harassing plant.When insect pest belongs to when eating the classification of ' chewing type ' insect of as plant tissues such as root, leaf, flower, bud, sprays, plant being caused sizable infringement, composition of the present invention is effective especially.From this other example of larger insects, comprise beetle and its larva.
Composition of the present invention can be for controlling in all stages of insect pest life cycle, for example the insect pest of ripe adult stage, larval stage and avette phase.
Under the background of the present composition, this RNA interfering can be by a kind of DNA construct, and especially as described in the elsewhere at this kind of expression construct produces, a kind of polynucleotide that this RNA interfering comprises this RNA interfering of encoding.In a preferred embodiment, this RNA interfering can produce expressed a kind of host cell of described RNA interfering or organism by the polynucleotide of a kind of coded interference RNA by engineered one-tenth in.
Appropriate host organism for composition of the present invention includes, but is not limited to known surely growing in plant or the crop paid close attention to, to the microorganism in environment on the plant of the invasion sensitivity of insect pest species or crop and/or around.This quasi-microorganism includes, but is not limited to occupy those of blade face (surface of leaf) and/or rhizosphere (around the soil of roots of plants).These microorganisms through selection so that can be successfully with plant environment in existing any wild-type organisms compete mutually.The applicable suitable microorganism that does host comprises different types of bacterium, algae and fungi.Clearly, selected microorganism is necessary for that tool is not virose to plant.Be administered to this based composition of the plant of the invasion sensitivity of insect pest species by by be take treated plant as food insect pest absorb.
Not surely to grow natively in the host organisms of plant and/or its environment also within the scope of the invention.This class organism can only serve as a kind of means of the RNA interfering that produces said composition.For instance, in one embodiment, fermentation in a host bacterium/produce RNA interfering and then by this bacteria inactivation/kill.Gained bacterium can be used as a kind of insect sprays of killing with using bacillus thuringiensis bacterial strain as the same way as of the insecticide of sprays application through processing and usining.In certain embodiments, suitably purification of bacterial extract or lysate, to leave a kind of extract containing pure in fact RNA interfering, are then mixed with a kind of composition of the present invention it.Those of ordinary skill in the art should known standard extraction/purification technique.
Composition of the present invention can be any suitable physical form that is administered to insect.For instance, said composition can be solid form (powder, spherolite or bait), liquid form (comprising the form giving as a kind of sprays insecticide) or gel form.In a specific embodiment, said composition can be a kind of coating, paste or powder, and it can be applied to a kind of matrix to protect described matrix to exempt from the invasion of insect.In this embodiment, said composition can be used for any matrix or the material of protection to insect infestation or the infringement sensitivity that caused by insect.
The character of vehicle and the physical form of composition can depend on desired processing matrix character and become.For instance, said composition can be a kind of liquid, and it is brushed or be sprayed on pending material or matrix or is imprinted in pending material or matrix; Or a kind of coating or powder, it is applied on pending material or matrix.
In one embodiment, said composition is the form that is bait.This bait is designed to lure insect to contact with said composition.With it contact after, said composition subsequently by this insect by for example absorbing and internalization and mediate rna i, thereby kill insects.Described bait can comprise a kind of food, for example, as a kind of food based on protein, fish meal.Boric acid also can be used as a kind of bait.This bait can depend on the species of institute's target.Can also use a kind of attractive substance.For instance, this attractive substance can be a kind of pheromone, as a kind of male or female pheromone.As an example, can use in the present invention in < < insect pheromone and they (the people such as person of outstanding talent this (Howse) of the purposes > > (Insect Pheremones and their use in Pest Management) in Pest Management, Cha Puman and Hall company (Chapman and Hall), 1998) pheromone of mentioning in a book.Attractive substance plays the effect to bait by insect attractant, and can maybe can be attracted the insect in gamut by a kind of specific insect of target.Bait can be any suitable form, as solid, paste, spherolite or powdered form.
Bait can also be brought back to group by insect.Then bait can serve as other members' of this group food source, thereby provides a large amount of insects and a kind of effective control of whole insect pest group potentially.This is an advantage relevant to using double-stranded RNA of the present invention, because the delay action to the effect of insect of RNAi mediation makes bait be brought back into group, thereby has sent maximum impact with regard to being exposed to insect.
In addition, the composition contacting with insect can be retained on the epidermis of insect.When clean, no matter be that an independent insect cleans self or insect is clean each other, these compositions can be ingested and can mediate thus their effects in insect.Even if this needs said composition sufficiently stable so that when being exposed to external environment condition for some time (this period for example can be the time of a couple of days), it is complete and can mediate rna i that RNA interfering still keeps.
Bait may be provided in suitable " housing " or " grabber ".This shells and grabber are that commercially available and existing grabber can be caused and comprise composition of the present invention by tune.Any housing or the grabber that can attract insect enter all comprise within the scope of the invention.Housing or grabber can be box shapes for example, and can under premolding condition, provide or can be formed by collapsible cardboard.Suitable material for housing or grabber comprises plastics and cardboard, especially corrugated cardboard.The suitable size of this housing or grabber is that for example 7-15cm is wide, and 15-20cm is long and 1-5cm is high.The internal surface of these grabbers can in be lined with a kind of viscous substance so that limits insect is once the movement in grabber.Housing or grabber can comprise in inside a suitable groove, and it can keep bait in position.Grabber and housing are distinguishing, because insect can not leave easily grabber after entering, and housing serves as one " station of ingesting ", it provides a preferred environment to insect, and they can ingest and feel can not be subject to predator's danger therein.
Therefore, in yet another aspect, the invention provides a kind of housing for insect or grabber, it comprises a kind of composition of the present invention, can be in conjunction with any feature of composition described herein.
In another alternate embodiment, composition can be a kind of spray form to be provided.Therefore, mankind user can directly be sprayed insect by said composition.Said composition is then by insect internalization, and in insect body, it can disturb by mediate rna, thereby controls insect.Sprays is the agent of a kind of pressurization/atomisation or a kind of pump formula sprays preferably.These particles can have suitable size so that they stick on insect, for example, stick on exoskeleton, and can be absorbed therefrom.Granularity can be passed through any means known, as measured by using a kind of commercially available device Maas spy to match (Mastersizer) particle size analyzer.
In yet another embodiment, carrier is a kind of powder or particle of static electrification, and it sticks on insect.Suitable powder and the particle that can stick on insect and send thus RNA construct of the present invention are described in detail in WO94/00980 and WO97/33472, are both combined in by reference this.
Alternately, carrier can comprise magnetic-particle, and these particle adhesions are in insect cuticle.The suitable magnetic-particle that can stick on insect and send thus RNA construct of the present invention is described in detail in WO00/01236, and this reference is combined in this.
In yet another embodiment, the carrier of composition comprises metallic particles, and these particles are unmagnetized at first but can when the electric field being provided by insect health has been provided, become magnetically polarization.This behavior pattern is described in detail in WO2004/049807 and is combined in by reference this.
Preferably, composition has been incorporated to a kind of carrier, and this carrier has increased the absorption of RNA interfering in insect pest.This carrier can be a kind of carrier based on lipid, preferably comprises one or more in the following: emulsion oil-in-water, micella, cholesterol, grease multi-amine and liposome.Other reagent that promote the absorption of construct of the present invention are that those skilled in the art is well-known and comprise polycation, dextran and (three) cation lipid, as CS096, CS102 etc.Commercially available liposome comprises
Figure BDA0000417228660001401
know
Figure BDA0000417228660001402
deng.Under title in WO03/004644 " transfection promotor (Transfection promoting agent) ", listed many suitable carriers, and the example providing is combined in this separately by reference.
In a further advantageous embodiment, carrier is a kind of nucleic acid flocculation agent.Preferably, nucleic acid flocculation agent comprises spermidine or protamine sulfate or derivatives thereof.
In the situation that composition of the present invention is applicable to the infest of prevention and/or control plant, said composition can comprise carrier suitable in a kind of agricultural.This carrier can be any material that has pending plant to tolerate, and this material can not cause infringement improperly and its permission RNA interfering to remain valid for insect pest species to environment or other biological body wherein.Specifically, composition of the present invention can prepare to be delivered to plant according to conventional agriculture practice used in biotic pesticide industry.Said composition can comprise the other component that can carry out other functions, and these functions comprise that (but being not limited to) (i) strengthens or promote insect cell to the absorption of RNA interfering and (ii) make the active ingredient of composition stable.In comprising the composition of RNA interfering, the specific examples of the other component of contained this class is yeast tRNA or the total RNA of yeast.
Said composition can be formulated for directly uses or is formulated as the conc forms that needed the primary composition of dilution before using.Alternately, said composition can be by kit form supply, and this test kit is included in a RNA interfering in container or comprises or express the host cell of RNA interfering and the suitable diluent or carrier for this RNA or host cell in an independent container.In practicable application of the present invention, said composition can be applied to any part of plant or the plant in any stage in development of plants.In one embodiment, for example plant crop, in field, between incubation period, composition is administered to the over-ground part of plant.In yet another embodiment, when plant seed is storing or after in being planted soil, composition is administered to plant seed.In general importantly, the good control in the early stage acquisition of plant-growth to insect, may be subject to the most badly damaged time of pest species because this is plant.
Can by different technology, composition be administered in the environment of insect pest, these technology include, but is not limited to spraying, atomization, dusting, scatter, pour into, are coated with seed, seed treatment, are incorporated in soil and are incorporated in irrigation water.When the plant of processing infest sensitivity, can be before there is insect (for the object of prevention) or after the sign of infest starts to occur (object of controlling for insect), composition is delivered to a part for plant or plant.
In yet another embodiment of the present invention, composition of the present invention can be formulated into and comprise at least one other promoting agent.Therefore, said composition can provide by a kind of " minute manifold test kit " form, test kit is included in composition and one or more the suitable activeconstituentss in an independent container, for example chemistry or the biotic pesticide containing RNA interfering in a container.Alternately, said composition can provide by a kind of form of mixtures, and this mixture is stable and combines with one another use.
The suitable activeconstituents that can act on disturbance RNA molecule of the present invention by a kind of complimentary fashion includes, but is not limited to the following: Chlorpyrifos 94, esbiothrin, chrysron, tetrabromo ethyl, dimethanol-cyclopropane-carboxylic acid (being included in liquid composition generally); And hydramethylnon, Avrmectin, Chlorpyrifos 94, sulfluramid, hydroprene, ethiprole (GABA acceptor), carboxylamine isopropyl phenyl methyl esters, indoxacarb (PARA), noviflumuron (chitin synthesis inhibitor), Imiprothrin (PARA), abamectin (chloride channel of glutamate gate), Provado (acetylcholine receptor) (being included in generally in bait composition).
In a preferred embodiment, with regard to healthy and environmental consideration, known activity composition is a kind of preferred insecticide, as hydramethylnon and Avrmectin.
In yet another embodiment of the present invention, composition is formulated into and comprises at least one other agronomy reagent, for example a kind of weedicide or a kind of other sterilant.As used in this, ' the second sterilant ' or ' other sterilant ' refers to a kind of sterilant except first or original disturbance RNA molecule of said composition.Alternately, composition of the present invention can for example, be sent with at least one other agronomy reagent (a kind of weedicide or a kind of the second sterilant) combination.In one embodiment, said composition is to provide with a kind of combinations of herbicides, and this weedicide is selected from any weedicide as known in the art, for example glyphosate, imidazolone, sulphur urea and bromoxynil.In yet another embodiment, said composition is that the insecticide composition other with at least one provides.This other sterilant can be selected from any sterilant as known in the art and/or can comprise a kind of disturbance ribonucleic acid, and this disturbance ribonucleic acid plays the effect of the expression of lowering a kind of target gene in described pest species after being taken in by a kind of insect.In one embodiment, target insect is that a kind of insect pest species and RNA interfering are any one being selected from RNA interfering as the described herein.In yet another embodiment, this other sterilant comprises a kind of RNA interfering, and it plays the effect of lowering a kind of expression of known in any target pest species (being not limited to insect pest).The original disturbance RNA molecule of composition with second or other sterilant can the identical insect pest species of target maybe can intend the different insect pest species of target.For instance, the insect pest species that original RNA interfering and the second sterilant are can target different or can target the insect organism of not equal or guiding principle, for example fungi or nematode or insect.How those of ordinary skill in the art should know the combination about synergistic effect test disturbance RNA molecule and other agronomy reagent.In a preferred embodiment, composition is included in this described a kind of the first disturbance RNA molecule of elsewhere and one or more other sterilants, each all has toxicity to identical insect pest, wherein these one or more other sterilant is selected from a kind of potato tuber differential protein, a kind of bacillus thuringiensis insecticidal proteins, a kind of Xenorhabdus insecticidal proteins, a kind of smooth rod bacterium insecticidal proteins, a kind of bacillus laterosporus insecticidal proteins, a kind of Bacillus sphaericus insecticidal proteins and a kind of xylogen, and wherein said bacillus thuringiensis insecticidal proteins is selected from lower group, this group is comprised of the following: Cry1Ab, Cry1C, Cry2Aa, Cry3, TIC851, CryET70, Cry22, VIP, TIC901, TIC1201, TIC407, TIC417, be selected from the binary insecticidal proteins of CryET33 and CryET34, CryET80 and CryET76, TIC100 and TIC101 and PS149B1, and any insect mosaic that kills in aforementioned insecticidal proteins.
The different components of combination described herein can be for example to the host organisms giving the invasion sensitivity of the insect in any order.These components can or be delivered to pending region or organism successively simultaneously.
At this, also provide a kind of for the method for preventing and/or Control pests is invaded and harassed, comprise insect pest species are contacted with at least one RNA interfering of significant quantity, wherein this RNA plays the effect of the expression of lowering essential insect target gene after being taken in by described insect.This essential target gene can relate to cause or maintain any insect gene of invading and harassing required essential bioprocess in regulation and control insect, and this bioprocess includes, but is not limited to survival, growth, growth, reproduction and pathogenic.Specifically, this target gene can be any insect gene as described in the elsewhere at this.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO1 with SEQ ID, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297 or 310 to 313 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO1 with SEQ ID, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297 or 310 to 313 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), root Galeruca (west Zea mays root firefly chrysomelid (west corn rootworm) for example, Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first food root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm), these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has with as SEQ ID NO79, 349, existing aminoacid sequence at least 85% in any in 352 or 356, 90%, 92%, 94%, 96%, 98%, 99% consistent (when comparing best the protein of described coding).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO141 with SEQ ID, 11, 12, 47 to 50 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO141 with SEQ ID, 11, 12, 47 to 50 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in any in SEQ ID NO328 or 84 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO17 with SEQ ID, 18, 59 to 62 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO17 with SEQ ID, 18, 59 to 62 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in SEQ ID NO87 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO19 with SEQ ID, 20, 63 to 66 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO19 with SEQ ID, 20, 63 to 66 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in SEQ ID NO88 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO165 with SEQ ID, 167, 166, 270 to 273 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO165 with SEQ ID, 167, 166, 270 to 273 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in any in SEQ ID NO347 or 348 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO143 with SEQ ID, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), North America corn root leaf A (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO143 with SEQ ID, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in any in SEQ ID NO330,350 or 353 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO145 with SEQ ID, 122, 144, 178, 131, 179, 210 to 213, 290 to 293 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO145 with SEQ ID, 122, 144, 178, 131, 179, 210 to 213, 290 to 293 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in any in SEQ ID NO331 or 351 (when the protein of coding as described in comparing best).
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO128 with SEQ ID, 149, 184, 137, 185, 234 to 237, 302 to 305 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca.
Described here in order to lower in the method for expression of the target gene in insect pest species, can use and comprise at least the double stranded rna molecule of 21bp (wherein a chain comprises the NO128 with SEQ ID, 149, 184, 137, 185, 234 to 237, 302 to 305 or its complementary sequence in any at least 21 continuous nucleotide complementations nucleotide sequence or consisting of) lower coleopterous insect, hemipteran, the straight expression to homology target gene in lepidopterid or dipteron, this insect is selected from lower group, this group includes, but is not limited to colorado potato beetles and belongs to (colorado potato beetles (Colorado colorado potato bug) for example, pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)), brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)), lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)), tumor aphid genus (for example black peach aphid (green black peach aphid)), (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm) or zea mexicana root fireflies chrysomelid (zea mexicana rootworm) to root Galeruca, these orthologous genes a kind of protein of encoding wherein, the aminoacid sequence that this protein has and as consistent in existing aminoacid sequence at least 85%, 90%, 92%, 94%, 96%, 98%, 99% in any in SEQ ID NO337 or 354 (when the protein of coding as described in comparing best).
In addition, at this, provide a kind of for preventing and/or control the method for the insect pest invasion in crop plants field, described method is included in the RNA interfering as the described herein of expressing significant quantity in described plant.
In the situation that the method is invaded and harassed for Control pests, phrase ' significant quantity ' expand to insect produce a kind of phenotype effect so that invade and harass host organisms insect organism reduced number and/or by the caused infringement amount of this insect, reduced amount or the concentration of required RNA interfering.In one embodiment, phenotype effect is the dead of insect and uses RNA interfering to realize as compared with contrasting insect pest, at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, and more preferably at least 80% or 90% Mortality of insect.In yet another embodiment, phenotype effect includes, but is not limited to hinder insect growth, ingests and stops and reducing laying eggs.Therefore, as compared with contrasting insect, the overall number of invading and harassing the insect organism of host organisms can be reduced by least 20%, 30%, 40%, and preferably at least 50%, 60%, 70%, more preferably at least 80% or 90%.Alternately, as compared with contrasting insect pest, the infringement being caused by insect pest can reduce at least 20%, 30%, 40%, and preferably at least 50%, 60%, 70%, more preferably at least 80% or 90%.Therefore, method of the present invention can be for realizing at least 20%, 30%, 40%, and preferably at least 50%, 60%, 70%, more preferably at least 80% or 90% insect is controlled.
As used in this, term ' plant ' can comprise any reproduction or the reproductive material of a kind of plant.Mention that plant can also comprise vegetable cell, plant protoplast, plant tissue cultures, plant callus, vegetation bed and in the part of plant or plant intact vegetable cell, these plant parts are as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, core, fringe, cob, shell, stem, root, the tip of a root etc.
At this, also provide disturbance ribonucleic acid as the described herein (RNA) or DNA construct as the described herein for prevention and/or controlled insect pest and invade and harass, the purposes that preferably plant insect pest is invaded and harassed.
With reference to following limiting examples, will be further understood that the present invention.
example
the target gene that example 1 is identified in insect pest species
1.1. the normalized cDNA library of beanpod lygus bug and prepare dsRNA for screening assay in porous plate
Isolating nucleic acid from the beanpod lygus bug nymph of different life stages, these beanpod lygus bug nymphs comprise nymph and the adult of squab nymph, 2,4,6 and 9 ages in days.Use SMARTer tMpCR cDNA synthetic agent box, follows the specification sheets (Clontech catalog number (Cat.No.) 634925) of manufacturers and prepares cDNA library.Use Trimmer test kit (Evrogen catalog number (Cat.No.) NK001) make cDNA library normalization method and clone in PCR4-TOPO carrier (hero (Invitrogen)).Normalized clone is introduced in M2 fit (Trimmer test kit, Evrogen, SEQ ID NO92:AAGCAGTGGTATCAACGCAG), relatively directed at these clones' place, every one end.Construction of recombinant vector body is converted in coli strain TOP10 (hero's) cell.By the cell dilution and the bed board that transform, obtain thus simple community or clone subsequently.Check that these clone to guarantee that clone's redundancy in this storehouse is no more than 5%.In liquid LB in 96 hole depth orifice plates (Luria meat soup (Luria-broth)) substratum, select single clone, and make its grow overnight at 37 ℃.These plates also comprise the positive (Lh423) and negative (FP) contrast clone.
In order to produce dsRNA, by PCR, produce the sense and antisense DNA fragmentation that contains T7 promoter sequence.In simple terms, for each clone, based on M2 and T7-M2 sequence, the bacterial suspension of 1 μ l is assigned to and is contained accordingly
Figure BDA0000417228660001541
in the porous PCR plate of (the catalog number (Cat.No.) D4309 of Sigma (Sigma)) and primer oGCC2738 (SEQ ID NO93:AAGCAGTGGTATCAACGCAG) and oGCC2739 (SEQ ID NO94:GCGTAATACGACTCACTATAGGAAGCAGTGGTATCAACGCAG).After PCR reaction, carry out in-vitro transcription, wherein for each clone, the PCR product of 6 μ l is added to the RiboMAX of 9 μ l tMovernight incubation in extensive RNA production system-T7 (Pu Luomaige (Promega) catalog number (Cat.No.) P1300) and at 37 ℃.In the beanpod lygus bug sucrose feed that contains 15% sucrose and 5 μ g/ μ l yeast tRNA (hero's catalog number (Cat.No.) 15401-029) by 2 times of final dsRNA solution dilutions, and for screening.Corresponding to positive Lh423 contrast clone's dsRNA, be SEQ ID NO101 and be SEQ ID NO104 (referring to table 4) corresponding to negative FP contrast clone's dsRNA.
1.2. use dsRNA to express the novel and effective beanpod lygus bug target gene of cDNA library screening
Developed a kind of new screening assay for effective beanpod lygus bug target.This mensuration arranges as follows: each pore volume of 96 orifice plates is received the beanpod lygus bug nymph of an age in days, and it is exposed in the Parafilm pouch that contains sucrose feed under tRNA exists, and this sucrose feed comprises test dsRNA or contrast dsRNA.Each plate contains dsRNA, 3 * Lh423 (positive control) and the 3 * FP (fluorescin from 90 kinds of different clones; Negative control).On three plates, repeat each clone (test dsRNA).After exposing three days, record the survival number of nymph and with not existing fresh raising (compound) feed of dsRNA to replace this feed.The 4th day, the 6th day and the 8th day evaluation mortality ratio.First and second take turns confirmation measures the identical setting of use, and has accordingly 8 and 20 insects, one, every hole nymph.
Use the dsRNA corresponding to Lh423 target as negative control, to verify this mensuration system as positive control and with fluorescin dsRNA: accordingly, more than 90% being true positives and below 5%, being false positive.
After tested contain 1800 independent clones called after Lh001 to 20 96 orifice plates of Lh020 (referring to the bottom line of Fig. 1 and 2).In confirming to measure in the first round, identify and tested 205 kinds of material standed fors.Threshold value is set in the mortality ratio that shows >=50%, identifies 41 and independently clone and make it and proceed to second and take turns confirmation.In this is measured, these clones and positive control Lh423 (RpLl9) and Lh105.2 (Sec23) and negative control Pt (the Fluorescent Bands of Coral albumen of encoding) are compared.DsRNA corresponding to sun raw (Lh423) contrast clone is SEQ ID NO101, corresponding to positive Lh105.2 contrast clone's dsRNA, is SEQ ID NO102 and is SEQ ID NO104 (referring to table 4) corresponding to negative (Pt) contrast clone's dsRNA.
For all test dsRNA that show >=50% mortality ratio in confirming for the first time, start second and take turns and confirm to measure, each test dsRNA tests 20 insects (Fig. 1 and 2).Candidate's target (referring to table 1) with " Lhxxx numeral " name corresponding to the test dsRNA confirming.The identical cutoff of the mortality ratio of use >=50%, is confirming 15 targets in screening for the first time.
Carry out programmed screening to identify more beanpod lygus bug target.The second result of taking turns confirmation mensuration is presented in Figure 12.The identical cutoff of the mortality ratio of use >=50% has been confirmed some targets (referring to table 1C) in programmed screening.
1.3. the evaluation of lygus bug target
When confirmation insect is measured, check order and use the consistence of searching for to confirm target for the BlastX of fruit bat and plan ostomatid albumen database to the inset corresponding to positive colony.Table 1 provides the analysis of biological information of beanpod lygus bug target sequence of novel evaluation and the general introduction of current annotation.
In screening, identifying 15 kinds of novel beanpod lygus bug targets and in programmed screening, identifying 11 kinds of novel beanpod lygus bug targets for the first time.All targets all show high-effect for beanpod lygus bug nymph, and the cDNA that shows to be included in coding double-stranded RNA is wherein survived and is essential and therefore represented the interested target gene of controlling for insect for insect.Therefore, the aminoacid sequence of the DNA sequence dna of these target genes and deduction measured and provided accordingly in table 2 and 3.
Lh594 is the beanpod lygus bug straight homologues of fruit bat Troponin I, is involved in Muscle contraction and is not therefore present in plant, and it has represented the target of a class novelty that belongs to animal specificity physiological pathway but not yet explore for GM-RNAi.In fruit bat, Troponin I is described to a kind of haplo-insufficiency gene, presents a kind of mutation type surface in heterozygote state.This genoid is to the reduction meeting of mrna expression level especially sensitivity and therefore can be regarded as desirable RNAi target.
In this Lh594 approach, select eight targets (referring to table 1B).For each target, based on the different insects sequence alignment of (comprising honeybee, Tribolium and aphid), design nearly 4 pairs of degenerate pcr primers.These primers are used to amplification from the fragment of beanpod lygus bug target.The aminoacid sequence of the DNA sequence dna of these target genes and deduction is measured and provided accordingly in table 2 and 3.
Table 1: according to the novelty of the beanpod lygus bug by the mortality ratio % classification target of confirming for the second time measurement result (screening for the first time).
Figure BDA0000417228660001561
Figure BDA0000417228660001571
The novel target of beanpod lygus bug in table 1B:Lh594 approach
Figure BDA0000417228660001572
*unclear: according to there being a plurality of hitting in the section of e value classification
Table 1C: according to the novelty of the beanpod lygus bug by the mortality ratio % classification target of confirming for the second time measurement result (programmed screening).
Figure BDA0000417228660001581
1.4. the full length cDNA clone being undertaken by RACE (cDNA end rapid amplifying)
In order to clone full-length cDNA, from the known clone from the interior segments of effective target, use 5 '/3 ' RACE test kit (Roche (Roche), catalog number (Cat.No.) 1734792; Based on Pehanorm Brooker, J. (Sambrook, J.) and Russell, D.M (Russell, D.M)).Then carry out the standard scheme described in service manual (Instruction Manual).Briefly, for 5 ' RACE, according to known array, design target sequence specific antisense primer and use lygus bug RNA as template, using it for the synthetic of the first chain cDNA.In the first chain cDNA, add afterbody amplification synthetic for the second chain used as a kind of anchor and the unknown terminal portions of transcript.For 3 ' RACE, use oligomerization dT anchor primer to carry out the first chain cDNA and synthesize.For 5 ' and 3 ' RACE, in PCR reaction for the second time, use the specific nested primer of target sequence.On sepharose, analyze PCR fragment, purifying, clones and checks order for confirmation.
Full length cDNA sequence in VectorNTi (a kind of fully integrated sequence analysis software bag (hero) for DNA sequence analysis) assembling corresponding to these targets.
example 2 is for the external generation of the double-stranded RNA of gene silencing
2.2. corresponding to the generation of the dsRNA of the partial sequence of beanpod lygus bug target gene
The double-stranded RNA of synthetic milligram quantities.First, by PCR, produce two independent 5 ' t7 rna polymerase promoter templates (having adopted template and antisense template).Design is gone forward side by side performing PCR to produce sense and antisense template polynucleotide, and these polynucleotide have the T7 promotor on the different directions of the target sequence with respect to needing to be transcribed separately.
For each target gene, using target-specific T7 forward primer and target-specific reverse primer to produce has adopted template.Use target-specific forward primer and target-specific T7 reverse primer to produce antisense template.Sequence for the corresponding primer of the sense and antisense template by each target gene of pcr amplification provides at table 4.By agarose gel electrophoresis, analyze PCR product and be purified.There is justice mix with antisense template and transcribe by adding t7 rna polymerase gained T7.The single stranded RNA of being transcribed generation by these templates is annealed, with DNA enzyme and RNA enzyme, process, and by precipitating in addition purifying.The sense strand of the gained dsRNA being produced by each target gene provides in table 4.
2.2. the survival analysis of novel beanpod lygus bug target is measured
In order to have synthesized corresponding to the external dsRNA of novel target and in survival analysis biological assay in 10 days according to usefulness classification, be applied to beanpod lygus bug.In simple terms, the beanpod lygus bug nymph of an age in days is placed in 96 orifice plates with sucrose sealing, the target dsRNA that these sealings contain 0.5 μ g/ μ l, is supplemented with the yeast tRNA of 5 μ g/ μ l.Under standard lygus bug raising condition, these plates are hatched 3 days.At the 3rd day, the 6th day and the 8th day, with more new feedstuff sealing of the sealing that only contains lygus bug feed.Use Lh423 (RpL19) as positive control and use GFP dsRNA and sucrose feed as negative control.
From the results verification of these survival analysis from the data of confirming to measure for the first time and for the second time.Lh594 is established as highly effectively target, and wherein active contrast Lh423 is stronger by force with killing speed ratio.
Up to the present, for the lygus bug Screening and Identification of novel target, go out the higher or new target within the scope of it of specific activity positive control Lh423, these new targets comprise Lh429, Lh594, Lh609, Lh610, Lh611, Lh617 and Lh618.The mortality ratio of being induced by these targets is shown in Fig. 3 and 4.
In order to allow according to the activity of these targets, by they classifications more accurately, to have carried out dose response concentration analysis.In measuring in vitro, test novel target, wherein concentration is in the scope of from 0.4 to 0.025 μ g/ μ l.For every kind of condition, in 96 orifice plates arrange, in the sucrose feed that is supplemented with dsRNA and tRNA carrier, the nymph of 24 ages in days is tested.Result is rendered as the survival rate % (Fig. 5 to 9) in experiment on the 10th and is summarised in table 5.
Based on concentration curve analysis, by benchmark, contrast Lh423 and Lh105 by these target classifications (table 5).
Table 5: compare according to DRC and with basic target Lh423 and Lh105 and carry out the novel target of lygus bug of classification.
Figure BDA0000417228660001601
Further confirm the usefulness of Lh594.Before other targets and benchmark positive control Lh105 and Lh423, at least one sky, clearly observes this target effect.Because Lh594 is highly effective, in standard DRC experiment, do not reach LD50, wherein concentration is in the scope of from 0.4 to 0.025 μ g/ μ l dsRNA (Fig. 6), therefore repeat Lh594 experiment, be included in the lower concentration (Figure 10) within the scope of from 0.05 to 0.001 μ g/ μ l dsRNA.In a word, low, under the concentration of 0.0025 μ g/ μ l, observe Lh594 activity and at the 6th day, obtained approximately 90% kill (survival rate corresponding to approximately 10%) with the dsRNA of 0.025 μ g.
In order further to explore the usefulness of Lh594 and the effect of tRNA carrier in the RNAi reaction in beanpod lygus bug, be provided with the other external mensuration of ingesting in the situation that not there is not carrier tRNA.Use standard method to produce in vitro Lh594, Lh423 (benchmark contrast) and GFP (negative control) dsRNA.These dsRNA of purifying and test (Figure 11 A) with 5 μ g/ μ l in the situation that not there is not tRNA.
In the situation that not there is not tRNA, target Lh594 and Lh423 have induced high lethality rate in lygus bug nymph.Reappeared afterwards the result from this experiment.Target dsRNA can induce via the RNAi effect of ingesting (RNAi-by-feeding effect) in the situation that not there is not tRNA in lygus bug nymph.
For the activity of the dsRNA that studies in the situation that not there is not carrier tRNA at lower concentration, use the dsRNA of decrement to be provided with other experiment (Figure 11 B).
The lygus bug target of identifying in programmed screening has been followed similar method.In order to allow, according to the activity of these targets, these targets are carried out to classification, carried out dose response concentration analysis.In measuring in vitro, test novel target, wherein concentration is in the scope of from 0.5 to 0.05 μ g/ μ l.For every kind of condition, in 96 orifice plates arrange, in the sucrose feed that is supplemented with dsRNA and tRNA carrier, the nymph of 24 ages in days is tested.Result is rendered as the survival rate % (Figure 15 A-D) in experiment on the 9th.Lh594 and Lh423 have been included in this mensuration as with reference to target.The results are summarized in table 6.Based on concentration curve analysis, by contrasting Lh423 with benchmark relatively by these target classifications.
Table 6: from the novel target of the lygus bug of programmed screening-relatively carry out classification according to DRC and with basic target Lh423 and Lh594.
Figure BDA0000417228660001611
Figure BDA0000417228660001621
example 3 troponin approach screenings
In order to test troponin approach target, synthesized corresponding to the dsRNA of the external generation of Lh619, Lh620, Lh621, Lh622, Lh622, Lh623, Lh624, Lh625 and Lh626 and be administered to beanpod lygus bug in survival analysis biological assay in 10 days.In simple terms, the beanpod lygus bug nymph of an age in days is placed in 96 orifice plates with sucrose sealing, the target dsRNA that these sealings contain 0.5 μ g/ μ l, is supplemented with the yeast tRNA of 5 μ g/ μ l.Under standard lygus bug raising condition, these plates are hatched 3 days.At the 3rd day, the 6th day and the 8th day, with more new feedstuff sealing of the sealing that only contains lygus bug feed.Use Lh594 (Troponin I) as positive control and use GFP dsRNA and sucrose feed as negative control (Figure 13).Then in the dose response curve analysis in measuring in vitro, include four targets in, wherein concentration is in the scope of from 0.4 to 0.025 μ g/ μ l.For every kind of condition, in 96 orifice plates arrange, in the sucrose feed that is supplemented with dsRNA and tRNA carrier, the nymph of 24 ages in days is tested.Result is rendered as the survival rate % (Figure 14 A-B) in experiment on the 10th.
the evaluation of the target gene in example 4 colorado potato beetles
4.1. the normalized cDNA library of colorado potato beetles and prepare dsRNA for screening assay in porous plate
Isolating nucleic acid from the colorado potato beetles larva of different steps.Use SMARTer tMpCR cDNA synthetic agent box, follows the specification sheets (Clontech catalog number (Cat.No.) 634925) of manufacturers and prepares cDNA library.Use Trimmer test kit (Evrogen catalog number (Cat.No.) NK001) that cDNA library is normalized to
Figure BDA0000417228660001622
in carrier (hero).Normalized clone is introduced in M2 fit (Trimmer test kit, Evrogen, SEQ ID NO92:AAGCAGTGGTATCAACGCAG), relatively directed at these clones' place, every one end.Construction of recombinant vector body is converted in coli strain TOP10 (hero's) cell.Subsequently by the cell dilution and the bed board that transform, thereby obtain simple community or clone.Check that these clone to guarantee that clone's redundancy in this storehouse is no more than 5%.Monospecific polyclonal is inoculated in liquid LB (Luria meat soup) substratum in 96 orifice plates, and makes its grow overnight at 37 ℃.These plates also comprise the positive (Ld513) and negative (FP) contrast clone.
In order to produce dsRNA, by PCR, produce the sense and antisense DNA fragmentation that contains T7 promoter sequence.In simple terms, for each clone, based on M2 and T7-M2 sequence, the bacterial suspension of 1 μ l is assigned to and is contained accordingly
Figure BDA0000417228660001631
in the porous PCR plate of (the catalog number (Cat.No.) D4309 of Sigma) and primer oGCC2738 (SEQ ID NO93:AAGCAGTGGTATCAACGCAG) and oGCC2739 (SEQ ID NO94:GCGTAATACGACTCACTATAGGAAGCAGTGGTATCAACGCAG).After PCR reaction, carry out in-vitro transcription, wherein, for each clone, use and containing by RiboMAX tMthe PCR product of 6 μ l in 20 μ l reaction volumes of the transcript reagent that extensive RNA production system-T7 test kit (Pu Luomaige catalog number (Cat.No.) P1300) provides and at 37 ℃ overnight incubation.By final dsRNA solution dilution in aseptic milli-Q water and for screening.Corresponding to positive Ld513 contrast clone's dsRNA, be SEQ ID NO400 (referring to table 9) and be SEQ ID NO104 (referring to table 4) corresponding to negative FP contrast clone's dsRNA.
4.2. use dsRNA to express the novel and effective colorado potato beetles target gene of cDNA library screening
The artificial diet that 0.5mL is contained in each hole of 48 orifice plates, the part of the test of 25 μ l for this feed (or 1 μ g) or contrast dsRNA covers carries out pre-treatment.In each hole, put a L2 larva and 3 larvas of each clone's test.At the 4th day, the 7th day and the 10th day assessment CPB survival number.
In biological assay for the second time, CPB larva is that take with the feed that the test dsRNA of topical application processes is food, and this test dsRNA is clone's generation that origin comes from normalized cDNA library.In a hole of 48 hole porous plates, put a larva, this porous plate covers containing the part of the 40ng/ μ LdsRNA solution of useful 25 μ L the feed that carries out pretreated 0.5mL.Each processing (clone) test is 24 larvas altogether.Number the insect of the 4th day, the 5th day, the 6th day, the 7th day, the 8th day and the 11st day assessment survival.With respect to the 0th day (measure and start), calculate larval mortality per-cent (referring to Figure 21).
4.3. the evaluation of colorado potato beetles beetle target
In colorado potato beetles, identified new target sequence that the screening by 5.2. obtains and corresponding to the target sequence of troponin approach target, these sequences and lygus bug Lh594, Lh619 and Lh620 sequence are straight to homology.Provide the primer of the Related cDNAs fragment of Ld594 to be listed in table 17.Determine the cDNA sequence of these target genes and the aminoacid sequence of deduction and provide respectively in table 7 and 9.
4.4. corresponding to the generation of the dsRNA of the partial sequence of colorado potato beetles target gene
DsRNA as synthetic in the primer being provided in table 9 is provided.The sense strand of the gained dsRNA being produced by these target genes provides in table 9.
4.5. the survival analysis of novel colorado potato beetles target is measured
early larvae is measured
Produced the synthetic dsRNA of Ld594, Ld619 and these 3 targets of Ld620, and in the mensuration of ingesting, CPB larva has been tested to (referring to Figure 16).In 48 orifice plates, at the artificial diet that are supplemented with every hole 1 μ g dsRNA (based on people such as Ge Erman (Gelman), < < insect science magazine > > (JIns Sc), 1:7,1-10: for raising the artificial diet (Artificial diets for rearing the Colorado Potato Beetle) of Colorado colorado potato bug) on, carry out measuring for 10th, wherein 12 larvas of every kind of condition.
Can observe the obvious effect to larvae development.Arrange measure for the second time to study these dsRNA pupate and metamorphosis process during effect (vide infra pupate measure).
pupate to measure
Arrange CPB pupate to measure with research Ld594, Ld619 and Ld620 pupate and period of metamorphosis between RNAi strike low (knock-down) effect.Make the four-age larva external synthetic dsRNA on leaf of potato dish that is distributed in of 1 μ g that ingests, and then transferred in the box that contains untreated fresh potato leaf.After four days, the insect of survival is placed on vermiculite and allows it to pupate.The insect that Lh594 processes more slowly, less, and major part can not experience and pupates.When experiment finishes, the hatching of pupa is assessed.For untreated contrast, 24 larvae pupations and all having hatched into healthy adult.For Ld620, observe the reduced number that advances to the larva pupating.For three tested targets, do not have larva to proceed to healthy pupa and do not occur adult.The dead insect of reclaiming from vermiculite demonstrates deformity (Figure 17) in various degree.
In CPB larva is measured, Ld594, Ld619 and Ld620 are at first with not lethality targeted forms appearance, although the vigor of clearly observing in the insect of processing at dsRNA reduces.On the other hand, in pupating to measure, all 3 targets all induce strong effect and inhibition to enter into pupate and/or the abnormal stage.
adult is measured
In order to assess Ld594, Ld619 and the Ld620 activity in CPB adult, a leaf dish is set and measures.With dsRNA or contrast, apply leaf of potato dish (diameter 1.7cm) and place it in the 3.5cm petri diss with an adult beetle.Second day, provides the leaf dish of fresh processing to these insects.At the 3rd day, adult is transferred in the box that contains enough fresh, untreated leaf of potato to maintain the survival of untreated contrast.For each processing, test 6 adults and from the 6th day to the 13rd day regular interval time the number of survivor and dying insect is counted.If they can not recover normally after placement that insect is lain on the back, it is dying being regarded as so.
Although there is relatively high background level in the negative control in this particular assay, for the insect observation that is exposed to Ld594 or Ld619dsRNA, arrived obvious effect (Figure 18).
the evaluation of the target gene in example 5 brown paddy plant hoppers
5.1. the evaluation of brown paddy plant hopper target
In brown plant hopper (brown paddy plant hopper), identified the new target sequence corresponding to troponin approach target and called after N1594 (Troponin I), N1619 (TnT) and N1626 (TnC).Use BPH cDNA as template, by degenerated primer PCR clone lygus bug gene directly to homologous sequence, these sequence called afters N1594 (Troponin I), N1619 (TnT) and N1625/626 (TnC).In addition, use RACE (referring to above method), identify the full-length cDNA of N1594.Follow the specification sheets of manufacturers and under the standard conditions for degenerated primer PCR reaction, use AmpliTaq Gold PCR system (applying biological system (Applied Biosystems)), these standard conditions are typically as follows: 10 minutes 1 circulation at 95 ℃, then 40 circulations, wherein at 95 ℃ 30 seconds, at 50 ℃ 1 minute and at 72 ℃ 1 minute, then at 72 ℃ 10 minutes.In order to increase success ratio, the straight comparison to homologous sequence based in other species, designs nearly 10 kinds of different degenerated primers (forward and reverse), and is used with different combinations.By gel extraction kit (Kai Jie (Qiagen) catalog number (Cat.No.) 28706), from gel-purified, go out obtained PCR fragment and be cloned into TOPO TA carrier (hero).The Blast search that these clones are checked order and consensus sequence is carried out for the available insect sequences database for different, to determine the cognation of inset.Cause the degenerated primer successfully increasing to be listed in table 18.
Determine these target genes and the DNA sequence dna of another target gene (N1537) and the aminoacid sequence of deduction and provide respectively in table 10 and 11.
5.2. corresponding to the generation of the dsRNA of the partial sequence of brown paddy plant hopper target gene
Use as at table 12 in the primer that provided synthesize dsRNA.The sense strand of the gained dsRNA of each generation from these target genes provides in table 12.
5.3. the survival analysis of novel brown paddy plant hopper target is measured
Synthesize dsRNA and, in the mensuration via the RNAi ingesting, under amphoteric ion type detergent CHAPS O exists, with 0.1% ultimate density, test at the BPH optimizing in advance.Ultimate density test dsRNA with 0.5 μ g/ μ l.Basic target during a kind of effective target N1537 of use in BPH measures measures as this.In the process of 9 days, insect survival rate is assessed.
The result demonstration of biological assay, in BPH, N1594, N1619 and N1626 are also the effective RNAi targets (Figure 19) in BPH.
the evaluation of the target gene in example 6 acyrthosiphum pisims
6.1. the evaluation of acyrthosiphum pisim target
In aphid, identified and made new advances target sequence and to follow identical nomenclature " Apxxx " (wherein " Ap " corresponding to acyrthosiphum pisim and " xxx " ID corresponding to this target), by its called after Ap423, Ap537, Ap560 and Ap594.Based on AphidBase (reference: http:// www.aphidbase.com/) in public domain gene predict to design primer (table 13).
Determine the DNA sequence dna of these target genes and the aminoacid sequence of deduction and provide respectively in table 14 and 15.
6.2. corresponding to the generation of the dsRNA of the partial sequence of aphid target gene
Use is at dsRNA as synthetic in the primer being provided in table 16.The sense strand of the gained dsRNA of each generation in these target genes provides in table 16.
6.3. the survival analysis of novel aphid target is measured
In having the acyrthosiphum pisim (pea aphid) of Ap594, Ap423, these 4 targets of Ap560, Ap537, test is via the RNAi ingesting.The primer that use designs based on public structural domain sequence information (http://www.aphidbase.com) and the cDNA preparing from aphid, carry out extension increasing sequence by PCR.Prepare synthetic dsRNA and in sucrose feed with the ultimate density of 0.5 μ g/ μ l, under the yeast tRNA of 5 μ g/ μ l exists, test.Ten newborn pea aphid nymphs are placed in a little petri diss (32mm).The feed of 50 microlitres (having tRNA and dsRNA) is pipetted with transfer pipet on the top of the first layer Parafilm.Second layer Parafilm has covered feed and has produced the pouch of ingesting, and aphid can ingest therein.For each target, repeat for five times that are provided with 10 newborn nymphs.Use GFP dsRNA as negative control.The new feedstuff and assess survival rate (Figure 20) more the 4th day that measures and the 7th day.
Table 2
Target ID CDNA sequence (sense strand) 5 ' → 3 '
Lh594 SEQ ID NO1
Lh609 SEQ ID NO3
Lh610 SEQ ID NO5
Lh610(b) SEQ ID NO139
Lh611 SEQ ID NO7
Lh611(b) SEQ ID NO140
Lh617 SEQ ID NO9
Lh618 SEQ ID NO11
Lh618(b) SEQ ID NO141
Lh429 SEQ ID NO13
Lh423 SEQ ID NO95
Lh105.2 SEQ ID NO96
Lh560 SEQ ID NO15
Lh615 SEQ ID NO17
Lh612 SEQ ID NO19
Lh246 SEQ ID NO21
Lh597 SEQ ID NO23
Lh598 SEQ ID NO25
Lh619 SEQ ID NO121
Lh619(b) SEQ ID NO142
Lh619(c) SEQ ID NO143
Lh620 SEQ ID NO122
Lh620(b) SEQ ID NO144
Lh620(c) SEQ ID NO145
Lh621 SEQ ID NO123
Lh622 SEQ ID NO124
Lh623 SEQ ID NO125
Lh623(b) SEQ ID NO146
Lh624 SEQ ID NO126
Lh624(b) SEQ ID NO147
Lh625 SEQ ID NO127
Lh625(b) SEQ ID NO148
Lh626 SEQ ID NO128
Lh626(b) SEQ ID NO149
Lh614 SEQ ID NO129
Lh627 SEQ ID NO150
[0383]
Lh628 SEQ ID NO152
Lh629 SEQ ID NO154
Lh630 SEQ ID NO156
Lh631 SEQ ID NO158
Lh632 SEQ ID NO160
Lh633.1 SEQ ID NO162
Lh633.2 SEQ ID NO163
Lh634.1 SEQ ID NO165
Lh634.2 SEQ ID NO167
Lh595.1 SEQ ID NO168
Lh595.2 SEQ ID NO170
Lh596 SEQ ID NO172
Table 3
Target ID As the cDNA clone's who is presented in table 2 corresponding aminoacid sequence
Lh594 SEQ ID NO79
Lh609 SEQ ID NO80
Lh610 SEQ ID NO81
Lh610(b) SEQ ID NO326
Lh611 SEQ ID NO82
Lh611(b) SEQ ID NO327
Lh617 SEQ ID NO83
Lh618 SEQ ID NO84
Lh618(b) SEQ ID NO328
Lh429 SEQ ID NO85
Lh429(b) SEQ ID NO329
Lh423 SEQ ID NO99
Lh105.2 SEQ ID NO100
Lh560 SEQ ID NO86
Lh615 SEQ ID NO87
Lh612 SEQ ID NO88
Lh246 SEQ ID NO89
Lh597 SEQ ID NO90
Lh598 SEQ ID NO91
Lh619 SEQ ID NO330
Lh620 SEQ ID NO331
Lh621 SEQ ID NO332
Lh622 SEQ ID NO333
Lh623 SEQ ID NO334
Lh624 SEQ ID NO335
Lh625 SEQ ID NO336
Lh626 SEQ ID NO337
Lh614 SEQ ID NO338
[0386]
Lh627 SEQ ID NO339
Lh628 SEQ ID NO340
Lh629 SEQ ID NO341
Lh630 SEQ ID NO342
Lh631 SEQ ID NO343
Lh632 SEQ ID NO344
Lh633.1 SEQ ID NO345
Lh633.2 SEQ ID NO346
Lh634.1 SEQ ID NO347
Lh634.2 SEQ ID NO348
Table 4
Figure BDA0000417228660001701
Figure BDA0000417228660001721
Table 7
Figure BDA0000417228660001731
Table 8
Target ID As the cDNA clone's who is presented in table 9 corresponding aminoacid sequence
Ld594 SEQ ID NO349
Ld619 SEQ ID NO350
Ld620 SEQ ID NO351
Ld583 SEQ ID NO390
Ld584 SEQ ID NO391
Ld586 SEQ ID NO392
Ld588 SEQ ID NO393
Ld513 SEQ ID NO395
Table 9
Figure BDA0000417228660001732
Table 10
Target ID CDNA sequence (sense strand) 5 ' → 3 '
N1594 SEQ ID NO180
N1619 SEQ ID NO182
N1626 SEQ ID NO184
N1537 SEQ ID NO186
Table 11
Target ID As the cDNA clone's who is presented in table 12 corresponding aminoacid sequence
N1594 SEQ ID NO352
N1619 SEQ ID NO353
N1626 SEQ ID NO354
N1537 SEQ ID NO355
Table 12
Figure BDA0000417228660001742
Table 13
Target Forward primer sequence Reverse primer sequence
Ap594 SEQ ID NO369 SEQ ID NO370
Ap423 SEQ ID NO371 SEQ ID NO372
Ap537 SEQ ID NO373 SEQ ID NO374
Ap560 SEQ ID NO375 SEQ ID NO376
Table 14
Target ID CDNA sequence (sense strand) 5 ' → 3 '
Ap594 SEQ ID NO188
Ap423 SEQ ID NO200
Ap537 SEQ ID NO202
Ap560 SEQ ID NO204
Table 15
Target ID As the cDNA clone's who is presented in table 16 corresponding aminoacid sequence
Ap594 SEQ ID NO356
Ap423 SEQ ID NO357
Ap537 SEQ ID NO358
Ap560 SEQ ID NO359
Table 16
Figure BDA0000417228660001751
Figure BDA0000417228660001761
Table 17
Target Forward primer Reverse primer
Ld594 SEQ ID NO377 SEQ ID NO378
Table 18
Target Forward primer Reverse primer
N1594 seq id no379 seq id no380
N1619 seq id no381 seq id no382
N1626 seq id no383 seq id no384
Table 19
Target ID Best fruit bat is hit Title Symbol
Ld583 CG4759 Ribosomal protein L 27 RpL27
Ld584 CG17331 Proteasome ，β type subunit
Ld586 CG13704 Unknown
Ld588 CG4157 Rpn12
Table 20
Figure BDA0000417228660001762
*unclear: in section, to have a plurality of hitting
Table 21
Target ID Best fruit bat is hit Title Symbol
Ap594 CG7178 Wings up A (Troponin I) wup A
Ap423 CG2746 Ribosomal protein L 19 RpL19
Ap537 CG32744 Ubiquitin-5E; Protein modified process
Ap560 CG10423 Ribosomal protein s27 Rp527
One skilled in the art will appreciate that in the situation that do not depart from the spirit and scope of this mensuration as usually described, can make multiple variation and/or modification to mensuration mentioned above.Those skilled in the art will recognize that or only use normal experiment just can determine a plurality of equivalents of these specific exampless, and these equivalents expections are contained by the present invention.Therefore, example of the present invention is all considered to illustrative and not restrictive in all respects.
Figure IDA0000417228700000021
Figure IDA0000417228700000041
Figure IDA0000417228700000051
Figure IDA0000417228700000061
Figure IDA0000417228700000071
Figure IDA0000417228700000081
Figure IDA0000417228700000091
Figure IDA0000417228700000111
Figure IDA0000417228700000121
Figure IDA0000417228700000131
Figure IDA0000417228700000141
Figure IDA0000417228700000151
Figure IDA0000417228700000161
Figure IDA0000417228700000171
Figure IDA0000417228700000181
Figure IDA0000417228700000191
Figure IDA0000417228700000201
Figure IDA0000417228700000211
Figure IDA0000417228700000221
Figure IDA0000417228700000231
Figure IDA0000417228700000251
Figure IDA0000417228700000261
Figure IDA0000417228700000271
Figure IDA0000417228700000291
Figure IDA0000417228700000301
Figure IDA0000417228700000311
Figure IDA0000417228700000321
Figure IDA0000417228700000331
Figure IDA0000417228700000341
Figure IDA0000417228700000351
Figure IDA0000417228700000361
Figure IDA0000417228700000371
Figure IDA0000417228700000381
Figure IDA0000417228700000391
Figure IDA0000417228700000401
Figure IDA0000417228700000411
Figure IDA0000417228700000421
Figure IDA0000417228700000441
Figure IDA0000417228700000451
Figure IDA0000417228700000461
Figure IDA0000417228700000471
Figure IDA0000417228700000481
Figure IDA0000417228700000491
Figure IDA0000417228700000501
Figure IDA0000417228700000521
Figure IDA0000417228700000531
Figure IDA0000417228700000541
Figure IDA0000417228700000551
Figure IDA0000417228700000571
Figure IDA0000417228700000581
Figure IDA0000417228700000591
Figure IDA0000417228700000601
Figure IDA0000417228700000611
Figure IDA0000417228700000621
Figure IDA0000417228700000631
Figure IDA0000417228700000641
Figure IDA0000417228700000651
Figure IDA0000417228700000661
Figure IDA0000417228700000671
Figure IDA0000417228700000681
Figure IDA0000417228700000691
Figure IDA0000417228700000721
Figure IDA0000417228700000731
Figure IDA0000417228700000741
Figure IDA0000417228700000751
Figure IDA0000417228700000811
Figure IDA0000417228700000821
Figure IDA0000417228700000831
Figure IDA0000417228700000841
Figure IDA0000417228700000861
Figure IDA0000417228700000871
Figure IDA0000417228700000881
Figure IDA0000417228700000891
Figure IDA0000417228700000901
Figure IDA0000417228700000911
Figure IDA0000417228700000921
Figure IDA0000417228700000931
Figure IDA0000417228700000951
Figure IDA0000417228700000961
Figure IDA0000417228700000971
Figure IDA0000417228700000981
Figure IDA0000417228700000991
Figure IDA0000417228700001011
Figure IDA0000417228700001021
Figure IDA0000417228700001031
Figure IDA0000417228700001041
Figure IDA0000417228700001051
Figure IDA0000417228700001061
Figure IDA0000417228700001071
Figure IDA0000417228700001081
Figure IDA0000417228700001101
Figure IDA0000417228700001111
Figure IDA0000417228700001131
Figure IDA0000417228700001141
Figure IDA0000417228700001161
Figure IDA0000417228700001171
Figure IDA0000417228700001181
Figure IDA0000417228700001191
Figure IDA0000417228700001211
Figure IDA0000417228700001221
Figure IDA0000417228700001231
Figure IDA0000417228700001241
Figure IDA0000417228700001251
Figure IDA0000417228700001261
Figure IDA0000417228700001291
Figure IDA0000417228700001301
Figure IDA0000417228700001331
Figure IDA0000417228700001341
Figure IDA0000417228700001351
Figure IDA0000417228700001371
Figure IDA0000417228700001381
Figure IDA0000417228700001391
Figure IDA0000417228700001401

Claims (49)

1. a disturbance ribonucleic acid (RNA), this disturbance ribonucleic acid plays the effect of the expression of lowering a kind of target gene in described insect pest after being taken in by a kind of insect pest species,
Wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in a target nucleotide sequences at least in part a complementary nucleotide sequence or consisting of, and
This target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 1152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any in 389 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389 is consistent.
2. RNA interfering as claimed in claim 1, wherein this silencing elements comprise with this target gene in target nucleotide sequences sequence complementary or complementary at least 21 continuous nucleotides at least in part or consisting of.
3. as claim 1 or RNA interfering claimed in claim 2, wherein this RNA comprises at least two silencing elements, wherein each silencing elements comprise with a kind of target gene in a target nucleotide sequences at least in part a complementary nucleotide sequence or consisting of.
4. RNA interfering as claimed in claim 3, wherein different nucleotide sequence of each self-contained target nucleotide sequences complementation different from of these silencing elements or consisting of.
5. RNA interfering as claimed in claim 4, wherein these different target nucleotide sequences derive from single target gene or derive from different target genes.
6. RNA interfering as claimed in claim 5, wherein these different target genes derive from identical insect pest species or different insect pest species.
7. the RNA interfering as described in any one in claim 1 to 6, wherein these insect pest species are a kind of plant insects.
8. RNA interfering as claimed in claim 7, wherein this plant insect is to be selected from a kind of insect pest species that belong to following object insect species: Coleoptera, Hemiptera, lepidopteran, Diptera, Dictyoptera, Orthoptera and Siphonaptera.
9. RNA interfering as claimed in claim 8, wherein this insect plant insect is selected from lower group, and this group is comprised of the following: colorado potato beetles belong to (for example colorado potato beetles (Colorado colorado potato bug), pseudo-colorado potato beetles (pseudo-colorado potato bug) or Thory Elaeagnus Leaf eggplant chrysomelid (the pseudo-colorado potato bug in Texas)); Brown paddy plant hopper belongs to (for example brown paddy plant hopper (brown plant hopper)); Lygus bug belongs to (for example tarnished plant bug (without damp fleahopper) or beanpod lygus bug (west is without damp fleahopper)); Tumor aphid genus (for example black peach aphid (green black peach aphid)); (for example west Zea mays root firefly chrysomelid (west corn rootworm), Pasteur's root firefly chrysomelid (northern corn rootworm), cucumber 11 asterophyllite first are eaten root subspecies (southern corn rootworm), zea mexicana root firefly chrysomelid (zea mexicana rootworm) to root Galeruca.
10. the RNA interfering as described in any one in claim 1 to 10, wherein this target gene coding is selected from a kind of insect protein of lower group, this group comprises that (i) is from a kind of protein of troponin/myofilament mixture, this mixture is selected from lower group, and this group comprises Troponin I (for example a kind of insect straight homologues of CG7178Dm albumen), support albumen (for example a kind of insect straight homologues of CG7107Dm albumen), tropomyosin 1 albumen (for example a kind of insect straight homologues of CG4898Dm albumen), tropomyosin 2 albumen (for example a kind of insect straight homologues of CG4843Dm albumen), myoglobulin heavy chain (for example a kind of insect straight homologues of CG17927Dm albumen), myosin light chain cytoplasm protein (for example a kind of insect straight homologues of CG3201Dm albumen), shark's fin melon albumen (for example a kind of insect straight homologues of CG3595Dm albumen), zipper protein (for example a kind of insect straight homologues of CG15792Dm albumen), TnC (CG2981 for example, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, a kind of insect straight homologues of CG12408 or CG6514Dm albumen), (ii) be selected from a kind of insect ribosomal protein of lower group, this group comprises ribosomal protein S3A (for example a kind of insect straight homologues of CG2168Dm albumen), ribosomal protein L P1 (for example a kind of insect straight homologues of CG4087Dm albumen), ribosomal protein S3 (for example a kind of insect straight homologues of CG6779Dm albumen), ribosomal protein L 10Ab (for example a kind of insect straight homologues of CG7283Dm albumen), ribosomal protein S1 8 (for example a kind of insect straight homologues of CG8900Dm albumen), ribosomal protein L 4 (for example a kind of insect straight homologues of CG5502Dm albumen), ribosomal protein S27 (for example a kind of insect straight homologues of CG10423Dm albumen), Ribosomal protein L6 (for example a kind of insect straight homologues of CG11522Dm albumen), ribosomal protein S1 3 (for example a kind of insect straight homologues of CG13389Dm albumen) and ribosomal protein L 12 (for example a kind of insect straight homologues of CG3195Dm albumen), ribosomal protein L 26 (for example a kind of insect straight homologues of CG6846Dm albumen), ribosomal protein L 21 (for example a kind of insect straight homologues of CG12775Dm albumen), ribosomal protein S1 2 (for example a kind of insect straight homologues of CG11271Dm albumen), ribosomal protein S28b (for example a kind of insect straight homologues of CG2998Dm albumen), ribosomal protein L 13 (for example a kind of insect straight homologues of CG4651Dm albumen), ribosomal protein L 10 (for example a kind of insect straight homologues of CG17521Dm albumen), ribosomal protein L 5 (for example a kind of insect straight homologues of CG17489Dm albumen), ribosomal protein S1 5Aa (for example a kind of insect straight homologues of CG2033Dm albumen), ribosomal protein L 19 (for example a kind of insect straight homologues of CG2746Dm albumen), ribosomal protein L 27 (for example a kind of insect straight homologues of CG4759Dm albumen), (iii) mitochondrial cytochrome c oxidase subunit II albumen (for example a kind of insect straight homologues of CG34069Dm albumen), (iv) atp synthase-γ chain (for example a kind of insect straight homologues of CG7610Dm albumen), (v) ubiquitin-5E (for example a kind of insect straight homologues of CG32744Dm albumen), (vi) proteasome beta type subunit (for example a kind of insect straight homologues of CG17331Dm albumen), (vii) as the protein of a kind of insect straight homologues of CG13704Dm albumen, and (viii) Rpn12 albumen (for example a kind of insect straight homologues of CG4157Dm albumen).
11. the RNA interfering as described in any one in claim 1 to 10, wherein as be exposed to a kind of disturbance ribonucleic acid of target dispensable gene or a kind of pest species of the disturbance ribonucleic acid that does not cut any gene in this pest species is compared, the expression of lowering this target gene causes that the growth of this insect, growth, reproduction or survival decline.
12. 1 kinds of polynucleotide, a kind of nucleotide sequence that comprises the RNA interfering of coding as described in any one in claim 1 to 11.
13. polynucleotide as claimed in claim 12, these polynucleotide are comprised in a DNA construct.
14. DNA construct as claimed in claim 13, this DNA construct is a kind of expression construct, this polynucleotide sequence of this RNA interfering of wherein encoding is operably connected to the regulating and controlling sequence that at least one can drive the expression of this polynucleotide sequence.
15. 1 kinds of host cells, comprise the RNA interfering as described in any one in claim 1 to 11, polynucleotide as claimed in claim 12 or the DNA construct as described in claim 13 or 14.
16. host cells as claimed in claim 15, wherein this host cell is a kind of prokaryotic cell prokaryocyte or a kind of eukaryotic cell.
17. host cells as claimed in claim 16, wherein this host cell is a kind of bacterial cell.
18. one kind for preventing and/or control the composition that insect pest is invaded and harassed, said composition comprises at least one disturbance ribonucleic acid (RNA) and carrier, vehicle or thinner that at least one is suitable, wherein this RNA interfering plays the effect of the expression of lowering a kind of target gene in described insect after being taken in by this insect
Wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in a target nucleotide sequences at least in part a complementary nucleotide sequence or consisting of, and
This target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 1186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 1130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any in 389 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389 is consistent.
19. compositions as claimed in claim 18, wherein this RNA interfering is as defined in any one in claim 1 to 11.
20. compositions as described in claim 18 or claim 19, wherein this RNA interfering is coded by the DNA construct as described in claim 13 or claim 14.
21. compositions as described in any one in claim 18 to 20, said composition comprises a kind of expression maybe can express the host cell of this RNA interfering.
22. compositions as claimed in claim 21, wherein this host cell is a kind of bacterial cell.
23. compositions as described in any one in claim 18 to 22, wherein said composition is to be a kind of form of being absorbed by a kind of insect of being suitable for.
24. compositions as described in any one in claim 18 to 23, wherein said composition is to be solid, liquid or gel form.
25. compositions as described in any one in claim 18 to 24, wherein said composition is configured to a kind of insect sprays of killing.
26. compositions as claimed in claim 25, wherein this sprays is the agent of a kind of pressurization/atomisation or a kind of pump formula sprays.
27. the composition as described in any one in claim 18 to 26, wherein said composition comprises at least one sterilant in addition, this sterilant is selected from lower group, and this group is comprised of the following: a kind of chemical insecticide, a kind of potato tuber differential protein, a kind of bacillus thuringiensis insecticidal proteins, a kind of Xenorhabdus insecticidal proteins, a kind of smooth rod bacterium insecticidal proteins, a kind of bacillus laterosporus insecticidal proteins and a kind of Bacillus sphaericus insecticidal proteins.
28. compositions as claimed in claim 27, wherein said bacillus thuringiensis insecticidal proteins is selected from lower group, and this group is comprised of the following: the combination of Cry1, Cry3, TIC851, CryET170, Cry22, TIC901, TIC201, TIC407, TIC417, binary insecticidal proteins CryET80 and CryET76, binary insecticidal proteins TIC100 and TIC101, insecticidal proteins ET29 or ET37 and insecticidal proteins TIC810 or TIC812 and binary insecticidal proteins PS149B1.
29. 1 kinds of housings for insect pest or grabber, this housing or grabber comprise the composition as described in any one in claim 18 to 28.
30. 1 kinds according to the purposes of the composition described in any one in claim 18 to 28, and said composition is invaded and harassed for prevention and/or Control pests.
31. 1 kinds according to the purposes of the composition described in any one in claim 18 to 28, and said composition is used as for a kind of plant or for a kind of sterilant of the breeding of the reproductive material of a kind of plant.
32. 1 kinds for the combination preventing and/or Control pests is invaded and harassed, and this combination comprises composition and at least one other promoting agent as described in any one in claim 18 to 28.
33. combinations as claimed in claim 32, wherein this combination is to be a kind of agronomy reagent for infest and this other promoting agents of preventing and/or control a kind of plant.
34. combination as claimed in claim 33, wherein this agronomy reagent comprises a kind of weedicide.
35. combinations as claimed in claim 34, wherein this weedicide is selected from 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) of the insensitive pattern of a kind of glyphosate; A kind of catabolic enzymes that can decompose dicamba 98, as dicamba monooxygenase enzyme; Maybe can make the catabolic a kind of careless fourth phosphinothricin acetyl transferase gene of careless ammonium phosphine.
36. combinations as claimed in claim 33, wherein this agronomy pack is containing a kind of the second sterilant.
37. combinations as claimed in claim 36, wherein this second sterilant is selected from lower group, and this group is comprised of the following: a kind of chemical insecticide, a kind of potato tuber differential protein, a kind of bacillus thuringiensis insecticidal proteins, a kind of Xenorhabdus insecticidal proteins, a kind of smooth rod bacterium insecticidal proteins, a kind of bacillus laterosporus insecticidal proteins and a kind of Bacillus sphaericus insecticidal proteins.
38. combinations as claimed in claim 37, wherein said bacillus thuringiensis insecticidal proteins is selected from lower group, and this group is comprised of the following: the combination of Cry1, Cry3, TIC851, CryET170, Cry22, T1C901, TIC201, TIC407, TIC417, binary insecticidal proteins CryET80 and CryET76, binary insecticidal proteins TIC100 and TIC101, insecticidal proteins ET29 or ET37 and insecticidal proteins TIC810 or TIC812 and binary insecticidal proteins PS149B1.
39. 1 kinds for the expression of target gene of lowering insect pest species so that the method that prevention and/or Control pests are invaded and harassed, the method comprises makes described pest species contact with at least one disturbance ribonucleic acid (RNA) of a kind of significant quantity, wherein this RNA interfering plays the effect of lowering a kind of expression of target gene in described insect after being taken in by this insect
Wherein this RNA comprises at least one silencing elements, wherein this silencing elements is a double-stranded RNA region of the complementary strand that comprises annealing, wherein chain comprise with this target gene in a target nucleotide sequences at least in part a complementary nucleotide sequence or consisting of
And this target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1-26, 121-205, 386-389, 394, 400 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when any in 389 compared best and compares, described nucleotide sequence and SEQ ID NO1-26, 121-205, 386-389, 394, 400 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 111, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any in 389 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 1151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389 is consistent.
40. methods as claimed in claim 39, wherein this RNA interfering is as defined in any one in claim 1 to 11.
41. methods as described in claim 39 or claim 40, wherein as the disturbance ribonucleic acid with the nonessential insect gene of a kind of target (RNA) or a kind of not as described in the contrast insect pest that contacts of the target gene of expressing in insect compare, the downward of the expression of a kind of target gene in a kind of insect pest species is used to obtain that at least 20% insect is controlled or at least 20% Mortality of insect.
42. methods as described in any one in claim 39 to 41, wherein the method is used to prevention and/or controls the infest of a kind of plant.
43. methods as claimed in claim 42, wherein this plant is selected from lower group, and this group comprises that cotton, potato, paddy rice, Kano are drawn, Sunflower Receptacle, Chinese sorghum, pearl millet, corn, strawberry, soya bean, clover, tomato, eggplant, pepper and tobacco.
The purposes of 44. 1 kinds of disturbance ribonucleic acid (RNA), the DNA construct as described in claim 13 or claim 14 or compositions as described in any one in claim 18 to 28 as described in any one in claim 1 to 11, invades and harasses for prevention and/or control insect pest.
45. 1 kinds for preventing and/or controlling the test kit that insect pest is invaded and harassed, and this test kit comprises disturbance ribonucleic acid (RNA), the DNA construct as described in claim 13 or claim 14 or the composition as described in any one in claim 18 to 28 as described in any one in claim 1 to 11.
46. 1 kinds of separated polynucleotide, are selected from lower group, and this group is comprised of the following:
(i) comprise as by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in a kind of polynucleotide of at least 21 continuous nucleotides of any represented a kind of nucleotide sequence, or
(ii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any in a kind of polynucleotide of at least 21 continuous nucleotides of represented a kind of nucleotide sequence, thus when comparing best and relatively during two kinds of sequences, described polynucleotide and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any is at least 75% consistent, or
(iii) comprise as at SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any in a kind of polynucleotide of fragment of at least 21 continuous nucleotides of represented a kind of nucleotide sequence, and wherein said fragment or described complementary sequence have a kind of nucleotide sequence, when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, when the respective segments in any in 389 is compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) encode a kind of a kind of polynucleotide of aminoacid sequence, when comparison best and relatively during two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, any coded aminoacid sequence at least 85% in 389 is consistent, and wherein said polynucleotide are no longer than 10000 Nucleotide.
47. according to the RNA interfering described in any one in claim 1 to 10, polynucleotide as described in claim 12 or claim 13, DNA construct as claimed in claim 14, host cell as described in any one in claim 15 to 17, composition as described in any one in claim 18 to 28, housing as claimed in claim 29 or grabber, as claim 30, purposes in 31 or 44 described in any one, combination as described in any one in claim 32 to 38, method as described in any one in claim 39 to 43, the polynucleotide of test kit as claimed in claim 45 or separation as claimed in claim 46, this target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when any in 230 to 233 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, when the respective segments in any in 230 to 233 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, any in 230 to 233 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, any coded aminoacid sequence at least 85% in 230 to 233 is consistent.
48. according to the RNA interfering described in any one in claim 1 to 10, polynucleotide as described in claim 12 or claim 13, DNA construct as claimed in claim 14, host cell as described in any one in claim 15 to 17, composition as described in any one in claim 18 to 28, housing as claimed in claim 29 or grabber, as claim 30, purposes in 31 or 44 described in any one, combination as described in any one in claim 32 to 38, method as described in any one in claim 39 to 43, the polynucleotide of test kit as claimed in claim 45 or separation as claimed in claim 46, this target gene wherein
(i) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and relatively during two kinds of sequences, this nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that when by the described gene that comprises described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when any in 270 to 273 compared best and compares, described nucleotide sequence and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein when by described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, when the respective segments in any in 270 to 273 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and relatively during this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, any in 270 to 273 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence with by SEQ ID NO3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, any coded aminoacid sequence at least 85% in 270 to 273 is consistent.
49. according to the RNA interfering described in any one in claim 1 to 10, polynucleotide as described in claim 12 or claim 13, DNA construct as claimed in claim 14, host cell as described in any one in claim 15 to 17, composition as described in any one in claim 18 to 28, housing as claimed in claim 29 or grabber, as claim 30, purposes in 31 or 44 described in any one, combination as described in any one in claim 32 to 38, method as described in any one in claim 39 to 43, the polynucleotide of test kit as claimed in claim 45 or separation as claimed in claim 46, this target gene wherein
(i) be selected from the group of following gene, these genes have comprise SEQ ID NO1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313 or its complementary sequence in any a kind of nucleotide sequence, or there is a kind of nucleotide sequence so that when comparing best and compare two kinds of sequences, this nucleotide sequence and SEQ ID NO1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313 or its complementary sequence in any is at least 75% consistent, or
(ii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, or there is a kind of nucleotide sequence so that work as the described gene that comprises described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when any in 310 to 313 compared best and compares, described nucleotide sequence and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any is at least 75% consistent, or
(iii) be selected from the group of following gene, these genes have the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence of fragment of at least 21 continuous nucleotides, and wherein work as described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, when the respective segments in any in 310 to 313 is compared best and compares, the described nucleotide sequence of described fragment and SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any described respective segments at least 75% consistent, or
(iv) be a kind of a kind of insect pest straight homologues of gene, this gene has the SEQ of comprising ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 or its complementary sequence in any a kind of nucleotide sequence, wherein two kinds of orthologous genes make when comparing best and compare this two kinds of genes at the similarity degree aspect sequence, the sequence that this straight homologues has with by SEQ ID NO1, 174, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, any in 310 to 313 represented sequences is at least 75% consistent, or
(v) be selected from the group of following gene, these genes have a kind of nucleotide sequence of a kind of aminoacid sequence of coding, when comparing best and comparing two seed amino acid sequences, this aminoacid sequence is consistent with any the coded aminoacid sequence at least 85% in SEQ ID NO1,174,180,188,2,175,181,189,27 to 30,282 to 285,294 to 297,310 to 313.
CN201280024260.1A 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest Expired - Fee Related CN103562394B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910766343.1A CN110452908A (en) 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201161477371P 2011-04-20 2011-04-20
US61/477,371 2011-04-20
US201161508826P 2011-07-18 2011-07-18
US61/508,826 2011-07-18
PCT/EP2012/057332 WO2012143542A1 (en) 2011-04-20 2012-04-20 Down-regulating gene expression in insect pests

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201910766343.1A Division CN110452908A (en) 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest

Publications (2)

Publication Number Publication Date
CN103562394A true CN103562394A (en) 2014-02-05
CN103562394B CN103562394B (en) 2019-09-03

Family

ID=46146824

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201280024284.7A Expired - Fee Related CN103562395B (en) 2011-04-20 2012-04-20 Insect pest is had the plant of resistance
CN201910766343.1A Pending CN110452908A (en) 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest
CN201280024260.1A Expired - Fee Related CN103562394B (en) 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest

Family Applications Before (2)

Application Number Title Priority Date Filing Date
CN201280024284.7A Expired - Fee Related CN103562395B (en) 2011-04-20 2012-04-20 Insect pest is had the plant of resistance
CN201910766343.1A Pending CN110452908A (en) 2011-04-20 2012-04-20 The down-regulation of gene expression in insect pest

Country Status (12)

Country Link
US (5) US9845479B2 (en)
EP (4) EP2699685B1 (en)
CN (3) CN103562395B (en)
AU (4) AU2012245135B2 (en)
CA (2) CA2833083A1 (en)
CL (2) CL2013003027A1 (en)
ES (2) ES2668630T3 (en)
MX (4) MX357192B (en)
PT (2) PT2699686T (en)
RU (3) RU2671143C2 (en)
WO (2) WO2012143543A2 (en)
ZA (2) ZA201307477B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110923240A (en) * 2019-12-21 2020-03-27 山西省农业科学院植物保护研究所 Function of insect adult disc growth factor and application of dsRNA (double-stranded ribonucleic acid) thereof

Families Citing this family (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8097712B2 (en) 2007-11-07 2012-01-17 Beelogics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
AU2012245135B2 (en) 2011-04-20 2017-04-13 Devgen Nv Plants resistant to insect pests
EP2734623B1 (en) * 2011-07-18 2018-04-04 Devgen NV Plants resistant to insect pests
AR095275A1 (en) * 2013-03-13 2015-09-30 E I Dupont De Nemours & Company COMPOSITIONS AND METHODS FOR INSECTICIDE CONTROL OF BUGS
WO2014150914A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2015010026A2 (en) * 2013-07-19 2015-01-22 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
EP3032942B1 (en) 2013-08-16 2020-03-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
UA120598C2 (en) 2013-09-13 2020-01-10 Піонір Хай-Бред Інтернешнл, Інк. Insecticidal proteins and methods for their use
WO2015042556A1 (en) 2013-09-23 2015-03-26 Georgia Tech Research Corporation Targeting non-coding rna for rna interference
BR112016018287A2 (en) 2014-02-07 2017-10-10 Du Pont insecticide proteins and methods for their use
RU2016139492A (en) 2014-03-12 2018-04-12 Дзе Юниверсити Оф Сидней RNA PRODUCTION IN HIGHER PLANTS
EP3125676A4 (en) * 2014-04-01 2018-02-14 Monsanto Technology LLC Compositions and methods for controlling insect pests
CN103907530B (en) * 2014-04-04 2016-03-02 河北省农林科学院谷子研究所 A kind of anti-aphid Sorghum Breeding method
US10450583B2 (en) * 2014-04-23 2019-10-22 The Regents Of The University Of California Compositions and methods for controlling pests
WO2016061206A1 (en) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
TW201629222A (en) * 2014-12-16 2016-08-16 陶氏農業科學公司 Parental RNAi suppression of hunchback gene to control hemipteran pests
TW201629221A (en) * 2014-12-16 2016-08-16 陶氏農業科學公司 Parental RNAi suppression of KRUPEL GENE to control hemipteran pests
RU2017144238A (en) 2015-05-19 2019-06-19 Пайонир Хай-Бред Интернэшнл, Инк. INSECTICIDAL PROTEINS AND METHODS OF THEIR APPLICATION
US10647995B2 (en) 2015-06-16 2020-05-12 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
US11198709B2 (en) 2015-08-06 2021-12-14 E. I. Du Pont De Nemours And Company Plant derived insecticidal proteins and methods for their use
WO2017052087A1 (en) 2015-09-25 2017-03-30 주식회사 엘지화학 Carbon nanotube dispersion liquid and manufacturing method thereof
MX2018004475A (en) 2015-10-12 2018-05-11 Pioneer Hi Bred Int Biologicals and their use in plants.
AU2016337355B2 (en) * 2015-10-12 2019-09-26 Dow Agrosciences Llc WupA nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CA3002995A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CA3018384A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CA3023483C (en) 2016-05-16 2024-01-16 Danisco Us Inc. Entomopathogenic products, metarhizium anisopliae or metarhizium robertsii
CN109312359A (en) 2016-06-16 2019-02-05 先锋国际良种公司 To prevent and treat the composition and method of insect pest
CN116334123A (en) 2016-06-24 2023-06-27 先锋国际良种公司 Plant regulating element and method of use thereof
RU2019102714A (en) 2016-07-01 2020-08-03 Пайонир Хай-Бред Интернэшнл, Инк. INSECTICIDE PROTEINS FROM PLANTS AND METHODS OF THEIR APPLICATION
US20210292778A1 (en) 2016-07-12 2021-09-23 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
AR109205A1 (en) * 2016-08-05 2018-11-07 Syngenta Participations Ag PATHOPE CONTROL OF COLEOPTERS USING RNA MOLECULES
CR20190130A (en) 2016-08-17 2019-05-07 Monsanto Technology Llc Methods and compositions for short stature plants through manipulation of gibberellin metabolism to increase harvestable yield
WO2018046312A2 (en) * 2016-09-06 2018-03-15 Syngenta Participations Ag Improvements in or relating to gene silencing
TWI739888B (en) * 2016-10-07 2021-09-21 美商陶氏農業科學公司 Pesticidal compositions and methods
AR109844A1 (en) 2016-10-27 2019-01-30 Syngenta Participations Ag INSECTED PROTEINS
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
MX2019007491A (en) 2016-12-22 2019-09-06 Pioneer Hi Bred Int Insecticidal proteins and methods for their use.
JP7264815B2 (en) 2017-01-12 2023-04-25 モンサント テクノロジー エルエルシー Pesticidal toxic proteins with activity against LEPIDOPTERAN insects
WO2018136336A1 (en) * 2017-01-18 2018-07-26 Neuropro Technologies, Inc. Bone fusion device
WO2018140214A1 (en) 2017-01-24 2018-08-02 Pioneer Hi-Bred International, Inc. Nematicidal protein from pseudomonas
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
US20180265871A1 (en) * 2017-03-16 2018-09-20 Dow Agrosciences Llc Ribosomal nucleic acid molecules to control insect pests
CN110621780B (en) 2017-05-11 2024-03-19 先锋国际良种公司 Insecticidal proteins and methods of use thereof
US20200165626A1 (en) 2017-10-13 2020-05-28 Pioneer Hi-Bred International, Inc. Virus-induced gene silencing technology for insect control in maize
GB201718701D0 (en) * 2017-11-13 2017-12-27 Syngenta Participations Ag Improvements in or relating to gene silencing
GB201719680D0 (en) 2017-11-27 2018-01-10 Devgen Nv Improvements in or relating to gene silencing
EP3740070A1 (en) 2018-01-18 2020-11-25 Pioneer Hi-Bred International Inc. Alginate encapsulation of fungal microsclerotia
CA3091431A1 (en) 2018-02-26 2019-08-29 Devgen Nv Control of insect pests using rna molecules
WO2019169150A1 (en) 2018-03-02 2019-09-06 Pioneer Hi-Bred International, Inc. Plant health assay
WO2019206780A1 (en) 2018-04-27 2019-10-31 Devgen Nv Control of insect pests using rna molecules
BR112020023800A2 (en) 2018-05-22 2021-02-23 Pioneer Hi-Bred International, Inc. plant regulatory elements and methods of using them
US20210163555A1 (en) * 2018-05-31 2021-06-03 Western University Of Health Sciences TARGETING P18 FOR mTOR-RELATED DISORDERS
WO2020046701A1 (en) 2018-08-29 2020-03-05 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CN109536407B (en) * 2018-12-10 2020-12-01 北京航天恒丰科技股份有限公司 Glyphosate-resistant Brevibacillus laterosporus strain, composition and application
US20220015372A1 (en) 2018-12-14 2022-01-20 Pioneer Hi-Bred International, Inc. Biologicals and their use in plants
EP3942044A1 (en) 2019-03-21 2022-01-26 Devgen NV Control of insect pests using rna molecules
CN113862275B (en) * 2019-07-08 2024-02-06 中国农业科学院植物保护研究所 Partial sequence, cloning method and application of reference gene RPL14 stably expressed under different density treatments of wheat long tube aphid
CN111019950A (en) * 2019-11-18 2020-04-17 中国计量大学 Nilaparvata lugens NlAtg1 gene, encoding protein and application thereof
TW202142114A (en) 2020-02-04 2021-11-16 美商陶氏農業科學公司 Compositions having pesticidal utility and processes related thereto
EP4182466A2 (en) 2020-07-14 2023-05-24 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2022035649A1 (en) 2020-08-10 2022-02-17 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
TW202345696A (en) 2022-05-18 2023-12-01 美商科迪華農業科技有限責任公司 Compositions having pesticidal utility and processes related thereto

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090300796A1 (en) * 2005-09-16 2009-12-03 Devgen Nv Transgenic Plant-Based Methods for Plant Pests Using Rnai
CN102007215A (en) * 2008-01-17 2011-04-06 先锋国际良种公司 Compositions and methods for the suppression of target polynucleotides from lygus

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9214956D0 (en) 1992-07-14 1992-08-26 Univ Southampton A method of trapping and/or killing insects
GB9605203D0 (en) 1996-03-12 1996-05-15 Univ Southampton Control agent
GB9814507D0 (en) 1998-07-03 1998-09-02 Univ Southampton A method and apparatus for controlling pests
US7560542B2 (en) * 1999-05-07 2009-07-14 Monsanto Technology Llc Nucleic acid molecule SEQ ID NO. 68811 and other molecules associated with plants
AUPR621501A0 (en) 2001-07-06 2001-08-02 Commonwealth Scientific And Industrial Research Organisation Delivery of ds rna
WO2004020636A1 (en) * 2002-08-29 2004-03-11 Monsanto Technology, Llc Nucleotide sequences encoding cry1bb proteins for enhanced expression in plants
GB0228421D0 (en) 2002-12-05 2003-01-08 Exosect Ltd Lipid carriers
SI1599463T1 (en) * 2003-01-28 2013-10-30 E.I. Du Pont De Nemours And Company Cyano anthranilamide insecticides
PT1818405E (en) * 2004-04-09 2015-10-20 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
AU2007214372B2 (en) * 2004-04-09 2010-04-29 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US7319142B1 (en) * 2004-08-31 2008-01-15 Monsanto Technology Llc Nucleotide and amino acid sequences from Xenorhabdus and uses thereof
AU2005298337A1 (en) 2004-10-25 2006-05-04 Devgen Nv RNA constructs
EP1907546A2 (en) * 2005-05-31 2008-04-09 Devgen N.V. Rnai for control of insects and arachnids
UA98445C2 (en) * 2005-09-16 2012-05-25 Монсанто Текнолоджи Ллс Methods for genetic control insect attack of plans, and compositions applied for this purpose
US8933042B2 (en) * 2005-09-16 2015-01-13 Devgen Nv Methods for controlling pests using RNAi
CN101370940A (en) * 2006-01-12 2009-02-18 德福根有限公司 DsRNA as insect control agent
CA2633576A1 (en) * 2006-01-12 2007-07-19 Devgen N.V. Dsrna as insect control agent
US8513493B2 (en) * 2008-08-29 2013-08-20 Monsanto Technology Llc Hemipteran and coleopteran active toxin proteins from Bacillus thuringiensis
AU2012245135B2 (en) * 2011-04-20 2017-04-13 Devgen Nv Plants resistant to insect pests
AR113761A1 (en) * 2017-10-18 2020-06-10 Syngenta Participations Ag PEST CONTROL OF HEMIPTERS USING RNA MOLECULES

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090300796A1 (en) * 2005-09-16 2009-12-03 Devgen Nv Transgenic Plant-Based Methods for Plant Pests Using Rnai
CN102007215A (en) * 2008-01-17 2011-04-06 先锋国际良种公司 Compositions and methods for the suppression of target polynucleotides from lygus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
EBI，ACCESSION NO,CB408878: "IPG018C12_250658 JH Ⅲ-TREATED ALE I.PINI MIDGUTS IPS PINI CDNA CLONE IPG018C125，MRNA SEQUENCE", 《DATABASE EMBL》 *
EBI，ACCESSION NO,DV392288: "NADBB46TR AEDES AEGYPTI INFECTED WITH DENGUE VIRUS POOL LIBRARY AEDES AEGYPTI CDNA CLONE NADBB46，MRNA SEQUENCE", 《DATABASE EMBL》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110923240A (en) * 2019-12-21 2020-03-27 山西省农业科学院植物保护研究所 Function of insect adult disc growth factor and application of dsRNA (double-stranded ribonucleic acid) thereof

Also Published As

Publication number Publication date
EP3351635A1 (en) 2018-07-25
ZA201307515B (en) 2015-04-29
EP3363906B1 (en) 2020-04-01
CA2832638A1 (en) 2012-10-26
AU2012245134B2 (en) 2017-01-19
US20190256851A1 (en) 2019-08-22
CN103562394B (en) 2019-09-03
US20130231246A9 (en) 2013-09-05
US20180094265A1 (en) 2018-04-05
EP2699686B1 (en) 2017-11-29
CL2013003027A1 (en) 2014-03-28
PT2699685T (en) 2018-05-09
US20120322660A1 (en) 2012-12-20
EP3363906A1 (en) 2018-08-22
EP3351635B1 (en) 2020-02-12
ES2660018T3 (en) 2018-03-20
US20160060628A1 (en) 2016-03-03
CN103562395B (en) 2016-06-01
AU2017202268A1 (en) 2017-04-27
WO2012143543A2 (en) 2012-10-26
MX2018007942A (en) 2023-04-12
CN110452908A (en) 2019-11-15
US9206438B2 (en) 2015-12-08
CN103562395A (en) 2014-02-05
AU2012245135B2 (en) 2017-04-13
ZA201307477B (en) 2015-08-26
EP2699685B1 (en) 2018-03-14
ES2668630T3 (en) 2018-05-21
WO2012143542A1 (en) 2012-10-26
US9914925B2 (en) 2018-03-13
AU2012245134A1 (en) 2013-10-24
AU2012245135A1 (en) 2013-10-24
AU2017202268B2 (en) 2019-05-16
EP2699686A2 (en) 2014-02-26
MX357192B (en) 2018-06-29
AU2019216595A1 (en) 2019-08-29
US9845479B2 (en) 2017-12-19
EP2699685A1 (en) 2014-02-26
RU2671143C2 (en) 2018-10-29
US10329565B2 (en) 2019-06-25
RU2013151448A (en) 2015-05-27
WO2012143543A3 (en) 2012-12-27
US20120297501A1 (en) 2012-11-22
MX349997B (en) 2017-08-23
PT2699686T (en) 2018-02-26
MX2013012164A (en) 2014-06-23
CL2013003028A1 (en) 2014-03-28
RU2018113179A (en) 2019-03-01
MX344569B (en) 2016-12-20
RU2013151447A (en) 2015-05-27
RU2018113179A3 (en) 2019-03-01
RU2653752C2 (en) 2018-05-14
MX2013012162A (en) 2014-06-23
CA2833083A1 (en) 2012-10-26

Similar Documents

Publication Publication Date Title
CN103562394B (en) The down-regulation of gene expression in insect pest
CN103687952B (en) The down-regulation of gene expression in insect pest
CN108431207A (en) Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
CN108366540A (en) Assign ribosomal protein L 40 (RPL40) nucleic acid molecules to the resistance of coleoptera and Hemipteran pest

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190903

Termination date: 20210420

CF01 Termination of patent right due to non-payment of annual fee