CN108431207A - Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest - Google Patents

Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest Download PDF

Info

Publication number
CN108431207A
CN108431207A CN201680059496.7A CN201680059496A CN108431207A CN 108431207 A CN108431207 A CN 108431207A CN 201680059496 A CN201680059496 A CN 201680059496A CN 108431207 A CN108431207 A CN 108431207A
Authority
CN
China
Prior art keywords
seq
sequence
plant
rna
polynucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201680059496.7A
Other languages
Chinese (zh)
Inventor
K·E·纳瓦
E·菲什里维奇
M·朗戈萨米
M·L·弗雷
W·洛
S·E·沃尔登
P·甘德拉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Corteva Agriscience LLC
Original Assignee
Dow AgroSciences LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dow AgroSciences LLC filed Critical Dow AgroSciences LLC
Publication of CN108431207A publication Critical patent/CN108431207A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
    • A01N37/46—N-acyl derivatives
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/60—Isolated nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Pest Control & Pesticides (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Environmental Sciences (AREA)
  • Dentistry (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Insects & Arthropods (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Catching Or Destruction (AREA)
  • Peptides Or Proteins (AREA)

Abstract

This disclosure relates to nucleic acid molecules and the method for controlling coleoptera and/or Hemipteran pest using the nucleic acid molecules, the method carries out the inhibition that mediated rnai is led to implement by the non-coding sequence to target coded sequence and transcription in coleoptera and/or Hemipteran pest.Present disclosure also relates to for manufacture expression can be used for controlling coleoptera and Hemipteran pest nucleic acid molecules genetically modified plants method and thus obtained plant cell and plant.

Description

Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
Related application
This application claims the priority for the U.S.Provisional Serial 62/240,227 that on October 12nd, 2015 submits, should The entire disclosure of provisional application is hereby incorporated herein by.
Technical field
Present invention relates generally to control the heredity of the plant damages caused by coleoptera and/or Hemipteran pest.In spy In fixed embodiment, this disclosure relates to identify target coded sequence and non-coding sequence, and transcribed using recombinant DNA technology It checks afterwards or the expression in coleoptera and/or Hemipteran pest cell of suppression target coded sequence and non-coding sequence, to Plant protection effect is provided.
Background technology
Western corn rootworm (WCR) (diabroticavirgifera (Diabrotica virgifera virgifera LeConte it is)) one of most destructive corn rootworm species in North America, is concerned in Middle West corn-growing regions.North Square corn rootworm (NCR) (Pasteur root firefly is chrysomelid (Diabrotica barberi Smith and Lawrence)) is existed with WCR The nearly edge species of commensalism in almost the same range.Also in addition several chrysomelid relevant subspecies for belonging to (Diabrotica) are America Serious pest：Mexican Corn Rootworm (MCR) (chrysomelid (the D.virgifera zeae Krysan and of zea mexicana root firefly Smith))；Southern corn rootworm (SCR) (11 star root fireflies are chrysomelid (D.undecimpunctata howardi Barber))； Cucumber strip root firefly is chrysomelid (D.balteata LeConte)；11 asterophyllite first of cucumber (D.undecimpunctata tenella)； South America is chrysomelid (D.speciosa Germar)；And D.u.undecimpunctata Mannerheim.United States Department of Agriculture is current Estimation corn rootworm causes 1,000,000,000 dollar revenues to lose every year, including 800,000,000 dollars of production loss and 200,000,000 dollars of improvement at This.
WCR ovum and NCR ovum are deposited on during summer in soil.These insects all rest on the ovum phase in entire winter. Ovum is ellipse, white, and length is less than 0.004 inch (0.010cm).Larva in may hatch by bottom or the beginning of June, and ovum is hatched Precise time be all varied from every year since temperature difference and position are different.The larva newly hatched is white worm, length Less than 0.125 inch (0.3175cm).Once hatching, larva just starts with corn root to be food.Corn rootworm is after three larvas Age.After feeding several weeks, larval molting, into pupa time.They pupate in the soil, then in July and August in the form of adult from Occur in soil.The length of adult rootworm is about 0.25 inch (0.635cm).
Corn rootworm larvae completes development on corn and other several species gramineaes.It is raised on yellow foxtail The later appearance of larva, and compared with the larva raised on corn, the head capsule size of adult is smaller.Ellsbury et al., (2005)Environ.Entomol.34:627-634.WCR adults are with corn silk, pollen and the jade on exposed fringe point Rice seed is food.If WCR adults occur before the presence of maize reproductive tissue, they may be food with leaf texture, to subtract Slow plant growth, and occasional kills host plant.However, once having the fringe silk and pollen of preference, adult will be quick It is shifted to it.NCR adults also with the germinal tissue of corn plant be food, but in contrast seldom with maize leaves be food.
Most rootworm damage is caused by larva feed in corn.The rootworm newly hatched is initially with very thin corn root hair To eat, and pierce in the tip of a root.As larva grows bigger, they are to eat and pierce wherein with primary root.There are a large amount of corn roots When worm, larva often results in root pruning when feeding, until the base portion of cornstalk.Serious damage interferes root to transport water and nutrient Defeated ability in plant slows down plant growth, and seed is caused to generate reduction, to which total output be greatly reduced often.Seriously Root damage also when often result in corn plant lodging, this makes harvest become more difficult, and further decreases yield.In addition, at Worm is organized as food with maize reproductive can cause the fringe silk at fringe point to be trimmed.This if " shearing of fringe silk " foot during pollen falls off Enough serious, then pollination may be destroyed.
It can be by shift of crops, chemical insecticide, biological insecticides (for example, the gram-positive bacterium for forming spore is revived Cloud gold bacillus (Bacillus thuringiensis)), expression Bt toxin genetically modified plants or these means combination, To attempt control corn rootworm.The defect of shift of crops is to unnecessarily limit the purposes in farmland.In addition, some rootworm species Oviposition be likely to occur in the crop fields in addition to corn or long-term diapause, lead to egg hatching for many years, to reduce corn Implement the validity of crop rotation with soybean.
Chemical insecticide is the strategy controlled for realizing corn rootworm that people are relied on for counsel the most.Nevertheless, using Chemical insecticide is not perfect corn rootworm control strategy；If the cost of chemical insecticide with using after insecticide still May occur rootworm damage caused by loss be added, then the U.S. every year due to corn rootworm can the loss of energy be more than 1,000,000,000 dollars. Big larva group, heavy rain and insecticide misapplication can all cause corn rootworm control insufficient.In addition, continuous use is killed Worm agent may select resistance to insecticides rootworm kind, and since there are toxicity to non-target species for insecticide, so having serious Influence environment anxiety.
Stinkbug and other hemipterans (Heteroptera) constitute the important agricultural pests of another major class.The known whole world There are the nearly edge species in the 50 of stinkbug more that crop is caused to damage.McPherson&McPherson(2000)Stink bugs of economic importance in America north of Mexico, CRC Press.Hemipteran is present in largely Important crops in, these crops include maize, soybean, water fruits and vegetables and cereal.
Stinkbug just enters the adult stage after after multiple nymphs.From the time that egg development is adult at about 30 to 40 days It is interior.Nymph and adult are food with the juice from soft tissue, they also inject digestive ferment in soft tissue, cause to organize outside mouth Digestion and necrosis.Then the vegetable material and nutrient of digestion are taken in.Water and nutrient from plant vasular system is exhausted to cause to plant Object tissue damage.Damage to developmental seed and seed is the most notable, because yield and sprouting substantially reduce.Warm It will appear multiple generations under weather, cause great insect pressure.The management of stinkbug is depended on the basis of monolithic field at present Use pesticide treatments.Therefore, there is an urgent need to alternative management strategies, and occurent Crop damage is minimized.
It is a kind of method using endogenous cell approach that RNA, which interferes (RNAi), relies on this method, to entire target gene Sequence or the sufficiently large any part of the size of target gene sequence have RNA interfering (iRNA) molecule (such as dsRNA of specificity Molecule) cause mRNA encoded by them to degrade.In recent years, in many species and experimental system such as Caenorhabditis elegans In cell in (Caenorhabditis elegans), plant, insect embryo and tissue culture, RNAi is used to execute base Because of " striking low ".See, for example, Fire et al., (1998) Nature 391:806-811；Martinez et al., (2002) Cell 110:563-574；McManus and Sharp, (2002) Nature Rev.Genetics 3:737-747.
RNAi realizes the degradation of mRNA by intrinsic pathway (including DICER protein complexes).DICER will be long DsRNA molecules cut into the short-movie section of about 20 nucleotide, referred to as siRNA (siRNA).SiRNA untwists into two Single stranded RNA：Passerby chain (passenger strand) and guiding chain (guide strand).Passerby chain is degraded, and guiding chain is then It is impregnated in the silencing complex (RISC) of RNA inductions.MiRNA (miRNA) molecule can be mixed similarly in RISC. When guiding chain is specifically binding to the complementary series of mRNA molecules and induces Argonaute (catalyst component of RISC compounds) When cutting, posttranscriptional gene silencing occurs.Although in such as plant, Nemata and some insects, siRNA and/or miRNA's Initial concentration is limited, but the known procedures system spread all over some eucaryotes.
Transcript only with siRNA and/or miRNA complementations is cut and is degraded, therefore striking low for mRNA expression is sequence Row specificity.In plant, there are several functional groups of DICER genes.The gene silencing effect last from days of RNAi, and Under experimental conditions, the abundance for targeting transcript can be caused to decline 90% or more, the horizontal drop of corresponding protein occurs therewith It is low.In insect, there are at least two DICER genes, wherein DICER1 that miRNA is promoted to degrade under Argonaute1 guides.Lee Et al., (2004) Cell 117 (1):69-81.DICER2 promotes siRNA to degrade under Argonaute2 guides.
U.S. Patent number 7,612,194 and U.S. Patent Publication number 2007/0050860,2010/0192265 and 2011/ 0154545 discloses the 9112 kinds of ESTs detached from diabroticavirgifera (D.v.virgifera LeConte) pupa (EST) library of sequence.Proposed in U.S. Patent number 7,612,194 and U.S. Patent Publication number 2007/0050860 by with its Disclosed in diabroticavirgifera vacuole type H+The nucleic acid of one of several specific part sequences of ATP enzyme (V-ATP enzymes) complementation point Son is operably connected to promoter, so as to the antisence RNA in plant cell.U.S. Patent Publication number 2010/0192265 It proposes and promoter is operably connected to following nucleic acid molecules so as to the antisence RNA in plant cell, the nucleic acid point Son with unknown and the diabroticavirgifera gene of undocumented function specific part sequence it is complementary (partial sequence it is said that It is identical as the C56C10.3 gene outcomes 58% in Caenorhabditis elegans (C.elegans)).U.S. Patent Publication number 2011/ 0154545 proposes promoter being operably connected to following nucleic acid molecules so as to the antisence RNA in plant cell, should Two specific part sequences of nucleic acid molecules and diabroticavirgifera coatmer (coatomer) β subunit genes are complementary.In addition, U.S. Patent number 7,943,819 discloses 906 kinds of expressed sequences of the middle intestines separation from diabroticavirgifera larva, pupa and incision The library of label (EST) sequence, and propose and promoter is operably connected to following nucleic acid molecules so as to thin in plant Double-stranded RNA is expressed in born of the same parents, the specific part sequence of the nucleic acid molecules and the multivesicular body albumen 4b genes of diabroticavirgifera electrification It is complementary.
Other than several specific part sequences of V-ATP enzymes and the specific part sequence of gene with unknown function, U.S. Patent number 7,612,194 and U.S. Patent Publication number 2007/0050860,2010/0192265 and 2011/0154545 In do not have it is further proposed that be more than any particular sequence in 9000 sequences carry out RNA interference using wherein listing.This Outside, U.S. Patent number 7,612,194 and U.S. Patent Publication number 2007/0050860,2010/0192265 and 2011/ 0154545 all do not teach its offer be more than which of 9000 sequences other sequences when as dsRNA or siRNA Can be fatal in corn rootworm species, even without its use in terms of having any other of teaching.In addition to charging multivesicular body egg Except the specific part sequence of white 4b genes, U.S. Patent number 7,943,819 is without proposing that using wherein listing be more than 900 Any particular sequence in sequence carries out RNA interference.In addition, U.S. Patent number 7,943,819 does not teach the super of its offer Cross which of 900 sequences other sequences in corn rootworm species can be when as dsRNA or siRNA it is fatal, very To not teaching its use in terms of having any other.U.S. Patent Application Publication No. U.S.2013/040173 and PCT application are public Cloth WO2013/169923 describes the sequence from corn root leaf A (Diabroticavirgifera) Snf7 genes and exists The purposes of RNA interference is carried out in maize.(it is also disclosed in Bolognesi et al., (2012) PLOS ONE 7 (10): e47534.doi:In 10.1371/journal.pone.0047534).
Most sequences (such as aforementioned) with corn rootworm DNA complementations are when as dsRNA or siRNA, in corn It is not fatal in rootworm species.For example, Baum et al., (2007, Nature Biotechnology 25:1322-1326) Describe the effect that RNAi inhibits several WCR gene targets.These authors report, more than 520ng/cm2High iRNA (examples Such as dsRNA) under concentration, having 8 in 26 target genes that they test, cannot to provide experimentally significant coleopteran pest dead Die rate.
The author of U.S. Patent number 7,612,194 and U.S. Patent Publication number 2007/0050860 first reported corn plant The plant kingdom RNAi of targeting western corn rootworm in object.Baum et al., (2007) Nat.Biotechnol.25 (11):1322- 6.These authors describe for screening potential target gene to develop the high-throughput in vivo diet of transgenic RNAi maize RNAi systems.In the initial gene pond of 290 targets, only 14 potentiality for showing control larva.Most effective double-strand One of RNA (dsRNA) targets the gene of encoding vacuolar ATP enzyme subunit A (V-ATP enzymes), to be drawn with low concentration dsRNA It rises and quickly suppresses corresponding endogenous mRNA and trigger specific RNA i reactions.Therefore, these authors are described with file for the first time Potentiality of the plant kingdom RNAi as feasible Pest Management tool, even and if being demonstrated simultaneously from relatively small candidate gene group Accurately priori it can not identify effective target.
Invention content
Disclosed herein is for controlling following pest nucleic acid molecules (for example, target gene, DNA, dsRNA, siRNA, ShRNA, miRNA and hpRNA) and its application method：Coleopteran pest, including such as diabroticavirgifera (western corn root Worm, " WCR "), chrysomelid (the northern com rootworm, " NCR " of Pasteur root firefly), 11 star root fireflies it is chrysomelid (southern corn rootworm, " SCR "), chrysomelid (the Mexican Corn Rootworm, " MCR " of zea mexicana root firefly), cucumber strip root firefly is chrysomelid, 11 asterophyllite first of cucumber, South America is chrysomelid and D.u.undecimpunctata Mannerheim；And Hemipteran pest, including for example heroic America stinkbug (Euschistus heros) (Fabr.) (neotropical realm palm fibre stinkbug, " BSB "), (south green rice bug (Nezara viridula) Green stinkbug), Gaede intend wall stinkbug (Piezodorus guildinii) (red tape stinkbug), eating attraction (Halyomorpha halys) (brown wing stinkbug), Chinavia hilare (Say) (green stinkbug), brown smelly stinkbug (Euschistus servus) (brown stinkbug), Chinese toon worm (Dichelops melacanthus)、Dichelops furcatus(F.)、Edessa meditabunda(F.)、Thyanta Perditor (F.) (the red shoulder stinkbug in neotropical realm), Chinavia marginatum (Palisot de Beauvois), Horcias nobilellus (Berg) (cotton bedbug), Taedia stigmosa (Berg), Peru red cotton bug (Dysdercus peruvianus)(Guérin-Méneville)、Neomegalotomus parvus(Westwood)、Leptoglossus Zonatus (Dallas), Niesthrea sidae (F.), lygushesperus (Lygus hesperus) (western tarnished plant bug) With US lyguslineolaris (Lygus lineolaris) (Palisot de Beauvois).In specific example, discloses and show Example property nucleic acid molecules, these molecules can be with one or more of coleoptera and/or Hemipteran pest native sequence nucleic acid extremely It is few a part of homologous.
In these and other example, native sequence nucleic acid can be target gene, and product can be for example but unlimited In：Metabolic process is participated in, or participates in the development of larva/nymph.In some instances, by including the sequence homologous with target gene The nucleic acid molecules of row inhibit to may be fatal for coleoptera and/or Hemipteran pest after translating the expression of target gene , or growth may be made and/or developed and slowed down.In specific example, encode Troponin I gene (Barbas et al., 1991；Barbas et al., 1993) (herein referred as wings up A or wupA) can be selected for use in the target of post-transcriptional silencing Gene.In specific example, the target gene that can be used for inhibiting after transcribing is the novel gene for being referred to herein as wupA.Cause This, disclosed herein is include wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:79) core Nucleotide sequence, wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:79) complementary series and The nucleic acid molecules of the aforementioned segment of any one.
Also disclose the nucleic acid molecules of the nucleotide sequence comprising the such polypeptide of coding：The polypeptide and target gene product Amino acid sequence at least about 85% in (such as being known as the gene outcome of WUPA) is identical.For example, nucleic acid molecules may include encoding The nucleotide sequence of polypeptide, the polypeptide and SEQ ID NO:2 (diabroticavirgifera WUPA-1), SEQ ID NO:4 (corn roots The chrysomelid WUPA-2 of firefly), SEQ ID NO:6 (diabroticavirgifera WUPA-3) or SEQ ID NO:80 (heroic America stinkbug WUPA eggs In vain)；Diabroticavirgifera wupA-1, diabroticavirgifera wupA-2, diabroticavirgifera wupA-3 or hero America stinkbug wupA Product in amino acid sequence at least 85% it is identical.Further disclose the nucleic acid molecules for including such nucleotide sequence： The nucleotides sequence is classified as the reverse complementary sequence for the nucleotide sequence for encoding following polypeptides, the wherein polypeptide and target gene product Interior amino acid sequence at least 85% is identical.
Also disclose the cDNA that can be used for generating iRNA (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) molecule The all or part of polynucleotides, the iRNA molecules and coleoptera and/or Hemipteran pest target gene (such as wupA) is mutually It mends.In certain embodiments, dsRNA, siRNA, shRNA, miRNA and/or hpRNA can generate or pass through gene in vitro Modified biological body (such as plant or bacterium) in vivo generates.In specific example, disclose can be used for generating it is following The cDNA molecules of iRNA molecules：These iRNA molecules and wupA genes (such as SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:79) all or part of complementation, the gene such as WCRwupA genes (such as SEQ ID NO:1、 SEQ ID NO:3 and SEQ ID NO:Or BSB wupA genes (such as SEQ ID NO 5):79).
The component for inhibiting the indispensable gene in coleopteran pest to express is further disclosed, and for being carried to plant For the component of coleopteran pest protection.A kind of component for inhibiting the indispensable gene in coleopteran pest to express is by being selected from down The single-stranded or double-stranded RNA molecule of the polynucleotides composition of row：SEQ ID NO:89-97 and their complementary series.For pressing down In coleopteran pest processed indispensable gene expression component functional equivalent include with containing SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11 and/or SEQ ID NO:12 coleoptera wupA genes All or part of substantially homologous single-stranded or double-stranded RNA molecule.A kind of structure for providing coleopteran pest protection to plant Part is such DNA molecular：The DNA molecular includes to be operably connected to promoter and encode for inhibiting in coleopteran pest Indispensable gene expression component polynucleotides, the wherein DNA molecular can be integrated into the genome of plant.
The component for inhibiting the indispensable gene in Hemipteran pest to express is also disclosed, and for providing half to plant The component of wing mesh pest protection.A kind of component for inhibiting the indispensable gene in Hemipteran pest to express is by selected from following The single-stranded or double-stranded RNA molecule of polynucleotides composition：SEQ ID NO:98-101 and their complementary series.For inhibiting In Hemipteran pest indispensable gene expression component functional equivalent include with containing SEQ ID NO:81、SEQ ID NO: 82 and/or SEQ ID NO:The substantially homologous single-stranded or double-stranded RNA molecule of all or parts of 83 Semiptera wupA genes. A kind of component for providing Hemipteran pest protection to plant is such DNA molecular：The DNA molecular includes operationally to connect It is connected to promoter and encodes the polynucleotides of the component for inhibiting the indispensable gene in Hemipteran pest to express, the wherein DNA Molecule can be integrated into the genome of plant.
In addition the method for controlling coleoptera and/or Hemipteran pest group is disclosed, including to coleoptera and/or partly Wing mesh pest provides iRNA (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) molecule, and the iRNA molecules are by coleoptera And/or it is played a role after Hemipteran pest intake to inhibit the biological function in coleoptera and/or Hemipteran pest.
In some embodiments, the method for controlling coleopteran pest group includes providing iRNA to coleopteran pest Molecule, the iRNA molecules include all or part selected from following polynucleotides：SEQ ID NO:89；SEQ ID NO:89 Complementary series；SEQ ID NO:90；SEQ ID NO:90 complementary series；SEQ ID NO:91；SEQ ID NO:91 complementation Sequence；SEQ ID NO:92；SEQ ID NO:92 complementary series；SEQ ID NO:93；SEQ ID NO:93 complementary series； SEQ IDNO:94；SEQ ID NO:94 complementary series；SEQ ID NO:95；SEQ ID NO:95 complementary series；SEQ ID NO:96；SEQ ID NO:96 complementary series；SEQ ID NO:97；SEQ ID NO:97 complementary series；With coleopteran pest The polynucleotides of the natural wupA polynucleotides hybridization of (such as WCR)；Hybridize with the natural wupA polynucleotides of coleopteran pest Polynucleotides complementary series；The polynucleotides hybridized with the natural coded polynucleotide of chrysomelid category organism (such as WCR), The natural coded polynucleotide includes SEQ ID NO:1, all or part of any one in 3,5 and 7-12；With chrysomelid category biology The complementary series of the polynucleotides of the natural coded polynucleotide hybridization of body, the natural coded polynucleotide include SEQ ID NO: 1, all or part of any one in 3,5 and 7-12.
In other embodiments, the method for controlling Hemipteran pest group includes providing iRNA to Hemipteran pest Molecule, the iRNA molecules include all or part selected from following polynucleotides：SEQ ID NO:98；SEQ ID NO:98 Complementary series；SEQ ID NO:99；SEQ ID NO:99 complementary series；SEQ ID NO:100；SEQ ID NO:100 it is mutual Complementary series；SEQ ID NO:101；SEQ ID NO:101 complementary series；With the natural wupA of Hemipteran pest (such as BSB) The polynucleotides of polynucleotides hybridization, the complementary sequence of the polynucleotides hybridized with the natural wupA polynucleotides of Hemipteran pest Row；The polynucleotides hybridized with the natural coded polynucleotide of Semiptera organism (such as BSB), the natural coded polynucleotide Including SEQ ID NO:The all or part of any one in 79 and 81-83；And the natural coding multinuclear with Semiptera organism The complementary series of the polynucleotides of thuja acid hybridization, the natural coded polynucleotide include SEQ ID NO:It is any in 79 and 81-83 The all or part of person.
In certain embodiments, it is played a role after being absorbed from following DNA transcriptions by insect pest to inhibit the pest The iRNA of interior biological function, the DNA include all or part selected from following polynucleotides：SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO: 11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:83；SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO: 10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:83 complementary series；The chrysomelid natural coding sequence for belonging to organism (such as WCR) or Semiptera organism (such as BSB), Including SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、 SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 With SEQ ID No:The all or part of any one in 83；The chrysomelid natural coding sequence for belonging to organism or Semiptera organism Complementary series, the natural coding sequence include SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、 SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、 SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:The all or part of any one in 83；Chrysomelid category organism or half The natural non-coding sequence of wing mesh organism is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、 SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、 SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:The all or part of day of any one in 83 Right RNA molecule；With the complementary series of the natural non-coding sequence of chrysomelid category organism or Semiptera organism, the natural non-coding Sequence is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:The all or part of natural RNA molecule of any one in 83.
There is disclosed herein following methods, wherein can in the measurement based on foodstuff, or expression dsRNA, siRNA, In the genetically modified plant cell of shRNA, miRNA and/or hpRNA, described in coleoptera and/or Hemipteran pest offer DsRNA, siRNA, shRNA, miRNA and/or hpRNA.In these and other example, the dsRNA, siRNA, shRNA, MiRNA and/or hpRNA can be taken in by coleopteran pest nymph and/or Hemipteran pest nymph.The dsRNA of the intake present invention, SiRNA, shRNA, miRNA and/or hpRNA can then cause the RNAi in nymph, RNAi that can cause coleoptera and/or half in turn Silence occurs for gene necessary to the viability of wing mesh pest, finally causes dead larvae.Therefore, it discloses wherein to coleoptera And/or Hemipteran pest provides the nucleic acid for including the Exemplary nucleic acid sequences that can be used for controlling coleoptera and/or Hemipteran pest The method of molecule.In specific example, by using the nucleic acid molecules of the present invention, the coleoptera controlled and/or Semiptera do harm to Worm can be WCR, NCR, SCR, MCR, heroic America stinkbug, brown America stinkbug, the quasi- wall stinkbug of Gaede, eating attraction, green rice bug, Chinavia Hilare, C.marginatum, Chinese toon worm, D.furcatus, Edessa meditabunda, Thyanta perditor, Horcias nobilellus、Taedia stigmosa、Dysdercus peruvianus、Neomegalotomus Parvus, Leptoglossus zonatus, Niesthrea sidae and/or US lyguslineolaris.
With reference to the detailed description to several embodiments carried out below in conjunction with attached drawing 1 to 2, preceding feature and other features It will be apparent.
Description of the drawings
Fig. 1 is the graphical representation from the strategy for generating dsRNA from single transcription templates with single pair primer.
Fig. 2 is the graphical representation for the strategy that dsRNA is generated from two transcription templates.
Sequence table
The nucleic acid sequence listed in accompanying sequence table uses the nucleotide base as specified in 37C.F.R. § 1.822 Shown in standard letter abbreviation.The nucleic acid sequence and amino acid sequence listed limit the nucleotide for having and being arranged in a manner of described The molecule of monomer and amino acid monomer (that is, respectively polynucleotides and polypeptides).The nucleic acid sequence and amino acid sequence listed are also Respectively limit a kind of polynucleotides or polypeptide for including the nucleotide monomer and amino acid monomer arranged in a manner of described.Consider To the redundancy of genetic code, it should be understood that the nucleotide sequence comprising coded sequence also describes coding and reference sequences institute group At the identical polypeptide of polynucleotides this kind of polynucleotides.It is also understood that amino acid sequence describes to encode the polypeptide This kind of polynucleotides ORF.
A chain of each nucleic acid sequence is illustrated only, it is any that it includes complementary strand that, which should be understood as, is referred to shown chain Inside.It is disclosed by the primary sequence since the complementary series and reverse complementary sequence of level-one nucleic acid sequence are inevitable, so any right Nucleic acid sequence refer to the also complementary series and reverse complementary sequence including the nucleic acid sequence including, unless expressly stated otherwise, (or can be seen that from the context for the sequence wherein occur really not so).In addition, as understood in the art, RNA chains Nucleotide sequence determined by the sequence for being transcribed into the DNA of the RNA chains (but to replace thymidine with uracil (U) nucleobase (T)), so any DNA sequence dna to coding RNA sequence refers to all including the RNA sequence.In the sequence table of accompanying In：
SEQ ID NO:1 shows the DNA sequence dna for including the wupA-1 from corn root leaf A.
SEQ ID NO:2 show the amino acid sequence of the WUPA-1 albumen from corn root leaf A.
SEQ ID NO:3 show the DNA sequence dna for including the wupA-2 from corn root leaf A.
SEQ ID NO:4 show the amino acid sequence of the WUPA-2 albumen from corn root leaf A.
SEQ ID NO:5 show the DNA sequence dna for including the wupA-3 from corn root leaf A.
SEQ ID NO:6 show the amino acid sequence of the WUPA-3 albumen from corn root leaf A.
SEQ ID NO:7 show the wupA-1reg1 (region 1) from corn root leaf A synthesized for external dsRNA DNA sequence dna (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:8 show the wupA-2reg2 (region 2) from corn root leaf A synthesized for external dsRNA DNA sequence dna (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:9 show the wupA-3reg3 (region 3) from corn root leaf A synthesized for external dsRNA DNA reverse complementary sequences (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:10 show the (regions wupA-1reg4 from corn root leaf A synthesized for external dsRNA 4) DNA reverse complementary sequences (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:11 show the wupA-3v1 (version 1) from corn root leaf A synthesized for external dsRNA DNA sequence dna (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:12 show the wupA-3v2 (version 2) from corn root leaf A synthesized for external dsRNA DNA sequence dna (the T7 promoter sequences in the ends 5' and 3' are not shown).
SEQ ID NO:13 show the DNA sequence dna of T7 phage promoters.
SEQ ID NO:14 show that the DNA sequence dna for the external dsRNA code areas the YFP sections synthesized (is not shown The T7 promoter sequences of the ends 5' and 3').
SEQ ID NO:15 to 22 show for expanding the part for including the wupA subunit sequences from corn root leaf A Primer, these parts include wupA-3 reg3, wupA-1 reg4, wupA-3 v1 and wupA-3 v2.
SEQ ID NO:23 show the DNA sequence dna in annexin region 1.
SEQ ID NO:24 show the DNA sequence dna in annexin region 2.
SEQ ID NO:25 show the DNA sequence dna in 2 region 1 of β spectrin.
SEQ ID NO:26 show the DNA sequence dna in 2 region 2 of β spectrin.
SEQ ID NO:27 show the DNA sequence dna in the regions mtRP-L4 1.
SEQ ID NO:28 show the DNA sequence dna in the regions mtRP-L4 2.
SEQ ID NO:29 to 56 show the gene for expanding YFP, annexin, β spectrin 2 and mtRP-L4 Region is to synthesize the primer of dsRNA.
SEQ ID NO:57 show the maize DNA sequence dna of coding TIP41 sample albumen.
SEQ ID NO:58 show the DNA sequence dna of oligonucleotides T20NV.
SEQ ID NO:59 to 63 show the sequence of the primer and probe for measuring maize transcript level.
SEQ ID NO:64 show the DNA sequence dna of a part for the code areas SpecR for detecting binary vector trunk.
SEQ ID NO:65 show the DNA sequence dna of a part for the code areas AAD1 for analyzing genome copy numbers.
SEQ ID NO:66 show the DNA sequence dna of maize invertase gene.
SEQ ID NO:67 to 75 show the sequence of the primer and probe for analyzing gene copy number.
SEQ ID NO:76 to 78 show the sequence of the primer and probe for analyzing maize expression.
SEQ ID NO:79 show showing for the BSB wupA transcripts derived from neotropical realm palm fibre stinkbug (heroic America stinkbug) Example property DNA sequence dna.
SEQ ID NO:79 show the amino acid sequence of heroic America stinkbug WUPA albumen.
SEQ ID NO:81 show the (areas BSB_wupA reg1 for deriving from heroic America stinkbug synthesized for external dsRNA Domain 1) DNA sequence dna (the T7 promoters in the ends 5' and 3' are not shown).
SEQ ID NO:82 show the BSB_wupA v1 (versions for deriving from heroic America stinkbug synthesized for external dsRNA 1) DNA sequence dna (the T7 promoters in the ends 5' and 3' are not shown).
SEQ ID NO:83 show the BSB_wupA v2 (versions for deriving from heroic America stinkbug synthesized for external dsRNA 2) DNA sequence dna (the T7 promoters in the ends 5' and 3' are not shown).
SEQ ID NO:84-85 is shown derives from the heroic America stinkbug wupA sequences comprising BSB_wupA v1 for expanding Part primer.
SEQ ID NO:86 be the sense strand i.e. primer of YFPv2 of the dsRNA of YFP targetings
SEQ ID NO:87-88 shows the part i.e. primer of YFPv2 of the dsRNA for expanding YFP targetings
SEQ ID NO:89-101 is shown from the exemplary of the transcribed nucleic acid comprising wupA polynucleotides and its segment RNA。
SEQ ID NO:102 show exemplary adapter polynucleotides, in RNA transcript transcribe when formed " ring " with Form hairpin structure.
SEQ ID NO:103 show that IDT customizes oligonucleotide probe wupA PRB Set1, are marked, are used in combination with FAM Zen and Iowa Black quenchers give dual be quenched
Specific implementation mode
I. the general introduction of several embodiments
We, will using one of the pest species of genetically modified plants most probable targeting of expression dsRNA western corn rootworm RNA interferes (RNAi) exploitation for the tool of management insect pest.So far, it is proposed as the target of RNAi in rootworm larvae Most of genes do not realize its purpose actually.Exemplary insect pest western corn root is described herein in we By the low to striking for wupA of RNAi mediations in worm and neotropical realm palm fibre stinkbug, when for example via intake or injection wupA dsRNA It is described to strike low show with fatal phenotype when delivering iRNA molecules.In embodiments herein, by feeding to insect The ability of delivering wupA dsRNA imparts the RNAi effect highly useful to management insect (such as coleoptera and Semiptera) pest It answers.It is combined with other useful RNAi targets by the RNAi for mediating wupA, influences multiple target sequences (for example, in larva In state rootworm) potentiality may increase exploitation be related to RNAi technology sustainable insect pest management method chance.
Disclosed herein is the method and compositions for heredity control coleoptera and/or hemipteran pest infection.Also provide For identifying that one or more genes necessary to the life cycle of coleoptera and/or Hemipteran pest mediate for use as RNAi Coleoptera and/or Hemipteran pest collective control target gene method.DsRNA points of coding one or more can be designed The DNA plasmid carrier of son carrys out one or more target genes necessary to suppressed growth, survival, development and/or breeding.One In a little embodiments, provide via the coding or non-coding sequence with the target gene in coleoptera and/or Hemipteran pest Complementary nucleic acid molecules are come the method that checks target gene expression or suppression target gene after transcribing.In these and other implementation In scheme, coleoptera and/or Hemipteran pest can be taken in one or more from mutual with the coding or non-coding sequence of target gene DsRNA, siRNA, shRNA, miRNA and/or hpRNA molecule of all or part of transcription of the nucleic acid molecules of benefit, to carry For plant protection effect.
Therefore, some embodiments are related to using the coded sequence and/or non-coding sequence with one or more target genes It arranges complementary dsRNA, siRNA, shRNA, miRNA and/or hpRNA and sequence-specific suppression is carried out to the expression of target gene product System, to realize at least partly control to coleoptera and/or Hemipteran pest.Disclose one group of nucleic acid through detaching and purifying point Son, it includes nucleotide sequences, such as following as shown in any one：SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO: 5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、 SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and SEQ ID NO:83 and its segment.In some embodiments In, it can be by the sequence, its segment or stabilized dsRNA molecules of gene expression comprising one of these sequences, after transcribing Silence or suppression target gene.In certain embodiments, the nucleic acid molecules through detaching and purifying include SEQ ID NO:1 it is complete Portion or part.In other embodiments, the nucleic acid molecules through detaching and purifying include SEQ ID NO:3 all or part. In a further embodiment, the nucleic acid molecules through detaching and purifying include SEQ ID NO:5 all or part.In other realities It applies in scheme, the nucleic acid molecules through detaching and purifying include SEQ ID NO:7 all or part.In other other embodiments In, the nucleic acid molecules through detaching and purifying include SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO: 11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 or SEQ ID NO:83 whole or Part.
Some embodiments are related to having coding at least one iRNA (such as dsRNA) molecule in its genome at least A kind of recombinant host cell of recombinant DNA sequence (such as plant cell).In certain embodiments, dsRNA molecules can be with It is generated when by coleoptera and/or Hemipteran pest intake, for post-transcriptional silencing or inhibits coleoptera and/or Hemipteran pest The expression of middle target gene.Recombinant DNA sequence may include for example any one or more of following：SEQ ID NO:1、 SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 or SEQ ID NO:In 83 Any one；SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 or SEQ ID NO:The segment of any one in 83；Or include SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、 SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、 SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 or SEQ ID NO:The portion of one or more of 83 gene Sub-sequence；Or its complementary series.
Particular embodiment is related to the recombination in its genome with coding at least one iRNA (such as dsRNA) molecule The recombinant host cell of DNA sequence dna, the iRNA molecules include it is following in all or part of any one：SEQ ID NO:89、 SEQ ID NO:90、SEQ ID NO:91 or SEQ ID NO:98 (for example, be selected from SEQ ID NO:92-97 and 99-101 are extremely A kind of few polynucleotides) or its complementary series.It is described one or more when by coleoptera and/or Hemipteran pest intake IRNA molecules can silence or suppression target wupA DNA (for example, comprising selected from SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and/or SEQ ID NO:The all or part of DNA of 79 polynucleotides) in coleoptera and/or Hemipteran pest Expression, to cause growth, development, viability and/or the feed of coleoptera and/or Hemipteran pest to stop.
In some embodiments, there is at least one recombination for encoding at least one dsRNA molecules in its genome The recombinant host cell of DNA sequence dna can be inverted plant cell.Some embodiments are related to comprising such inverted The genetically modified plants of plant cell.In addition to such genetically modified plants, the offspring for additionally providing any genetically modified plants generation plants Object, transgenic seed and transgenic plant product, each of they all include one or more recombinant DNA sequences.In spy In fixed embodiment, the dsRNA molecules of the present invention can be expressed in transgenic plant cells.Therefore, at these and other In embodiment, the dsRNA molecules of the present invention can be detached from transgenic plant cells.In certain embodiments, turn Gene plant is to be selected from following plant：Corn (Zea mays), soybean (Glycine max) and grass family (Poaceae) Plant.
Some embodiments are related to the side for regulating and controlling the expression of target gene in coleoptera and/or Hemipteran pest cell Method.In these and other embodiments, it is possible to provide nucleic acid molecules, the wherein nucleic acid molecules include the core of coding dsRNA molecules Nucleotide sequence.In certain embodiments, the nucleotide sequence of coding dsRNA molecules can be operatively attached to startup Son, and it is also operatively connected to transcription terminator.In certain embodiments, for regulate and control coleoptera and/ Or the method for the expression of target gene may include in Hemipteran pest cell：(a) with the nucleotides sequence for including coding dsRNA molecules The carrier of row converts plant cell；(b) it is being enough that the plant cell cultures comprising multiple inverted plant cells is allowed to develop Under conditions of cultivate the inverted plant cell；(c) selection is by the inverted plant in the vector integration to its genome Object cell；And (d) determine that selected inverted plant cell includes the nucleotide sequence coded dsRNA by the carrier Molecule.It can be integrated with carrier from genome and include by the plant of the nucleotide sequence coded dsRNA molecules of the carrier Object cytothesis plant.
Therefore, it also discloses comprising the genetically modified plants for integrating carrier in its genome, which has coding The nucleotide sequence of dsRNA molecules, wherein the genetically modified plants include the nucleotide sequence coded dsRNA by the carrier Molecule.In certain embodiments, dsRNA molecules are expressed in plant is enough to regulate and control the contact inverted plant or plant The coleoptera of cell (for example, being food by the part (such as root) or plant cell with the inverted plant, the plant) And/or in the cell of Hemipteran pest target gene expression.Genetically modified plants disclosed herein can show to coleoptera and/ Or the patience of hemipteran pest infection and/or the tolerance of enhancing.Specific genetically modified plants can show to one or more choosings From the tolerance of the resistance and/or enhancing of following coleoptera and/or Hemipteran pest：WCR, NCR, SCR, MCR, heroic America Stinkbug, brown America stinkbug, Gaede intend wall stinkbug, eating attraction, green rice bug, Chinavia hilare, C.marginatum, Chinese toon worm, D.furcatus、Edessa meditabunda、Thyanta perditor、Horcias nobilellus、Taedia stigmosa、Dysdercus peruvianus、Neomegalotomus parvus、Leptoglossus zonatus、 Niesthrea sidae and/or US lyguslineolaris.
There is disclosed herein for controlling agent (such as iRNA molecules) to be delivered to the side of coleoptera and/or Hemipteran pest Method.Such controlling agent can directly or indirectly weaken coleoptera and/or Hemipteran pest feed, growth or otherwise cause The ability of host's damage.In some embodiments, it provides a method, including stabilized dsRNA molecules is delivered to Coleoptera and/or Hemipteran pest are to suppress at least one of the coleoptera and/or Hemipteran pest target gene, to subtract Plant damages caused by light or elimination coleoptera and/or Hemipteran pest.In some embodiments, inhibit coleoptera and/or The method of the expression of target gene can cause growth, development, viability and/or the feed of Hemipteran pest to stop in Hemipteran pest Only.In some embodiments, this method can eventually lead to coleoptera and/or Hemipteran pest is dead.
In some embodiments, composition (such as the office of iRNA (such as dsRNA) molecule comprising the present invention is provided Portion's composition), for being used in the environment of plant, animal and/or plant or animal, it is intended to eliminate or mitigate coleoptera And/or hemipteran pest infection.In certain embodiments, the composition can be coleoptera to be fed to and/or half wing The alimentation composition or food source or RNAi baits of mesh pest.Some embodiments include that coleoptera and/or Semiptera is made to do harm to The alimentation composition or food source can be obtained in worm.Composition of the intake comprising iRNA molecules can cause the molecule by coleoptera And/or one or more cellular uptakes of Hemipteran pest, and then can cause to coleoptera and/or Hemipteran pest one or more The inhibition of at least one of a cell target gene expression.By being provided in the host of coleoptera and/or Hemipteran pest The compositions of one or more iRNA molecules comprising the present invention, can be any there are coleoptera and/or Hemipteran pest Among or on host tissue or environment, limitation or eliminate due to caused by coleoptera and/or hemipteran pest infection to plant Or the intake or damage of plant cell.
By dsRNA and food or attractant or both mix when, formation RNAi baits.When pest eats bait, can also Eat up dsRNA.Bait can take the form of particle, gel, flowable powder, liquid or solid.In another embodiment, WupA can be mixed in bait preparation, such as U.S. Patent number 8, described in 530,440, which is incorporated by reference accordingly Herein.It is, in general, that using bait in the case of, bait be placed in the environment of insect pest or surrounding, in this way, for example WCR can touch bait and/or be attracted by bait.
Compositions disclosed herein and method can with for control coleoptera and/or Hemipteran pest institute induced damage resistive other Method and composition is used in combination together.For example, as described herein for protecting the plants from coleoptera and/or Semiptera evil The iRNA molecules of damaged by insect evil can use in such method：This method include additionally use it is one or more to coleoptera and/ Or the effective chemical agent of Hemipteran pest, to coleoptera and/or the effective biological insecticides of Hemipteran pest, shift of crops, Or show the recombinant DNA technology (example of the feature different from the feature of RNAi compositions of the RNAi methods mediated and the present invention Such as, recombination is generated to coleoptera and/or the harmful protein of Hemipteran pest (such as Bt toxin) in plant.
II. it abridges
DsRNA double stranded RNAs
GI growth inhibitions
NCBI National Center for Biotechnology Information
GDNA genomic deoxyribonucleic acids
IRNA inhibition ribonucleic acid
ORF open reading frame
RNAi the RNA interferences
MiRNA miRNAs
ShRNA bobby pin ribonucleic acid
The small inhibition ribonucleic acid of siRNA
HpRNA hairpin ribonucleic acids
UTR non-translational regions
WCR western corn rootworms (diabroticavirgifera)
NCR northern com rootworms (Pasteur root firefly is chrysomelid)
MCR Mexican Corn Rootworms (zea mexicana root firefly is chrysomelid)
PCR PCRs
The silencing complex of RISC RNA inductions
SCR southern corn rootworms (11 star root fireflies are chrysomelid)
The neotropical realms BSB palm fibre stinkbug (heroic America stinkbug)
YFP yellow fluorescence proteins
SEM average standard errors
III. term
In description below and table, many terms have been used.In order to provide to the clear of specification and claims And consistent understanding, including the range of such term is given, it provides defined below：
Coleopteran pest：As used herein, term " coleopteran pest " refers to corn and other very grass for the chrysomelid of food Belong to insect.In specific example, coleopteran pest is selected from following inventory：Diabroticavirgifera (WCR), Pasteur root firefly are chrysomelid (NCR), 11 star root fireflies chrysomelid (SCR), zea mexicana root firefly chrysomelid (MCR), cucumber strip root firefly be chrysomelid, 11 asterophyllite of cucumber First, South America is chrysomelid and D.u.undecimpunctata Mannerheim.
(with organism) contacts：As used herein, with organism (such as coleoptera and/or Hemipteran pest) " contact " or By terms such as organisms " intake ", for nucleic acid molecules, including in nucleic acid molecules internalization to organism, such as, but not limited to： Organism takes in the molecule (such as passing through feed)；Organism is set to be contacted with the composition comprising nucleic acid molecules；And with packet Solution containing nucleic acid molecules impregnates organism.
Contig：As used herein, term " contig " refers to one group of overlapping DNA area that origin is derived from single genetic origin The DNA sequence dna of Duan Chongjian.
Corn plant：As used herein, term " corn plant " refers to the plant of species maize (Zea mays).
Encode dsRNA：As used herein, term " coding dsRNA " includes such gene, and rna transcription product can Form intramolecular dsRNA structures (for example, hair clip) or intermolecular dsRNA structures (for example, by hybridizing with target RNA molecule).
Expression：As used herein, " expression " of coded sequence (for example, gene or transgenosis) refers to such process, is led to Cross the process, the coding information of transcribed nucleic acid unit (including such as genomic DNA or cDNA) be converted into the operation part of cell, Not operation part or structural moiety generally include the synthesis of protein.Gene expression may be influenced by external signal, example The medicament of gene expression is increased or decreased as cell, tissue or organism are exposed to.Gene expression can also be from DNA to RNA Regulated and controled again to any position in the approach of protein.Controlling gene expression is for example by controlling to transcription, translation, RNA The effect of transhipment and processing, middle element (such as mRNA) degradation, or pass through the work after having been generated in specific proteins molecule Change, inactivation, compartmentation or degradation or these combination and occur.Gene expression can be wrapped by any method known in the art Include but be not limited to Northern (RNA) blotting, RT-PCR, Western (immune) blotting, or external, original position or live body Internal protein activation measurement is measured in rna level or protein level.
Inhereditary material：As used herein, term " inhereditary material " includes all genes and nucleic acid molecules, such as DNA with RNA。
Hemipteran pest：As used herein, term " Hemipteran pest " refers to Pentatomidae Insects, with extensive host plant Divide to eat and with piercing through and sucking oral area.In specific example, Hemipteran pest is selected from following inventory：Heroic America stinkbug (neotropical realm palm fibre stinkbug, " BSB "), green rice bug (the green stinkbug in south), Gaede intend wall stinkbug (red tape stinkbug), eating attraction (brown wing Stinkbug), Chinavia hilare (Say) (green stinkbug), brown smelly stinkbug (brown stinkbug), Chinese toon worm (Dallas), Dichelops Furcatus (F.), Edessa meditabunda (F.), Thyanta perditor (F.) (the red shoulder stinkbug in neotropical realm), Chinavia marginatum (Palisot de Beauvois), Horcias nobilellus (Berg) (cotton bedbug), Taedia stigmosa (Berg), Peru red cotton bug, Neomegalotomus parvus (Westwood), Leptoglossus Zonatus (Dallas), Niesthrea sidae (F.), lygushesperus (western tarnished plant bug) and US lyguslineolaris.
Inhibit：As used herein, term " inhibition " refers to when for describing the effect to coded sequence (such as gene) Peptide, polypeptide or the protein product of the mRNA and/or the coded sequence that are transcribed from the coded sequence can measure on a cellular level It reduces on ground.In some instances, inhibit the expression of coded sequence that expression may make almost to disappear." specificity inhibits " refers to just Realize the inhibition in the cell that specificity inhibits to target coded sequence not therewith to the table of other coded sequences (such as gene) Up to having an impact.
Insect：As used herein, for pest, term " insect pest " specifically includes coleopteran insect pests.One In a little examples, term " insect pest " refers specifically to chrysomelid category coleopteran pest selected from the following：Diabroticavirgifera (WCR), Pasteur's root firefly chrysomelid (NCR), 11 star root fireflies chrysomelid (SCR), zea mexicana root firefly chrysomelid (MCR), cucumber strip root Firefly is chrysomelid, 11 asterophyllite first, D.u.undecimpunctata Mannerheim of cucumber and South America are chrysomelid.In some embodiments In, which further includes other insect pests, such as hemipteran pest.
It is separated：" separated " biological components (such as nucleic acid or protein) with the naturally occurring life of component institute Other biological component (i.e. other chromosomes and extrachromosomal DNA and RNA and protein) in object cell is substantially divided From, separately generate or be purified." separated " nucleic acid molecules and protein include being purified by standard purification methods Nucleic acid molecules and protein.The term further includes the nucleic acid and protein prepared by being recombinantly expressed in host cell, And chemically synthesized nucleic acid molecules, protein and peptide.
Nucleic acid molecules：As used herein, term " nucleic acid molecules " can refer to the polymerized form of nucleotide, it may include RNA, The synthesized form and mixed polymer of both cDNA, the sense strand of genomic DNA and antisense strand and above-mentioned items.Nucleotide The modified forms of any one in ribonucleotide, deoxyribonucleotide or both types nucleotide can be referred to.Such as this paper institutes " nucleic acid molecules " and " nucleic acid " and " polynucleotides " are synonyms.Unless otherwise specified, the length of nucleic acid molecules is logical Often it is at least 10 bases.By convention, the nucleotide sequence of nucleic acid molecules is held to 3 ' ends from the 5 ' of the molecule and is read.Nucleotide " complementary series " of sequence refers to the nucleobase that base-pair (that is, A-T/U and G-C) is formed with the nucleobase of the nucleotide sequence 5' is to 3' sequences." reverse complementary sequence " of nucleotide sequence refers to forming base-pair with the nucleobase of the nucleotide sequence Nucleobase 3' is to 5' sequences.
Some embodiments include the nucleic acid containing the template DNA for being transcribed into RNA molecule, and the RNA molecule is mRNA points The complementary series of son.In these embodiments, it is transcribed into the complementary series of the nucleic acid of mRNA molecules and is orientated with 5 ' to 3 ' and existed, So that RNA polymerase (it is with 5 ' to 3 ' direction transcription DNAs) will transcribe out the nucleic acid that can hybridize with mRNA molecules from complementary series. Therefore, can be seen that unless expressly stated otherwise, or from context and refer else, term " complementary series " refer to from 5 ' extremely 3 ' have the polynucleotides for the nucleobase that base-pair can be formed with the nucleobase of reference nucleic acid.Similarly, unless otherwise specifically Bright (or can be seen that and refer else from context), " reverse complementary sequence " of nucleic acid refer to being orientated opposite complementary sequence Row.Foregoing teachings are demonstrated in following diagram：
ATGATGATG polynucleotides
" complementary series " of TACTACTAC polynucleotides
" reverse complementary sequence " of CATCATCAT polynucleotides
Some embodiments of the present invention may include the RNAi molecule to form hairpin RNA.In these RNAi molecules, RNA Both the complementary series of targeted nucleic acid and described reverse complementary sequence is interfered to may alternatively appear in the same molecule so that single-stranded RNA molecule " can fold " on the region comprising complementary polynucleotide and reverse complemental polynucleotides and on the area with from Body hybridizes.
" nucleic acid molecules " include single-stranded and DNA, the RNA of single stranded form and the RNA of double-stranded form of double-stranded form (dsRNA).Term " nucleotide sequence " or " nucleic acid sequence " refer to as individual single-stranded or in duplex nucleic acid sense strands Both with antisense strand.Term " ribonucleic acid " (RNA) includes iRNA (inhibitory RNA), dsRNA (double-stranded RNA), siRNA (small dry Disturb RNA), mRNA (mRNA), shRNA (children purpura nephritis), miRNA (Microrna), hpRNA (hairpin RNA), tRNA (transfer RNA is either mounted with or has unloaded corresponding acylated amino) and cRNA (complementary RNA).Term " DNA " (DNA) include cDNA, genomic DNA and DNA RNA hybrid.Term " polynucleotides " and " nucleic acid " and its " segment " or more one As say " section " will by it will be understood by those skilled in the art that for both include genome sequence, ribosomal RNA sequences, transfer RNA Sequence, mRNA sequence, operon sequence also include coding or may be adapted to the smaller engineering of encoded peptide, polypeptide or protein The functional term of nucleotide sequence.
Oligonucleotides：Oligonucleotides is short nucleic acid polymers.Oligonucleotides can by cut longer nucleic acid segment or It is formed by so that individual nucleotide precursor is polymerize.Automatic synthesizer allows the few nucleosides of up to hundreds of bases of composition length Acid.Since oligonucleotides can be combined with complementary nucleotide sequence, so can be used as detecting the probe of DNA or RNA.By DNA groups At oligonucleotides (oligodeoxyribonucleotide) can PCR (one kind be used for DNA amplification and RNA (reverse transcription is at cDNA) sequence Technology) in use.In PCR, oligonucleotides is commonly known as " primer ", and archaeal dna polymerase is allowed to extend oligonucleotides simultaneously Replicate complementary strand.
Nucleic acid molecules may include naturally occurring nucleotide and/or modified nucleotide, they pass through naturally occurring Nucleotide connects and/or non-naturally occurring nucleotide is connected and linked together.As easily understood by the skilled person Like that, nucleic acid molecules can be modified by sulphation or biochemical modification, or contain non-natural or derivatization nucleosides soda acid Base.Such modification including such as marker, methylate, replaced with analog one or more of naturally occurring nucleotide, Modified between nucleotide (such as without electrical connection：Such as methyl phosphonate, phosphotriester, phosphoramidate, carbamate etc.； Band electrical connection：Such as thiophosphate, phosphorodithioate etc.；Overhang：Such as peptides；Intercalator：Such as acridine, Psoralen Fat element etc.；Chelating agent；Alkylating agent；And modified connection：Such as different head nucleic acid of α etc.).Term " nucleic acid molecules " further includes appointing What topological conformation, including it is single-stranded, double-strand, partial duplex, triplex, hairpin-shaped, circular and padlock shape (padlocked) conformation.
As herein in relation to used in DNA, term " coded sequence ", " structural nucleotide sequence " or " Structural nucleic acid point Son " refers to such nucleotide sequence：When being placed under regulating and controlling sequence control appropriate, finally translated via transcription and mRNA At polypeptide.For RNA, term " coded polynucleotide " refers to the polynucleotides for translating into peptide, polypeptide or protein.Code sequence The boundary of row is determined by the translation initiation codon of 5 '-ends and the translation termination codon of 3 '-ends.Coded polynucleotide Including but not limited to：Genomic DNA, cDNA, EST and recombinant nucleotide sequence.
As used herein, " non-coding polynucleotide of transcription " refers to the untranslated at peptide, more peptide or proteins of mRNA molecules The section of matter, such as 5'UTR, 3'UTR and includes sub-segments.In addition, " non-coding polynucleotide of transcription " refers to being transcribed into The nucleic acid of the RNA to work in cell, the RNA such as structural RNA (such as rRNA (rRNA), for example 5S RRNA, 5.8S rRNA, 16S rRNA, 18S rRNA, 23S rRNA and 28S rRNA etc.), transfer RNA (tRNA), and SnRNA U4, U5, U6 etc..The non-coding polynucleotide of transcription further includes (being such as, but not limited to) tiny RNA (sRNA), the art Language is commonly used to describe small bacterium non-coding RNA, little nucleolar RNA (snoRNA), Microrna (miRNA), siRNA (siRNA), Piwi reciprocations RNA (piRNA) and long non-coding RNA.Also further, " non-coding polynucleotide of transcription " Refer to such polynucleotides：It can natively exist as intragenic " connector " in nucleic acid, and be transcribed into RNA points Son.
Fatal RNA interference：As used herein, term " fatal RNA interference " refers to causing to its delivering for example The RNA interference that the main body individual death of dsRNA, miRNA, siRNA, shRNA and/or hpRNA or viability decline.
Genome：As used herein, term " genome " refers to being present in endonuclear chromosomal DNA, also refers to presence Organelle DNA in the subcellular components of cell.In some embodiments of the present invention, DNA molecular can be imported plant In cell so that DNA molecular is integrated into the genome of plant cell.In these and other embodiments, DNA molecular can It is integrated into the core DNA of plant cell, or is integrated into the chloroplaset of plant cell or the DNA of mitochondria.Term " genome " Refer to both chromosome and the plasmid in bacterial cell when applied to bacterium.In some embodiments of the present invention, it can incite somebody to action DNA molecular imports in bacterium so that the DNA molecular is integrated into the genome of bacterium.In these and other embodiments, DNA molecular can be integrated in chromosome, or as stable plasmid positioning or in stable plasmid.
Sequence identity：As used herein, term " sequence identity " or " homogeneity " are in two nucleic acid or polypeptide sequence Context under, refer to the identical residue in the two sequences when being compared with maximum correspondence in specified comparison window.
As used herein, term " Percentage of sequence identity " can refer to by comparing two best ratios in comparison window To the value that sequence (such as nucleic acid sequence or polypeptide sequence) determines, wherein in order to realize the optimal comparison of the two sequences, the ratio It may include adding compared to reference sequences (it does not include addition or missing) compared with the Sequence in window or lack (i.e. vacancy). Matching position number is generated by determining the number for the position for occurring identical nucleotide or amino acid residue in the two sequences, With the sum of position in the matching position number divided by comparison window, result is multiplied by 100 and generates the percentage of sequence identity, To calculate the percentage.Each position sequence of all same compared with reference sequences is considered and 100% phase of reference sequences Together, vice versa.
Sequence alignment method for comparing is well known in the art.Various programs and alignment algorithm are described in for example following In document：Smith and Waterman (1981) Adv.Appl.Math.2:482；Needleman and Wunsch (1970) J.Mol.Biol.48:443；Pearson and Lipman (1988) Proc.Natl.Acad.Sci.U.S.A.85:2444； Higgins and Sharp (1988) Gene 73:237-244；Higgins and Sharp (1989) CABIOS 5:151-153； Corpet et al., (1988) Nucleic Acids Res.16:10881-10890；Huang et al., (1992) Comp.Appl.Biosci.8:155-165；Pearson et al., (1994) Methods Mol.Biol.24:307-331； Tatiana et al., (1999) FEMS Microbiol.Lett.174:247-250.What sequence alignment method and homology calculated Detailed consideration is found in such as Altschul et al., (1990) J.Mol.Biol.215:403-410.
Basic Local Alignment Search Tool (the BLAST of National Center for Biotechnology Information (NCBI)TM；Altschul etc. People (1990)) it can be obtained from several sources (including National Center for Biotechnology Information (Bethesda, MD)) and can be It is obtained on internet, to combine several sequence analysis programs to use.How the description of sequence identity is determined using the program It can BLAST on the internetTM" help " part obtain.In order to compare nucleic acid sequence, it may be used to utilize to be set as giving tacit consent to and join The BLAST of several acquiescence BLOSUM62 matrixesTM(Blastn) " 2 sequences of Blast " function of program.It is assessed when by the method When, with reference sequences there is the nucleic acid sequence of even bigger similitude will show that homogeneity percentage increases.
It can specific hybrid/complementary specificity：As used herein, term " can specific hybrid " and " complementary specificity " are Show the complementary term of sufficient degree, which is sufficient to make occurs surely between nucleic acid molecules and target nucleic acids molecule Fixed and specificity combination.Hybridization between two nucleic acid molecules is related to being formed between the nucleic acid sequence of the two nucleic acid molecules Antiparallel comparison.Then, the two molecules can corresponding on opposite strand base form hydrogen bond to form duplex molecule, such as The fruit duplex molecule is sufficiently stable, and method detection well known in the art may be used.Nucleic acid molecules can specific hybrid with it Target sequence to need not be 100% complementary.However, the amount for the complementarity that there must be for specific hybrid is with institute The hybridization conditions that use and change.
Cause the hybridization conditions of specific stringency degree will be according to the property of the hybridizing method of selection and hybrid nucleic acid sequence Composition and the length of row and change.It is, in general, that ionic strength (the especially Na of the temperature and hybridization of hybridization+And/or Mg++It is dense Degree) it will determine the stringency hybridized.The ionic strength and wash temperature of washing buffer also influence stringency.Related acquisition is specific The calculating of the required hybridization conditions of stringency degree is known to persons of ordinary skill in the art, and is discussed in for example following In document：Sambrook et al. (editor),Molecular Cloning:A Laboratory Manual, second edition, 1-3 Volume, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 year, the 9th and 11 chapters And update；And Hames and Higgins (editor),Nucleic Acid Hybridization, IRL Press, Oxford, 1985.The further description of related nucleic acid hybridization and guidance can be found in the following documents：Such as Tijssen, " Overview of principles of hybridization and the strategy of nucleic acid Probe assays ", are loaded inLaboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, part i, the 2nd chapter, Elsevier, NY, 1993 Year；And Ausubel et al. (editor),Current Protocols in Molecular Biology, the 2nd chapter, Greene Publishing and Wiley-Interscience, NY, nineteen ninety-five and update.
As used herein, " stringent condition " covers the homologous sequence of sequence and target nucleic acids intramolecular only in hybrid molecule Between the condition that just hybridizes when there is the matching more than 80%." stringent condition " includes other specific Stringency levels. Therefore, as used herein, " medium stringency " condition is that sequences match is more than 80% the molecule of (that is, mispairing is less than 20%) will The condition of hybridization；" high stringency " condition is matching more than the condition that the sequence of 90% (that is, mispairing is less than 10%) will hybridize； And " high stringency " condition is to match the condition that will hybridize more than the sequence of 95% (that is, mispairing is less than 5%).
It is representative non-limiting hybridization conditions below.
High stringency condition (sequence for detecting shared at least 90% sequence identity)：65 in 5x SSC buffer solutions Hybridize 16 hours at DEG C；It is washed twice at room temperature in 2x SSC buffer solutions, 15 minutes every time；And it is buffered in 0.5x SSC It is washed twice at 65 DEG C in liquid, 20 minutes every time.
Medium stringent conditions (sequence for detecting shared at least 80% sequence identity)：In 5x-6x SSC buffer solutions In hybridize 16-20 hours at 65-70 DEG C；It is washed twice at room temperature in 2x SSC buffer solutions, it is 5-20 minutes each；And It is washed twice at 55-70 DEG C in 1x SSC buffer solutions, 30 minutes every time.
Non-critical collating condition (sequence of shared at least 50% sequence identity will hybridize)：In 6x SSC buffer solutions In room temperature to hybridizing 16-20 hours at 55 DEG C；In room temperature at least washing twice at 55 DEG C in 2x-3x SSC buffer solutions, often It is 20-30 minutes secondary.
As used herein, for contiguous nucleic acid sequence, term " substantially homologous " or " substantial homology " refer to by Nucleic acid molecules carry under strict conditions with the contiguous nucleotide sequence of the making nucleic acid molecular hybridization with reference nucleic acid sequence.Example Such as, have and SEQ ID NO:1, in 3,5 and 80 the substantially homologous sequence of the reference nucleic acid sequence of any one nucleic acid molecules It is those of to hybridize nucleic acid with the reference nucleic acid under stringent condition (for example, the medium stringent conditions shown above).Base Homologous sequence can be at least 80% sequence identity in sheet.For example, substantially homologous polynucleotides can have about 80% to 100% sequence identity, such as 79%, 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 98.5%, about 99%, about 99.5% and about 100%.The characteristic and specific hybrid of substantial homology It is closely related.For example, when there are the complementarity of sufficient degree, nucleic acid molecules can specific hybrid, it is expected to avoid nucleic acid It is combined with non-target sequence-nonspecific (for example, under stringent hybridization conditions) in the case of specific binding.
As used herein, term " ortholog thing " refers in two or more species from common ancestors' nucleosides Acid sequence develops and can retain the gene of identical function in described two or more species.
As used herein, when each nucleotide for the sequence read with 5 ' to 3 ' directions and when being read with 3 ' to 5 ' directions Each nucleotide mutual added time of another sequence, two nucleic acid molecules are considered showing " complete complementarity ".With with reference to core The nucleotide sequence of nucleotide sequence complementation will show sequence identical with the reverse complementary sequence of reference nucleotide sequence. These terms and description are clearly defined in this field, and are that those of ordinary skill in the art are understandable.
It is operably connected：When the first nucleic acid sequence and second nucleotide sequence are in functional relationship, the first nucleosides Acid sequence is operably connected with second nucleotide sequence.When being generated with recombination form, the nucleic acid sequence being operably connected is general It is adjoined to, and two protein coding regions can be connected in the same reading frame if necessary (for example, being merged in translation ORF in).However, the nucleic acid being operably connected be not necessarily it is adjacent.
Term " being operably connected " is in the case of related regulating and controlling sequence and coded sequence in use, meaning the regulation and control Sequence influences the expression of the coded sequence of connection." regulating and controlling sequence " or " control element " refer to influence transcription opportunity and it is horizontal/ Amount, RNA are processed or the nucleotide sequence of the translation of stability or related coding sequences.Regulating and controlling sequence may include promoter, turn over Translate targeting sequencing, introne, enhancer, loop-stem structure, repressor binding sequence, termination sequence, Polyadenylation identification sequence Row etc..Specific regulating and controlling sequence can be located at the upstream and/or downstream of the coded sequence being operably connected with it.Moreover, with The specific regulating and controlling sequence that coded sequence is operably connected can be located on the related complementary chain of double-stranded nucleic acid molecule.
Promoter：As used herein, term " promoter " refers to that in transcription initiation upstream and can may participate in RNA The identification and combination of polymerase and other protein are to start the region of DNA domain of transcription.Promoter can with for being expressed in cell Coded sequence be operably connected or promoter can be operably connected with the nucleotide sequence of encoded signal peptide, it is described Nucleotide sequence can be operably connected with the coded sequence for being expressed in cell." plant promoter " can be opened The promoter of transcription in animal and plant cells.In the example of the promoter under development controls includes preferentially starting certain tissues The promoter of transcription, tissue such as leaf, root, seed, fiber, xylem vessel, tracheid or the sclerenchyma.Such promoter It is referred to as " tissue is preferential " promoter.The promoter for only starting the transcription in certain tissues is referred to as " tissue specificity " startup Son." cell type specificity " promoter mainly drives in one or more organs certain cell types (for example, in root or leaf Tie up solencyte) in expression." induction type " promoter can be the promoter that can be under environmental Kuznets Curves.It can be opened by induction type The example that mover starts the environmental condition of transcription includes anaerobic condition and there are light.Tissue-specific promoter, tissue preferentially open Mover, cell type specific promoters and inducible promoter constitute " non-constitutive " and start subclass." composing type " starts Son be can under most of environmental conditions or in most of tissues or cell type active promoter.
Any inducible promoter can be used in some embodiments of the present invention.Referring to Ward et al., (1993) Plant Mol.Biol.22:361-366.Using inducible promoter, transcription rate increases in response to derivant.It is exemplary Inducible promoter includes but not limited to：The promoter in response to copper from ACEI systems；From maize in response to benzene The In2 gene promoters of sulfonamide herbicide safener；Tet repressors from Tn10；And come from steroid hormone gene Inducible promoter, transcriptional activity can be induced by Glucocorticoid (Schena et al., 1991, Proc.Natl.Acad.Sci.USA 88:10421-10425)。
Exemplary group constitutive promoter includes but not limited to：Promoter from plant virus is such as from Cauliflower Mosaic The 35S promoter of viral (CaMV), the promoter from rice actin gene, ubiquitin promoter, pEMU, MAS, maize H3 histones promoter and ALS promoters, the Xba1/NcoI pieces of colea (Brassica napus) ALS3 structural genes 5 ' Section (or nucleotide sequence similar with the Xba1/NcoI segments) (U.S. Patent number 5,659,026).
In addition, any tissue specificity or tissue preferential promoters can be utilized in some embodiments of the present invention. With comprising the coded sequence being operably connected with tissue-specific promoter nucleic acid molecules convert plant can uniquely or The product of the coded sequence is preferentially generated in specific tissue.Illustrative tissue specificity or tissue preferential promoters Including but not limited to：Seed-preferred promoters, such as promoter from phaseolin gene；Leaf specificity and Light-inducible start Son, such as promoter from cab or rubisco；Anther specific promoter, such as promoter from LAT52；Pollen is special Specific Promoters, such as promoter from Zm13；And microspore preferential promoters, such as promoter from apg.
Bean plant：As used herein, term " bean plant " refers to the plant of Glycine (Glycine) species, such as Soybean (Glycine max).
Conversion：As used herein, term " conversion " or " transduction " refer to that one or more nucleic acid molecules are transferred to cell In.It is replicated by cytotostatic by nucleic acid molecules being incorporated in cellular genome or by episomal replication in nucleic acid molecules In the case of, cell is by the nucleic acid molecules " conversion " into the cell of transduceing.As used herein, cover can be by core for term " conversion " Acid molecule imports all technologies in this cell.Example includes but not limited to：It is transfected with viral vectors；Turned with plasmid vector Change；Electroporation (Fromm et al., (1986) Nature 319:791-793)；Liposome transfection (Felgner et al., (1987) Proc.Natl.Acad.Sci.USA 84:7413-7417)；Microinjection (Mueller et al., (1978) Cell 15:579- 585)；Transfer (Fraley et al., (1983) Proc.Natl.Acad.Sci.USA that Agrobacterium (Agrobacterium) mediates 80:4803-4807)；Direct DNA intakes；And microparticle bombardment (Klein et al., (1987) Nature 327:70).
Transgenosis：Exogenous nucleic acid sequence.In some instances, transgenosis can be encode one of dsRNA molecules or The sequence of two chains, the dsRNA molecules include be present in it is nucleic acid molecule complementary in coleoptera and/or Hemipteran pest Nucleotide sequence.In additional examples, transgenosis can be anti sense nucleotide sequence, wherein the expression suppression of the anti sense nucleotide sequence The expression of target nucleic acid sequence processed.In additional examples, transgenosis can be gene order (for example, herbicidal tolerance base Cause), coding industry or pharmaceutically useful compound gene or coding needed for agronomic traits gene.In these and other realities In example, transgenosis contains the regulating and controlling sequence (such as promoter) being operably connected with the coded sequence of transgenosis.
Carrier：It imports in cell for example to generate the nucleic acid molecules of inverted cell.Carrier may include allowing it in host The nucleic acid sequence replicated in cell, such as replication orgin.The example of carrier includes but not limited to：Plasmid, clay, bacteriophage, or Carry the virus that exogenous DNA enters cell.Carrier can also be RNA molecule.Carrier may also comprise one or more genes, anti- Adopted sequence and/or selected marker and other genetic elements known in the art.Carrier can be transduceed, converts or be infected Cell, so as to cause cell express nucleic acid molecule and/or by the protein of the vector encoded.Carrier optionally includes auxiliary nucleic acid Molecule realizes the substance (such as liposome, protein-coated etc.) into cell.
Yield：Relative in identical growth position in same time and the production of inspection kind that grows under the same conditions Amount, about 100% or bigger stabilisation yield.In certain embodiments, " yield of raising " or " improving yield " means Relative in the identical growth position to the harmful coleoptera of crop and/or Hemipteran pest containing quite big density identical Time and the yield of inspection kind grown under the same conditions, the cultivation with 105% to 115% or the stabilisation yield of bigger It cultivates.
Unless specifically stated otherwise or imply, term as used herein "one", expression is " at least for "an" and " should/described " One/kind ".
Unless in addition particularly explaining, otherwise whole technical terms and scientific terms used herein have and disclosure institute The identical meaning that the those of ordinary skill in category field is generally understood.The definition of generic term can be following in molecular biology It is found in publication：Such as Lewin ' sGenes X,Jones&Bartlett Publishers,2009(ISBN 100763766321)；Krebs et al. (editor),The Encyclopedia of Molecular Biology,Blackwell Science Ltd.,1994(ISBN 0-632-02182-9)；And Meyers R.A. (editor),Molecular Biology and Biotechnology:A Comprehensive Desk Reference,VCH Publishers,Inc.,1995 (ISBN 1-56081-569-8).Unless otherwise specified, all percentages are by weight, all solvent mixture proportions with Stereometer.All temperature are in degrees celsius.
IV. include the nucleic acid molecules of coleoptera and/or Hemipteran pest sequence
A. it summarizes
This document describes the nucleic acid molecules that can be used for controlling coleoptera and/or Hemipteran pest.In some instances, insect Pest is coleoptera (such as chrysomelid species) or Semiptera (such as America stinkbug category (Euschistus) species) insect pest.Institute The nucleic acid molecules of description include target sequence (for example, natural gene and non-coding sequence), dsRNA, siRNA, hpRNA, shRNA And miRNA.For example, dsRNA, siRNA, shRNA, miRNA and/or hpRNA molecule are described in some embodiments, these Molecule can be mutual with all or part of specificity of one or more native sequence nucleic acids in coleoptera and/or Hemipteran pest It mends.In these and other embodiments, native sequence nucleic acid can be one or more target genes, and product can example Such as but it is not limited to：Metabolic process is participated in, reproductive process is participated in or participates in the development of larva.Nucleic acid molecules described herein are importing Including when with the cell of at least one native sequence nucleic acid of the nucleic acid molecules complementary specificity, can start in cell RNAi, therefore reduce or eliminate the expression of the native sequence nucleic acid.In some instances, by comprising special with target gene Property complementary sequence nucleic acid molecules reduce or eliminate the expression of target gene coleoptera and/or Hemipteran pest can be caused dead Or growth, development is caused to slow down and/or feed reduction.
In some embodiments, at least one of coleoptera and/or Hemipteran pest target gene can be selected, In the target gene include wupA polynucleotides.In some instances, the target gene in coleopteran pest, the wherein target are selected It includes to be selected from SEQ ID NO to mark gene:1,3,5 and 79 polynucleotides.In particular instances, chrysomelid category coleopteran pest is selected In target gene, wherein the target gene include be selected from SEQ ID NO:1, the polynucleotides of 3,5 and 7-12.In some examples In, the target gene in Hemipteran pest is selected, the wherein target gene includes to be selected from SEQ ID NO:The multinuclear of 79 and 81-83 Thuja acid.
In some embodiments, target gene can be the nucleic acid molecules for including such polynucleotides：The multinuclear glycosides Acid can (in silico) reverse translation be the polypeptide for including continuous amino acid sequence, the continuous amino acid sequence on silicon chip Row and wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79) amino of protein product Acid sequence at least about 85% it is identical (for example, at least 84%, 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% or 100% is identical).Target gene can be any wupA multinuclears in coleoptera and/or Hemipteran pest Thuja acid inhibits have adverse effect to coleoptera and/or Hemipteran pest, or provides confrontation coleoptera for plant after transcription And/or the protection benefit of Hemipteran pest.In specific example, target gene is the nucleic acid comprising such polynucleotides point Son, the polynucleotides can reverse translation be the polypeptide for including continuous amino acid sequence, the continuous amino acid sequence on silicon chip Row and SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 amino acid sequence at least about 85% phase With, it is about 90% identical, about 95% identical, about 96% identical, about 97% identical, about 98% identical, about 99% identical, about 100% It is identical or 100% is identical.
According to the present invention provides nucleotide sequence, expression generates the RNA molecule for including nucleotide sequence, the nucleotide All or part of specificity of sequence and the natural RNA molecule by the coded sequence coding in coleoptera and/or Hemipteran pest It is complementary.In some embodiments, after the RNA molecule of coleoptera and/or Hemipteran pest intake expression, it can get elytrum The downward of mesh and/or the coded sequence in Hemipteran pest cell.In certain embodiments, coleoptera and/or Semiptera Coded sequence in pest cell lower can to the growth of coleoptera and/or Hemipteran pest, viability, proliferation and/or into Food causes adverse effect.
In some embodiments, target sequence includes the non-coding RNA sequence of transcription, such as 5'UTR；3'UTR；Montage Targeting sequencing；Intron sequences；End intron sequences (for example, the 5'UTR RNA then modified in trans-splicing)； Donatron (for example, the required non-coding RNA of donor sequences of trans-splicing is provided) and target coleoptera and/or half wing Other non-codings of mesh pest gene transcribe RNA.Such sequence can derive from both monocistronic gene and polycistron gene.
Therefore, the iRNA molecule (examples comprising at least one nucleotide sequence are also described herein in conjunction with some embodiments Such as dsRNA, siRNA, shRNA, miRNA and hpRNA), the nucleotide sequence and the target in coleoptera and/or Hemipteran pest Mark all or part of complementary specificity of nucleic acid.In some embodiments, iRNA molecules may include and multiple target sequence (examples Such as, 2,3,4,5,6,7,8,9,10 or more target sequences) all or part of complementary one or more nucleotides sequences Row.In certain embodiments, iRNA molecules can generate in vitro, or pass through genetic modified organism body (such as plant or thin Bacterium) in vivo generate.CDNA sequence is also disclosed, can be used for generating and the target in coleoptera and/or Hemipteran pest DsRNA molecules, siRNA molecule, shRNA molecule, miRNA molecule and/or the hpRNA of all or part of complementary specificity of nucleic acid Molecule.Further describe the recombinant dna construct used in the stable conversion for realizing specific host target.Inverted host Target can express dsRNA, siRNA, shRNA, miRNA and/or hpRNA molecule of effective level from the recombinant dna construct.Cause This, also describes a kind of plant conversion carrier, it includes with to have functional heterologous promoter in plant cell operable At least one nucleotide sequence of ground connection, wherein the expression of the nucleotide sequence generates the RNA comprising nucleotide sequence points Son, the nucleotide sequence and coleoptera and/or all or part of complementary specificity of the target sequence in Hemipteran pest.
In some embodiments, it can be used for controlling coleoptera and/or the nucleic acid molecules of Hemipteran pest may include：From The all or part of chrysomelid category or the native sequence nucleic acid of Semiptera separation, it includes wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79)；The nucleotide sequence of such RNA molecule, the RNA are generated in expression Molecule include with by wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79) coding is natural The nucleotide sequence of all or part of complementary specificity of RNA molecule；Including with wupA (SEQ ID NO:1、SEQ ID NO:3、 SEQ ID NO:5 or SEQ ID NO:79) iRNA of at least one nucleotide sequence of all or part of complementary specificity points Sub (such as dsRNA, siRNA, shRNA, miRNA and hpRNA)；It can be used for generating and wupA (SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79) the dsRNA molecules of all or part of complementary specificity, siRNA molecule, The cDNA sequence of shRNA molecule, miRNA and/or hpRNA molecules；And the stable conversion for realizing specific host target Recombinant dna construct, wherein the host's target converted includes one or more of aforementioned nucleic acid molecules.
B. nucleic acid molecules
Invention particularly provides the target bases in the cell, tissue or organ that inhibit coleoptera and/or Hemipteran pest Because of iRNA (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) molecule of expression；And it can be in cell or microorganism What the target gene in the cell, tissue or organ that are expressed as iRNA molecules to inhibit coleoptera and/or Hemipteran pest was expressed DNA molecular.
Some embodiments of the present invention provide a kind of separated nucleic acid molecules, and it includes selected from following at least one Kind (such as it is a kind of, two kinds, it is three or more) nucleotide sequence：SEQ ID NO:1；SEQ ID NO:1 complementary series； SEQ ID NO:3；SEQ ID NO:3 complementary series；SEQ ID NO:5；SEQ ID NO:5 complementary series；SEQ ID NO:79；SEQ ID NO:79 complementary series；SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO: Any one in 79 at least 15 contiguous nucleotides (for example, 15,16,17,18,19,20,21,22,23,24,25,26,27, 28,29,30 or more contiguous nucleotide) segment；SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:The complementary series of the segment of at least 15 contiguous nucleotides of any one in 79；Coleoptera or Semiptera organism (such as WCR and BSB) natural coding sequence, it includes SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO: The all or part of any one in 79；The complementary series of the natural coding sequence of coleoptera or Semiptera organism, the natural volume Code sequence includes SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:The whole of any one in 79 or portion Point；The natural non-coding sequence of coleoptera or Semiptera organism is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、 SEQ ID NO:5 and SEQ ID NO:The all or part of natural RNA molecule of any one in 79；Coleoptera or Semiptera biology The complementary series of the natural non-coding sequence of body, the non-naturally encoded sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO: 3、SEQ ID NO:5 and SEQ ID NO:The all or part of natural RNA molecule of any one in 79；Coleoptera or Semiptera life The segment of at least 15 contiguous nucleotides of the natural non-coding sequence of object, the non-naturally encoded sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:The all or part of natural RNA of any one in 79 points Son；The complementary series of the segment of at least 15 contiguous nucleotides of the natural non-coding sequence of coleoptera or Semiptera organism, The non-naturally encoded sequence is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:In 79 The all or part of natural RNA molecule of any one；At least 15 of the natural coding sequence of coleoptera or Semiptera organism The segment of contiguous nucleotide, the natural coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 With SEQ ID NO:79 natural RNA molecule；At least 15 of the natural coding sequence of coleoptera or Semiptera organism are adjoined The complementary series of the segment of nucleotide, the natural coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:79 natural RNA molecule.In certain embodiments, coleoptera and/or Hemipteran pest contact Or absorb growth, development, breeding and/or feed that the separated nucleic acid sequence inhibits coleoptera and/or Hemipteran pest.
In certain embodiments, insect (such as coleoptera and/or Semiptera) contacting pests or intake divide from the warp From the iRNA of polynucleotides transcription inhibit the growth, development and/or feed of pest.In some embodiments, insect connects It touches or absorbs and occur for food via with the vegetable material comprising the iRNA.In some embodiments, insect contact or intake Occur via the plant for containing the insect with the composition sprayed comprising the iRNA.
In some embodiments, separated nucleic acid molecules of the invention may include being selected from following at least one (example As it is a kind of, two kinds, it is three or more) polynucleotides：SEQ ID NO:89；SEQ ID NO:89 complementary series；SEQ ID NO:90；SEQ ID NO:90 complementary series；SEQ ID
NO:91；SEQ ID NO:91 complementary series；SEQ ID NO:98；SEQ ID NO:98 complementary series；SEQ ID NO:The segment of at least 15 contiguous nucleotides of any one in 92-97 and 99-101；SEQ ID NO:92-97 and 99-101 In at least 15 contiguous nucleotides of any one segment complementary series；The chrysomelid natural coded polynucleotide for belonging to organism, It includes SEQ ID NO:Any one of 92-97；The complementary series of the chrysomelid natural coded polynucleotide for belonging to organism, the day Right coded polynucleotide includes SEQ ID NO:Any one of 92-97；The chrysomelid natural coded polynucleotide for belonging to organism The segment of at least 15 contiguous nucleotides, the natural coded polynucleotide include SEQ ID NO:Any one of 92-97；And leaf The complementary series of the segment of at least 15 contiguous nucleotides of the natural coded polynucleotide of first category organism, the natural coding are more Nucleotide includes SEQ ID NO:Any one of 92-97；The natural coded polynucleotide of Semiptera (such as BSB) organism, It includes SEQ ID NO:Any one of 99-101；The complementary series of the natural coded polynucleotide of Semiptera organism, should Natural coded polynucleotide includes SEQ ID NO:Any one of 99-101；The natural coded polynucleotide of Semiptera organism At least 15 contiguous nucleotides segment, the natural coded polynucleotide include SEQ ID NO:Any one of 99-101； With the complementary series of the segment of at least 15 contiguous nucleotides of the natural coded polynucleotide of Semiptera organism, the natural volume Code polynucleotides include SEQ ID NO:Any one of 99-101.
In some embodiments, nucleic acid molecules of the invention can include and can be expressed as in cell or microorganism At least one of the iRNA molecules to inhibit the target gene in coleoptera and/or Hemipteran pest cell, tissue or organ to express (such as it is a kind of, two kinds, it is three or more) DNA sequence dna.Such DNA sequence dna can be operatively attached to comprising described The promoter sequence to play a role in the cell of DNA molecular, to cause or enhance the coding RNA that can form dsRNA molecules Transcription.In one embodiment, at least one (for example, one, two, three or more) DNA sequence dna can derive From polynucleotides selected from the following：SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 and SEQ ID NO:79.SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 derivative includes SEQ ID NO:1、SEQ ID NO: 3、SEQ ID NO:5 or SEQ ID NO:79 segment.In some embodiments, such segment can include such as SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 at least about 15 contiguous nucleotides or its complementary sequence Row.Therefore, such segment can include such as SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO: 79 15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,40,50,60,70,80,90,100, 110,120,130,140,150,160,170,180,190,200 or more the nucleotide or its complementary series adjoined. , in other embodiments, such segment can include such as SEQ ID NO for these:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 be more than about 15 contiguous nucleotides or its complementary series.Therefore, SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 segment may include such as SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 15,16,17,18,19,20,21, about 25 (such as 22,23,24,25,26,27,28 and 29), About 30, about 40 (such as 35,36,37,38,39,40,41,42,43,44 and 45), about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200 or more adjoin Nucleotide or its complementary series.
Some embodiments include that partially or completely stable dsRNA molecules are imported coleoptera and/or Hemipteran pest To inhibit the expression of target gene in coleoptera and/or Hemipteran pest cell, tissue or organ.When being expressed as iRNA molecules (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) and when being absorbed by coleoptera and/or Hemipteran pest, including SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:The nucleic acid sequence of 79 one or more segments can cause One or more of below：Coleoptera and/or Hemipteran pest are dead, growth printing, sex ration changes, brood size reduces, Infection stops and/or feed stops.For example, in some embodiments, providing a kind of dsRNA molecules, it includes contain base About 15 to about 300 or about 19 to about 300 nucleotide homologous with coleoptera and/or Hemipteran pest target gene sequence in sheet Nucleotide sequence, and include containing SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 One or more segments of nucleotide sequence.The expression of such dsRNA molecules can for example lead to the sheath for absorbing the dsRNA molecules The death of wing mesh and/or Hemipteran pest and/or growth inhibition.
In certain embodiments, dsRNA molecules provided by the present invention include and contain SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:The nucleotide sequence of 79 target gene complementation and/or with SEQ ID NO:1、 SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:The nucleotide sequence of 79 fragment complementation, the target gene is in sheath Being suppressed in wing mesh and/or Hemipteran pest causes for coleoptera and/or Hemipteran pest growth, development or other biological The essential albumen of function or nucleotide sequence agent reduce or eliminate.The nucleotide sequence of selection can be with SEQ ID NO:1、 SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79, SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:The continuous fragment of nucleotide sequence shown in 79 and it is aforementioned in the complementary series of any one show about 80% To about 100% sequence identity.For example, selected nucleotide sequence can express out and SEQ ID NO:1、SEQ ID NO:3、 SEQ ID NO:5 or SEQ ID NO:79, SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 institutes The nucleotide sequence shown adjoin segment or the aforementioned complementary series of any one about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 98.5%, about 99%, about 99.5% or about 100% sequence identity.
In some embodiments, iRNA molecules can be expressed as in cell or microorganism with suppression target gene expression DNA molecular may include and be present in the natural acid sequence in one or more target coleopteras and/or Hemipteran pest species The single nucleotide sequence or DNA molecular of all or part of complementary specificity of row can be by multiple such complementary specificities Sequence construct at chimera.
In some embodiments, nucleic acid molecules may include the first nucleotide sequence and second separated by " intervening sequence " Nucleotide sequence.Intervening sequence can be comprising the secondary structure promoted between the first nucleotide sequence and the second nucleotide sequence Form the region of any nucleotide sequence of (in the case that desired).In one embodiment, intervening sequence is mRNA A part for ariyoshi coded sequence or antisense coded sequence.Alternatively, intervening sequence may include that nucleic acid can be covalently attached to Any combinations of the nucleotide of molecule or its homologue.
For example, in some embodiments, DNA molecular may include the nucleotide for encoding one or more different RNA molecules Sequence, wherein each in the difference RNA molecule all includes the first nucleotide sequence and the second nucleotide sequence, wherein the One nucleotide sequence and the second nucleotide sequence are complimentary to one another.First nucleotide sequence and second nucleotides sequence are listed in It can be connected by intervening sequence in RNA molecule.Intervening sequence may make up first nucleotide sequence or second nucleotide A part for sequence.Including the expression of the RNA molecule of first nucleotide sequence and second nucleotide sequence can pass through Base pairing in the specific molecular of first nucleotide sequence and second nucleotide sequence and cause dsRNA molecule shapes At.First nucleotide sequence or second nucleotide sequence can substantially with coleoptera and/or the day of Hemipteran pest Right nucleic acid sequence (for example, target gene or non-coding sequence of transcription), its derivative or its complementary series are identical.
DsRNA nucleic acid molecules include the double-strand of polymerization ribonucleotide, and may include to phosphate radical-sugar trunk or The modification of nucleosides.The modification of RNA structures can suitably be adjusted so that specificity inhibition can occur.In one embodiment, DsRNA molecules can be modified by the enzymatic processes of generally existing, so as to generate siRNA molecule.The enzymatic processes can profit With external or intravital RNA enzyme III enzymes, the DICER in such as eucaryote.Referring to Elbashir et al., (2001) Nature 411:494-498；And Hamilton and Baulcombe, (1999) Science 286 (5441):950-952. Larger dsRNA chains and/or hpRNA molecules are cut into smaller few nucleosides by DICER or functionally equivalent RNA enzyme III enzymes Sour (such as siRNA), the length in the oligonucleotides each is about 19-25 nucleotide.The siRNA generated by these enzymes Molecule has 2 to 3 protrusions of nucleotide 3 ' and 5 ' phosphate radical ends and 3 ' C-terminals.It is generated by RNA enzyme III enzymes SiRNA molecule untwists in cell and is divided into single stranded RNA.Then, siRNA molecule and the RNA sequence transcribed from target gene are special Specific hybridization, both RNA molecules are then degraded by intrinsic cell RNA degradation mechanism.The process can cause by target It marks the RNA sequence effectively degradation of the target gene coding in organism or removes.The result is that after the gene targeted is transcribed Silence.In some embodiments, the siRNA molecule generated by homologous nucleic acid molecule by endogenous RNA enzyme III enzymes can have Effect mediates the downward of coleoptera and/or the target gene in Hemipteran pest.
In some embodiments, nucleic acid molecules of the invention may include that at least one can be transcribed into single strand RNA molecule Non-naturally occurring nucleotide sequence, the single strand RNA molecule can in vivo pass through molecule intermolecular hybrid and form dsRNA point Son.Such usual self assembly of dsRNA sequences, and can be provided in the source of nutrition of coleoptera and/or Hemipteran pest, with reality Inhibit after the transcription of existing target gene.In these and other embodiments, nucleic acid molecules of the invention may include two kinds not Same non-naturally occurring nucleotide sequence, wherein each nucleotide sequence and the difference in coleoptera and/or Hemipteran pest Target gene complementary specificity.Divide when providing such nucleic acid in the form of dsRNA molecules to coleoptera and/or Hemipteran pest The period of the day from 11 p.m. to 1 a.m, the expression of at least two different target genes in dsRNA molecules in inhibiting coleoptera and/or Hemipteran pest.
C. nucleic acid molecules are obtained
A variety of native sequences in coleoptera and/or Hemipteran pest can be used to design the present invention's as target sequence The DNA molecular of nucleic acid molecules, such as iRNA and coding iRNA.However, it is flat-footed process that the selection of native sequences, which is not,. It can be effective target there was only minority in native sequences in coleoptera and/or Hemipteran pest.For example, can not predict for certain Whether specific native sequences can effectively be lowered by the nucleic acid molecules of the present invention, or whether the downward of specific native sequences can The growth of coleoptera and/or Hemipteran pest, viability, proliferation and/or breeding are adversely affected.The natural elytrum of the overwhelming majority The EST that mesh and/or Hemipteran pest sequence are such as detached from it is (for example, such as U.S. Patent number 7,612,194 and U.S. Patent number It is listed in 7,943,819) to the growth of coleoptera and/or Hemipteran pest, viability, proliferation and/or breeding without adverse effect, The coleoptera and/or Hemipteran pest be such as WCR, NCR, SCR, BSB, green rice bug, Gaede intend wall stinkbug, eating attraction, Chinavia hilare, brown America stinkbug, Chinese toon worm, Dichelops furcatus, Edessa meditabunda, Thyanta Perditor, Chinavia marginatum, Horcias nobilellus, Taedia stigmosa, Peru red cotton bug, Neomegalotomus parvus, Leptoglossus zonatus, Niesthrea sidae, lygushesperus and the U.S. are herded Lygus bug.
It may be unexpected by, in the native sequences that can be adversely affected to coleoptera and/or Hemipteran pest, which energy It is enough to be used in recombinant technique, to the nucleic acid molecules of expression and the complementation of such native sequences in host plant, and in sheath It is adversely affected after wing mesh and/or Hemipteran pest feed, while not being caused damages to host plant.
In some embodiments, nucleic acid molecules of the invention are (for example, will be in coleoptera and/or the place of Hemipteran pest The dsRNA molecules provided in main plant) be selected as targeting such cDNA sequence, the cDNA sequence encode coleoptera and/or Protein or protein portion necessary to Hemipteran pest survival, be such as related to metabolism or catabolism bio-chemical pathway, The amino acid sequence of cell division, breeding, energetic supersession, digestion, host plant identification etc..As described herein, target pest is given birth to Object intake (is generated containing one or more dsRNA at least one section of the dsRNA and the cell of target organism At least one substantially the same section complementary specificity of RNA) composition, can cause the target death or other inhibition Effect.The nucleotide sequence (DNA or RNA) from coleoptera and/or Hemipteran pest can be used build anti-coleoptera and/ Or the plant cell of hemipteran pest infection.For example, can convert coleoptera and/or Hemipteran pest host plant (such as Corn or soybean), so that it is contained one or more nucleosides as herein provided from coleoptera and/or Hemipteran pest Acid sequence.The nucleotide sequence codified being transformed into host is formed in the cell or biofluid in inverted host One or more RNA of dsRNA sequences, therefore, if coleoptera and/or Hemipteran pest form nutrition with transformed host and close It is or when coleoptera and/or Hemipteran pest and transformed host formation nutrition relationship so that dsRNA is available.This can draw Rise and the expression of one or more genes in coleoptera and/or Hemipteran pest cell suppressed, and ultimately cause it is dead or The inhibition that pest is grown or is developed.
Therefore, in some embodiments, targeting substantially participates in the growth of coleoptera and/or Hemipteran pest, development With the gene of breeding.Other target genes used in the present invention may include that for example those are in coleoptera and/or Hemipteran pest Viability, Yun Dong, Gan move, growth, development, the target to play a significant role in infectious, feed position foundation and breeding Gene.Therefore, target gene can be house-keeping gene or transcription factor.In addition, the natural coleoptera that is used in the present invention and/or Hemipteran pest nucleotide sequence can also derive from plant, virus, bacterium or insect genes homologue (such as ortholog Object), the function of the homologue is known to the skilled in the art, and its nucleotide sequence and target coleoptera and/or half Target gene in the genome of wing mesh pest can specific hybrid.By hybridizing gene of the identification with known nucleotide sequence The method of homologue be known to the skilled in the art.
In some embodiments, the present invention provides the method for obtaining nucleic acid molecules, which includes to use In the nucleotide sequence for generating iRNA (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) molecule.A kind of such implementation Scheme includes：(A) one or more target genes are analyzed in coleoptera and/or Hemipteran pest, in the gene that dsRNA is mediated Expression, function after suppressing and phenotype；(b) libraries cDNA or gDNA are detected with probe, the probe includes to come from institute's targeting sheath The all or part or its homologue of the nucleotide sequence of wing mesh and/or Hemipteran pest, targeted pest mediate in dsRNA Suppress (such as decrease) growth that change is shown in analysis or development phenotype；(c) identification hybridizes with probe specificity DNA clone；(d) DNA clone identified in separating step (b)；(e) to the cDNA comprising clone separated in step (d) or GDNA sequencing fragments, wherein the nucleic acid molecules being sequenced include the RNA sequence wholly or largely or its homologue；And (f) chemical synthesis gene order or siRNA or miRNA or shRNA or hpRNA or mRNA or dsRNA be wholly or largely.
In a further embodiment, for obtain comprising for generate most iRNA (such as dsRNA, siRNA, ShRNA, miRNA and hpRNA) method of nucleic acid fragment of nucleotide sequence of molecule includes：(a) the first antisense oligonucleotide primer is synthesized Object and the second Oligonucleolide primers, they are with the native nucleotide sequence from the coleoptera and/or Hemipteran pest that are targeted A part of complementary specificity；And the first Oligonucleolide primers of step (a) and the second Oligonucleolide primers (b) is used to expand CDNA or gDNA inserts present in cloning vector, wherein the nucleic acid molecules expanded include siRNA or shRNA or miRNA or The major part of hpRNA or mRNA or dsRNA molecules.
The nucleic acid of the present invention can be detached by a variety of methods, expanded or be generated.For example, can be derived from by PCR amplification Target nucleic acid sequence (for example, target gene or target non-coding sequence of transcription) of gDNA or cDNA library or part thereof obtains Obtain iRNA (such as dsRNA, siRNA, shRNA, miRNA and hpRNA) molecule.DNA or RNA can be extracted from target organism, and And method known to persons of ordinary skill in the art can be used to prepare nucleic acid library from the DNA or RNA.It can be used and given birth to by target The libraries gDNA or cDNA library that object generates carry out PCR amplification and sequencing to target gene.The PCR product confirmed can be used to make For the template of in-vitro transcription, to generate sense and antisense RNA in the case of bottom line promoter.Alternatively, nucleic acid point Son can be synthesized by any one of many technologies (see, for example, Ozaki et al., (1992) Nucleic Acids Research,20:5205-5214；And Agrawal et al., (1990) Nucleic Acids Research, 18:5419- 5423), including use automatic dna synthesizer (for example, the 392 of P.E.Biosystems, Inc. (Foster City, Calif.) Or 394 type DNA/RNA synthesizers), use standard chemical (such as phosphoramidite chemicals).See, for example, Beaucage etc. People, (1992) Tetrahedron, 48:2223-2311；U.S. Patent number 4,415,732,4,458,066,4,725,677,4, 973,679 and 4,980,460.The alternative chemicals for causing non-natural backbones group, such as thiophosphate, ammonia also can be used Base phosphate etc..
RNA, dsRNA, siRNA, miRNA, shRNA or hpRNA molecule of the present invention can be passed through by those skilled in the art Reaction or automatic reaction are generated with chemistry or enzymatic manually, or comprising containing coding RNA, dsRNA, siRNA, In in vivo generating in the cell of the nucleic acid molecules of the sequence of miRNA, shRNA or hpRNA molecule.It can also be by partially or completely Organic synthesis generates RNA, can import any modified ribonucleotide by external enzymatic or organic synthesis.Cell can be passed through RNA polymerase or phage rna polymerase (for example, T3 RNA polymerases, T7 RNA polymerases and SP6 RNA polymerases) synthesis RNA molecule.The expression construct that can be used for cloning and express nucleotide sequence is known in the art.See, for example, United States Patent (USP) Numbers 5,593,874,5,693,512,5,698,425,5,712,135,5,789,214 and 5,804,693.Chemistry can first be purified RNA molecule that is synthesis or being synthesized by external enzyme' s catalysis, then be conducted into cell.For example, can by with solvent or The combination of resin extraction, precipitation, electrophoresis, chromatography or these means is from purifying mixture RNA molecule.Alternatively, can be It does not purify or in the case that minimum degree purifies using RNA molecule that is chemically synthesized or being synthesized by external enzyme' s catalysis, For example, the loss caused by avoid being processed due to sample.RNA molecule can be dried to store, or dissolving is in aqueous solution.This is molten Liquid can contain buffer or salt, to promote dsRNA molecule double chains body chains to anneal and/or stabilize.
In embodiments, dsRNA can be formed by the RNA chains of single self-complementary or by two complementary RNA chains Molecule.DsRNA molecules can synthesize in vivo or in vitro.The Endogenous RNA polymerase of cell can in vivo mediate one The transcription of item or two RNA chains, or the RNA polymerase of clone in vivo or in vitro mediate transcription can be used.After transcription Inhibit the target gene in coleoptera and/or Hemipteran pest, passes through the specificity in the organ, tissue or cell type of host It transcribes (for example, being carried out by using tissue-specific promoter)；Environmental condition in stimulation of host is (for example, by using sound Should in infection, stress, the inducible promoter of temperature and/or chemical inducer carries out)；And/or certain of engineered host The transcription (for example, being carried out by using puberty specificity promoter) of a puberty or development age, can be that host targets. The RNA chains (whether external or in vivo transcribe) for forming dsRNA molecules can may not be Polyadenylation , and can not polypeptide can may also be translated by the translating equipment of cell.
D. recombinant vector and transformation of host cells
In some embodiments, the present invention also provides for import cell (for example, bacterial cell, yeast cells or Plant cell) in DNA molecular, wherein the DNA molecular include such nucleotide sequence, which, which is listed in, is expressed as RNA and by after coleoptera and/or Hemipteran pest intake, is realized to the cell, tissue or device of coleoptera and/or Hemipteran pest Target gene in official is suppressed.Therefore, some embodiments provide recombinant nucleic acid molecules, and it includes can be in plant cell In be expressed as iRNA (such as dsRNA, siRNA, miRNA, shRNA and hpRNA) molecules to inhibit coleoptera and/or Semiptera to do harm to The nucleotide sequence of target gene expression in worm.In order to start or Enhanced expressing, such recombinant nucleic acid molecules may include one kind Or a variety of regulating and controlling sequences, the regulating and controlling sequence can be operably connected with the nucleic acid sequence that can be expressed as iRNA.In plant The method of middle expressing gene repressor molecule is known, and can be used for expressing the nucleotide sequence of the present invention.See, for example, state Border PCT Publication WO06/073727；And 2006/0200878 Al of U.S. Patent Publication number).
In specific embodiments, recombinant DNA molecules of the invention may include the nucleic acid sequence for encoding dsRNA molecules. Such recombinant DNA molecules can encode such dsRNA molecules, and the dsRNA molecules can inhibit coleoptera after being ingested And/or in Hemipteran pest cell one or more endogenous target genes expression.In many embodiments, transcription RNA can form such dsRNA molecules, and the dsRNA molecules can be provided by stabilized form；For example, with hair clip and stem ring knot The form of structure provides.
In these and other embodiments, a chain of dsRNA molecules can be by transcribing by shape from nucleotide sequence At, the nucleotide sequence substantially with the nucleotide sequences homologous that is made up of：SEQ ID NO:1；SEQ ID NO:1 it is mutual Complementary series；SEQ ID NO:3；SEQ ID NO:3 complementary series；SEQ ID NO:5；SEQ ID NO:5 complementary series； SEQ ID NO:1, the segment of 3 or 5 at least 19 contiguous nucleotides；SEQ ID NO:1, at least 19 of 3 or 5 adjoin nucleosides The complementary series of the segment of acid；The chrysomelid natural coding sequence for belonging to organism (for example, WCR), it includes SEQ ID NO:1,3 or 5；The complementary series of the chrysomelid natural coding sequence for belonging to organism, the natural coding sequence include SEQ ID NO:1,3 or 5；Leaf The natural non-coding sequence of first category organism is transcribed into comprising SEQ ID NO:1,3 or 5 natural RNA molecule；Chrysomelid category life The complementary series of the natural non-coding sequence of object, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1,3 or 5 day Right RNA molecule；The segment of at least 19 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism (for example, WCR), the day Right coded sequence includes SEQ ID NO:1,3 or 5；At least 19 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism Segment complementary series, the natural coding sequence include SEQ ID NO:1,3 or 5；The chrysomelid natural non-coding for belonging to organism The segment of at least 19 contiguous nucleotides of sequence, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1,3 or 5 day Right RNA molecule；With it is chrysomelid belong to organism natural non-coding sequence at least 19 contiguous nucleotides segment complementary series, The natural non-coding sequence is transcribed into comprising SEQ ID NO:1,3 or 5 natural RNA molecule.
In some embodiments, a chain of dsRNA molecules can be formed by being transcribed from nucleotide sequence, the core Nucleotide sequence and the nucleotide sequence being made up of are substantially homologous：SEQ ID NO:79；SEQ ID NO:79 complementary sequence Row；SEQ ID NO:The segment of 79 at least 15 contiguous nucleotides；SEQ ID NO:79 at least 15 contiguous nucleotides The complementary series of segment；The natural coding sequence of Semiptera organism, it includes SEQ ID NO:79；The day of Semiptera organism The complementary series of right coded sequence, the natural coding sequence include SEQ ID NO:79；It is transcribed into half wing of natural RNA molecule The natural non-coding sequence of mesh organism, the natural RNA molecule include SEQ ID NO:79；It is transcribed into natural RNA molecule The complementary series of the natural non-coding sequence of Semiptera organism, the natural RNA molecule include SEQ ID NO:79；Semiptera The segment of at least 15 contiguous nucleotides of the natural coding sequence of organism, the natural coding sequence include SEQ ID NO: 79；The complementary series of the segment of at least 15 contiguous nucleotides of the natural coding sequence of Semiptera organism, the natural volume Code sequence includes SEQ ID NO:79；It is transcribed into the natural non-coding sequence of the Semiptera organism of natural RNA molecule at least The segment of 15 contiguous nucleotides, the natural RNA molecule include SEQ ID NO:79；And it is transcribed into natural RNA molecule The complementary series of the segment of at least 15 contiguous nucleotides of the natural non-coding sequence of Semiptera organism, the natural RNA Molecule includes SEQ ID NO:79.
In certain embodiments, the recombinant DNA molecules of coding dsRNA molecules can include at least two in transcription sequence A nucleotide sequence section, such sequence are arranged such that transcription sequence includes in the first nucleotide sequence area that ariyoshi is orientated Section, and the second nucleotide sequence section (complementary series for including the first nucleotide sequence section) in antisense orientation, wherein There are sense nucleotide sequence section and antisense base sequences section to pass through about five (~5) to about 1,000 (~1000) a nucleotide Intervening sequence section is connected or is combined.Intervening sequence section can form ring between ariyoshi sequence section and antisense sequences section. There are sense nucleotide sequence section or antisense base sequences section can be substantially with target gene (for example, comprising SEQ ID NO: 1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 gene) nucleotide sequence or its segment it is homologous.However, In some embodiments, recombinant DNA molecules can encode the dsRNA molecules without intervening sequence.In embodiments, ariyoshi Coded sequence and antisense coded sequence can have different length.
By creating expression cassette appropriate in the recombinant nucleic acid molecules of the present invention, will can easily be accredited as with to sheath The adverse effect of wing mesh and/or Hemipteran pest or with the plant protection effect for coleoptera and/or Hemipteran pest In the dsRNA molecules of the polynucleotides incorporation expression of fruit.For example, such sequence can be expressed as with stem ring by following steps The hair clip of structure：It obtains and corresponds to target gene sequence (for example, SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、 SEQ ID NO:79 and its segment) the first section；The sequence is connected to the second section intervening sequence area, second section Intervening sequence area and the first section are not homologous or complementary；Then the attachment is connected to third section, wherein third area At least part of section is substantially complementary with the first section.The intramolecular that such construct passes through the first section and third section Base pairing and form loop-stem structure, wherein the ring structure forms and includes the second section.See, for example, U.S. Patent Publication Number 2002/0048814 and 2003/0018993；And International PCT publication WO94/01550 and WO98/05770.Can for example with The form of duplex structure such as loop-stem structure (such as hair clip) generates dsRNA molecules, from there through the piece of coexpression target gene Section (such as can be on expression cassette in additional plant target gene segment) and enhance and target natural coleoptera and/or Semiptera The generation of the siRNA of pest sequence, this causes siRNA to generate enhancing, or mitigates and methylate to prevent dsRNA hair clip promoters Transcriptional gene silencing.
Certain embodiments of the present invention include that the recombinant nucleic acid molecules of the present invention are imported in plant and (converted), with reality The coleoptera of existing one or more iRNA molecules and/or the expression of Hemipteran pest suppression level.Recombinant DNA molecules can be such as It is carrier, such as linear or closed hoop plasmid.Carrier system can be single carrier or plasmid, or contain jointly and to import Two or more carriers or plasmid of total DNA in host genome.In addition, carrier can be expression vector.It can be such as The nucleic acid sequence of the present invention is appropriately interposed in carrier under the control of suitable promoter, the promoter is one or more It is functioned in host with the coded sequence of drive connection or the expression of other DNA sequence dnas.Many carriers can be used for the purpose, and The specific host that the selection of suitable carrier will mainly be converted depending on the size of the nucleic acid in carrier to be inserted into and with carrier Cell.According to the function (for example, DNA amplification or expression DNA) of each carrier and particular host cell compatible, each load Body contains various components.
In order to assign patience of the genetically modified plants to coleoptera and/or Hemipteran pest, such as can be in recombinant plant Recombinant DNA is transcribed into iRNA molecules (for example, forming the RNA molecule of dsRNA molecules) in tissue or fluid.IRNA molecules can wrap Containing to can be basic to the corresponding transcription nucleotide sequence in the hurtful coleoptera of host plant species and/or Hemipteran pest Upper homologous and specifically hybridized nucleotide sequence.The coleoptera and/or Hemipteran pest can for example include by intake The cell or fluid of the transgenic host plant of the iRNA molecules and contact the institute transcribed in transgenic host plant cell State iRNA molecules.Therefore, the expression of target gene in the coleoptera and/or Hemipteran pest for infecting transgenic host plant by Suppress to iRNA molecules.In some embodiments, resistance target gene in target coleoptera and/or Hemipteran pest expressed Suppression can cause plants against pests to be attacked.
In order to enable iRNA molecules be delivered to use the present invention recombinant nucleic acid molecules convert plant cell at Coleoptera in nutrition relationship and/or Hemipteran pest need the expression in plant cell (to transcribe) iRNA molecules.Therefore, Recombinant nucleic acid molecules may include and one or more regulating and controlling sequences (heterologous promoter such as to play a role in host cell Sequence) nucleotide sequence of the present invention that is operably connected, the host cell such as wherein wants the thin of amplifier nucleic acid molecule Bacterium cell, and wherein want the plant cell of express nucleic acid molecule.
The promoter of nucleic acid molecules suitable for the present invention includes inducible promoter, viral promotors, synthesis startup Son or constitutive promoter, they are all well known in the art.The non-limiting examples for describing such promoter include that the U.S. is special Sharp number 6,437,217 (maize RS81 promoters), 5,641,876 (rice actin promoters), 6,426,446 (beautiful another name for Sichuan Province Broomcorn millet RS324 promoters), 6,429,362 (maize PR-1 promoters), 6,232,526 (maize A3 promoters), 6,177, 611 (maize constitutive promoters), 5,322,938,5,352,605,5,359,142 and 5,530,196 (CaMV 35S startups Son), 6,433,252 (maize L3 oleosins promoters), 6,429,357 (2 promoter of rice actin and rice flesh are dynamic 2 introne of albumen), 6,294,714 (light-inducible promoters), 6,140,078 (Salt treatment type promoters), 6,252,138 (disease Pathogem-inducible promoter), 6,175,060 (phosphorus shortage inducible promoters), 6,388,170 (bidirectional promoters), 6,635, (maize leaf is green for 806 (γ-Job's tears alcohol soluble protein (coixin) promoter) and U.S. Patent Publication number 2009/757,089 Body aldolase promoter).Additional promoter includes nopaline synthase (NOS) promoter (Ebert et al., (1987) Proc.Natl.Acad.Sci.USA 84(16):5745-5749) and octopine synthase (OCS) promoter is (both in crown gall It is carried on the tl plasmid of Agrobacterium (Agrobacterium tumefaciens))；Cauliflower mosaic virus group starts Son, such as cauliflower mosaic virus (CaMV) 19S promoters (Lawton et al., (1987) Plant Mol.Biol.9:315- 324)；CaMV 35S promoters (Odell et al., (1985) Nature 313:810-812)；Radix scrophulariae mosaic virus 35 S-startup Son (Walker et al., (1987) Proc.Natl.Acad.Sci.USA 84 (19):6624-6628)；Sucrose synthase promoter (Yang and Russell, (1990) Proc.Natl.Acad.Sci.USA 87:4144-4148)；R gene complex promoters (Chandler et al., (1989) Plant Cell 1:1175-1183)；Chlorophyll a/b binding protein gene promoter；CaMV 35S (U.S. Patent number 5,322,938,5,352,605,5,359,142 and 5,530,196)；FMV 35S (U.S. Patent number 5, 378,619 and 6,051,753)；PC1SV promoters (U.S. Patent number 5,850,019)；SCP1 promoters (U.S. Patent number 6, 677,503)；And AGRtu.nos promoters (GenBankTMAccession number V00087；Depicker et al., (1982) J.Mol.Appl.Genet.1:561-573；Bevan et al., (1983) Nature 304:184-187).
In certain embodiments, nucleic acid molecules of the invention include tissue-specific promoter, such as root-specific Promoter.Root-specific promoter drives uniquely or is preferentially expressed in root tissue the coded sequence being operatively connected.Root The example of specificity promoter is known in the art.See, for example, U.S. Patent number 5,110,732,5,459,252 and 5, 837,848；Opperman et al., (1994) Science 263:221-3；And Hirel et al., (1992) Plant Mol.Biol.20:207-18.In some embodiments, it can be cloned according to this hair between two root-specific promoters The bright nucleotide sequence or segment for coleopteran pest control, the root-specific promoter is relative to the nucleotides sequence Row or segment are orientated with opposite transcriptional orientation, are operable in transgenic plant cells, and in transgenic plant cells Expression so that generate RNA molecule wherein, these RNA molecules can be subsequently formed dsRNA molecules, as mentioned before.Coleoptera and/ Or Hemipteran pest can take in the iRNA molecules expressed in plant tissue, suppress to target gene expression to realize.
The additional regulating and controlling sequence being optionally operably connected with interested nucleic acid molecules includes 5'UTR, 5'UTR Serve as the translation targeting sequencing between promoter sequence and coded sequence.Translation targeting sequencing, which is present in, completely to be processed In mRNA, and the processing of primary transcript and/or the stability of RNA can be influenced.The example for translating targeting sequencing includes beautiful another name for Sichuan Province Broomcorn millet and petunia heat shock protein targeting sequencing (U.S. Patent number 5,362,865), plant viral coat protein targeting sequencing, Plant diphosphoribulose carboxylase (rubisco) targeting sequencing etc..See, for example, Turner and Foster, (1995) Molecular Biotech.3(3):225-36.The non-limiting examples of 5'UTR include GmHsp (U.S. Patent number 5,659, 122), PhDnaK (U.S. Patent number 5,362,865), AtAnt1, TEV (Carrington and Freed, (1990) J.Virol.64:1590-7) and AGRtunos (GenBankTMAccession number V00087；Bevan et al., (1983) Nature 304: 184-7)。
The additional regulating and controlling sequence being optionally operably connected with interested nucleic acid molecules further includes 3 ' untranslateds Sequence, 3 ' transcription termination regions or Polyadenylation area.These are the genetic elements positioned at nucleotide sequence downstream, including are provided Polyadenylation signal and/or can influence transcription or mRNA processing other adjustment signals polynucleotides.Polyadenosine Polyadenylation signal plays a role in plant, and Polyadenylation nucleotide is caused to be added to 3 ' ends of mRNA precursor.Polyadenosine Polyadenylation sequence can derive from various plants gene or T-DNA genes.One non-limiting examples of 3 ' transcription termination regions are rouges 3 ' area (no 3 ' of fat alkali synthase；Fraley et al., (1983) Proc.Natl.Acad.Sci.USA 80:4803-7).Using not The example of 3 ' same non-translational regions is in Ingelbrecht et al., (1989) Plant Cell 1:It is provided in 671-80.Poly gland The non-limiting examples of nucleotide signal include the signal (Ps.RbcS2- from pea (Pisum sativum) RbcS2 genes E9；Coruzzi et al., (1984) EMBO is J.3:1671-9) and AGRtu.nos (GenBankTMAccession number E01312).
Some embodiments may include plant conversion carrier, which includes the DNA through detaching and purifying points Son, the DNA molecular include in the above-mentioned regulating and controlling sequence being operably connected with one or more nucleotide sequences of the present invention At least one.It includes following nucleotide sequence that one or more nucleotides sequences, which are listed in and are generated when expression one or more, IRNA molecules, the nucleotide sequence and all or part of coleoptera and/or the natural RNA molecule in Hemipteran pest are special Property it is complementary.Therefore, one or more nucleotide sequences may include encoding targeted coleoptera and/or Hemipteran pest The all or part of section of existing ribonucleotide in RNA transcript, and may include targeted coleoptera and/ Or all or part of inverted repeats of Hemipteran pest transcript.Plant conversion carrier can contain with more than a kind of target The sequence of sequence-specific complementation is more than a kind of dsRNA with suppression target coleoptera and/or Hemipteran pest to allow to generate One or more groups or species cell in two or more genes expression.It can will be with core present in different genes The members of the nucleotide sequence of nucleotide sequence complementary specificity are at single composite nucleic acid molecule, so as in transgenic plants Expression.Such section can be continuous, or be separated by intervening sequence.
In some embodiments, having contained the plasmid of the present invention of at least one nucleotide sequence of the present invention can pass through Additional one or more nucleotide sequences are sequentially inserted in same plasmid to modify, wherein described additional one or more Nucleotide sequence is operably connected to identical controlling element with original at least one nucleotide sequence.In some embodiment party In case, nucleic acid molecules may be configured to inhibit a variety of target genes.In some embodiments, the several genes to be inhibited can obtain From identical coleoptera and/or Hemipteran pest species, the validity of nucleic acid molecules can be enhanced in this way.In other embodiments In, gene can derive from different coleopteras and/or Hemipteran pest, and it is effective to its can to widen one or more medicaments in this way The range of coleoptera and/or Hemipteran pest.When target several genes with realize suppress or express and suppress combination when, can To manufacture polycistron DNA element.
The recombinant nucleic acid molecules or carrier of the present invention may include that assigning inverted cell (such as plant cell) may be selected table The selectable marker of type.The plant or plant that selectable marker can also be used to select the recombinant nucleic acid molecules comprising the present invention are thin Born of the same parents.The label codified biocide resistance, antibiotic resistance (for example, kanamycins, Geneticin (G418), it is rich come it is mould Element, hygromycin etc.) or herbicide tolerant (such as glyphosate etc.).The example of selectable marker includes but not limited to：Coding card That chloramphenicol resistance and the neo genes that the selections such as kanamycins, G418 can be used；Encode the bar genes of bialaphos-resistant； Encode the mutation epsp synthase gene of glyphosate tolerant；Assign the nitrilase gene to the resistance of Brominal；Assign imidazoles Mutant acetolactate synthase (ALS) gene of quinoline ketone or sulfonylureas tolerance；And methotrexate resistance DHFR genes.There are many Selectable marker is available, assigns to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, to block that mould The resistance of element, lincomycin, methotrexate (MTX), glufosinate, puromycin, spectinomycin, rifampin, streptomysin and tetracycline etc.. The example of such selectable marker is illustrated in such as U.S. Patent number 5,550,318,5,633,435,5,780,708 and 6,118, In 047.
The recombinant nucleic acid molecules or carrier of the present invention also may include can selection markers.Can be used can selection markers monitor table It reaches.It is exemplary can selection markers include：GRD beta-glucuronidase or uidA genes (GUS) encode known various chromogenic substrates Enzyme (Jefferson et al., (1987) Plant Mol.Biol.Rep.5:387-405)；R- locus genes, coding are adjusted Control product (Dellaporta et al., (1988) " Molecular that anthocyanin pigments (red) generate in plant tissue Cloning of the maize R-nj allele by transposon tagging with Ac ", are loaded in18thThis tower Moral strangles science of heredity seminar (Stadler Genetics Symposium), P.Gustafson and R.Appels edit, New York:Plenum, the 263-82 pages)；Beta-lactam enzyme gene (Sutcliffe et al., (1978) Proc.Natl.Acad.Sci.USA 75:3737-41)；Enzyme (such as the PADAC, Yi Zhongsheng of the known various chromogenic substrates of coding Color cephalosporin) gene；Luciferase gene (Ow et al., (1986) Science 234:856-9)；XylE genes are compiled Code can convert catechol dioxygenase (Zukowski et al., (1983) Gene 46 (2-3) of catechol of adding lustre to:247-55)；It forms sediment Powder enzyme gene (Ikatu et al., (1990) Bio/Technol.8:241-2)；Tyrosinase cdna, coding can be by tyrosine It is oxidized to enzyme (Katz et al., (1983) of DOPA and DOPA quinone (it is then condensed into melanin) J.Gen.Microbiol.129:2703-14)；And alpha-galactosidase.
In some embodiments, for create genetically modified plants and in plant expressing heterologous nucleic acid method In, recombinant nucleic acid molecules as previously described can be used to prepare the neurological susceptibility shown to coleoptera and/or Hemipteran pest The genetically modified plants of reduction.It can be for example inserted into plant conversion carrier by the way that the nucleic acid molecules of iRNA molecules will be encoded, then These are imported and prepares plant conversion carrier in plants.
Appropriate method for converting host cell includes any method that can be imported DNA in cell, such as by turning Change protoplast (see, for example, U.S. Patent number 5,508,184), the DNA intakes mediated by drying/inhibition (see, for example, Potrykus et al., (1985) Mol.Gen.Genet.199:183-8), by electroporation (see, for example, U.S. Patent number 5, 384,253), by being stirred (see, for example, U.S. Patent number 5,302,523 and 5,464,765) with silicon carbide fibre, passing through agriculture Conversion that bacillus mediates (see, for example, U.S. Patent number 5,563,055,5,591,616,5,693,512,5,824,877,5, 981,840 and 6,384,301) and by accelerate the coated particles of DNA (see, for example, U.S. Patent number 5,015,580,5, 550,318,5,538,880,6,160,208,6,399,861 and 6,403,865), etc..It is particularly useful for the skill of maize transformation Art is described in such as U.S. Patent number 5,591,616,7,060,876 and 7,939,3281.By applying such as these skill Art can steadily convert the cell of substantially any species.In some embodiments, conversion DNA is integrated into host cell In genome.In the case of many cells species, transgenic cell can be regenerated as transgenic organism.These technologies can be used Any one of generate genetically modified plants, such as include in its genome encode one or more iRNA molecules one kind or The genetically modified plants of multiple nucleic acids sequence.
For expression vector to be imported to the most widely used method in plant with the natural transformation of various Agrobacterium species Based on system.Agrobacterium tumefaciems and agrobacterium rhizogenes (A.rhizogenes) are the plant pathogenics of genetic transformation plant cell Soil bacteria.The Ti-plasmids and Ri plasmids of Agrobacterium tumefaciems and agrobacterium rhizogenes carry the base for being responsible for genetic transformation plant respectively Cause.Ti (tumor inducing) plasmid contains the macroportion for being transferred to inverted plant, referred to as T-DNA.Another section of Ti-plasmids It is responsible for T-DNA transfers in the areas Vir.The areas T-DNA are using terminal repeat as boundary.In modified binary vector, tumor inducing Gene has lacked, and the function in the areas Vir is used for shifting using T-DNA border sequences as the foreign DNA on boundary.The areas T-, which can also contain, to be useful for The effectively selectable marker of recycling transgenic cell and plant, and for being inserted into metastasis sequence such as dsRNA code nucleic acids Multiple cloning sites.
In certain embodiments, plant conversion carrier derives from the Ti-plasmids of Agrobacterium tumefaciems (see, for example, the U.S. 4,536,475,4,693,977,4,886,937 and 5,501,967 and european patent number EP 0 122 of the patent No. 791) or The Ri plasmids of agrobacterium rhizogenes.Additional plant conversion carrier includes (being such as, but not limited to) by Herrera-Estrella etc. People, (1983) Nature 303:209-13；Bevan et al., (1983) Nature 304:184-7；Klee et al., (1985) Bio/Technol.3:637-42；And those of descriptions of european patent number EP 0 120 516, and derive from aforementioned bearer In any one those of.Other bacteriums natively with plant interaction, such as Sinorhizobium Pseudomonas can be modified (Sinorhizobium), rhizobium (Rhizobium) and Autoinducer category (Mesorhizobium), to mediate to perhaps The gene transfer of mostly various plants.Both first Ti-plasmids and suitable binary vector are unloaded by obtaining, these can be made The relevant symbiotic bacteria of plant can be competent at gene transfer.
After providing exogenous DNA to recipient cell, inverted cell is usually identified for further cultivating and planting Object regenerates.In order to improve the ability for identifying inverted cell, technical staff may expect to use the optional of such as preceding proposition or can Riddled basins, wherein conversion carrier are used for generating transformant.Using selectable marker, by keeping cell sudden and violent It is exposed to one or more selective agents and identifies inverted cell in potential inverted cell colony.Mark can be screened in use In the case of note, cell can be screened for desired marker gene character.
It can will be exposed to the cell survived after selective agent or be rated as positive cell in screening test and be placed in It supports to cultivate in the culture medium of plant regeneration.It in some embodiments, can be by including other substance (such as growth regulating Agent) improve any suitable plant tissue culture media (such as MS culture mediums and N6 culture mediums).Tissue can be maintained has On the basal medium of growth regulator, until when enough tissues can be obtained for starting plant regeneration work, or After being manually selected repeat to take turns, (for example, normally about 2 weeks) until when tissue morphology is suitable for regeneration, then turn more It moves on in the culture medium for being beneficial to bud formation.Periodically transfer culture, until when having there is sufficient bud formation.Once shape At bud, just it is transferred into the culture medium for being beneficial to root formation.Enough roots once being formed, so that it may which plant is transferred to soil In, so as to further growth and maturation.
In order to confirm, there are interested nucleic acid molecules (for example, encoding one or more iRNA molecules in aftergrowth DNA sequence dna, the target gene expression in the iRNA molecules in inhibiting coleoptera and/or Hemipteran pest), it can perform a variety of surveys It is fixed.Such measure includes for example：Molecular biology measures, and such as Southern traces and Northern traces, PCR and nucleic acid are surveyed Sequence；Biochemical measurement such as detects whether that there are protein products, such as passes through immunology means (ELISA and/or immune Trace) or by enzyme function；Plant part measures, and such as leaf or root measure；And the analysis of the phenotype to regenerating whole plant.
It can be for example by using the Oligonucleolide primers progress PCR amplification for for example having specificity to interested nucleic acid molecules Carry out analytical integration event.Pcr gene parting should be understood as：From separated host plant callus group The PCR (PCR) for the genomic DNA knitted expands, and the callus prediction contains the sense being integrated into genome Interest nucleic acid molecules, followed by the standard Cloned culturing of pcr amplification product.The method of pcr gene parting has been filled (such as Rios, G. et al., (2002) Plant is J.32 for point description:243-53), it and can be applied to derive from any plant object The gDNA of kind (such as maize or soybean) or organization type, includes the genomic DNA from cell culture.
The genetically modified plants formed using Agrobacterium dependence method for transformation usually contain the list being inserted into item chromosome A recombinant DNA sequence.The single recombinant DNA sequence is referred to as " transgenic event " or " integrating event ".Such genetically modified plants It is hemizygous for the exogenous sequence of insertion.In some embodiments, by the way that single allogenic gene will be contained The independent separation genetically modified plants of sequence and itself (such as T0Plant) sexual cross (selfing) to be to generate T1Seed can get It is homozygous genetically modified plants relative to transgenosis.Generated T1The a quarter of seed can be pure relative to the transgenosis It closes.Sprout T1The plant that seed generates can be used for testing heterozygosity, and the test is measured usually using SNP or thermal expansion increasing is surveyed It is fixed so as to allow to distinguish heterozygote and homozygote (i.e. zygosity determination).
In certain embodiments, being generated in plant cell has coleoptera and/or Hemipteran pest inhibition At least 2,3,4,5,6,7,8,9 or 10 kind or more different iRNA molecule.It can be from the different transformation events of importing Multiple nucleic acids sequence expresses iRNA molecules (such as dsRNA molecules) from the single nucleic acid sequence imported in single transformation event. In some embodiments, multiple iRNA molecules are expressed under the control of single promoter.In other embodiments, multiple Multiple iRNA molecules are expressed under the control of promoter.The single iRNA molecules comprising multiple nucleic acid sequences, the core can be expressed Acid sequence respectively from the different groups of identical coleoptera and/or Hemipteran pest species or different coleoptera and/ Or the different locus in one or more of Hemipteran pest species coleoptera and/or Hemipteran pest is (for example, by SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79 locus limited) it is homologous.
Other than directly converting plant with recombinant nucleic acid molecules, can by make that there is at least one transgenic event One plant carrys out prepare transgenosis plant with the second plant hybridization for lacking this event.For example, can will include coding iRNA molecules Nucleotide sequence recombinant nucleic acid molecules import be easy to conversion the first plant lines in generate genetically modified plants, this turns base Because plant can hybridize with the second plant lines, so that the nucleotide sequence of coding iRNA molecules penetrates into the second plant lines.
The invention also includes the commodity product(s)s of one or more of the sequence comprising the present invention.Specific embodiment packet Include the commodity product(s) generated from the recombinant plant or seed of one or more of the nucleotide sequence comprising the present invention.Including this The commodity product(s) of one or more of the sequence of invention is intended to：The coarse powder of plant, oils, pulverize or it is complete Whole seed or seed, and the recombinant plant comprising one or more of the sequence containing the present invention or seed are any thick Powder, oil or any food product or animal feed product pulverize or complete seed.The one kind or more imagined herein One or more of the sequence that the present invention is detected in kind commodity or commodity product(s) actually demonstrates：The commodity or commodity product(s) It is to control the purpose of coleoptera and/or Hemipteran plant pest for the gene suppression methodologies that dsRNA is mediated are used and set It is calculated as expressing the genetically modified plants generation of one or more of nucleotide sequence of the present invention.
In some respects, include seed and commodity production of the origin derived from the genetically modified plants generation of inverted plant cell Product, wherein the seed or commodity product(s) include can detected level the present invention nucleic acid sequence.It in some embodiments, can example Such as such commodity product(s) is produced by obtaining genetically modified plants and preparing food or feed by it.Include the nucleic acid sequence of the present invention The commodity product(s) of one or more of row includes (being such as, but not limited to)：The coarse powder of plant, oils, pulverize or complete seed Grain or seed, and the recombinant plant comprising one or more of the nucleic acid sequence containing the present invention or seed are any thick Powder, oil or any food product pulverize or complete seed.This is detected in one or more commodity or commodity product(s) One or more of sequence of invention, actually demonstrate the commodity or commodity product(s) be by for control coleoptera and/or The purpose of Hemipteran pest is designed to the genetically modified plants generation of one or more of iRNA molecules of the expression present invention.
In some embodiments, including the genetically modified plants of the nucleic acid molecules of the present invention or seed also can be in its genomes In include at least one other transgenic event, including but not limited to：From its transcription targeting coleoptera and/or Hemipteran pest In from the transgenic event of the iRNA molecules by the different locus of the locus that limits of the following：SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:79, the different locus is such as selected from following one or more bases Because of seat：Caf1-180 (U.S. Patent Application Publication No. 2012/0174258), VatpaseC (U.S. Patent Application Publication No.s 2012/0174259), Rho1 (U.S. Patent Application Publication No. 2012/0174260), VatpaseH (U.S. Patent Application Publications Number 2012/0198586), (U.S. Patent application is public by PPI-87B (U.S. Patent Application Publication No. 2013/0091600), RPA70 Cloth number 2013/0091601), RPS6 (U.S. Patent Application Publication No. 2013/0097730), ROP (U.S. Patent Application No.s 14/ 577,811), rna plymerase i 1 (U.S. Patent Application Publication No. 62/133,214), (the United States Patent (USP) Shen of rna plymerase ii 140 Please publication No. 14/577,854), rna plymerase ii 215 (U.S. Patent Application Publication No. 62/133,202), RNA polymerase II33 (U.S. Patent Application Publication No. 62/133,210), ncm (U.S. Patent Application Publication No. 62/095487), (U.S. Dre4 Patent application publication number 14/705,807), COPI α (U.S. Patent Application Publication No. 62/063,199), COPI β (United States Patent (USP)s Application publication number 62/063,203), COPI γ (U.S. Patent Application Publication No. 62/063,192), COPI δ (U.S. Patent applications Publication No. 62/063,216)；Targeting the organism different from coleoptera and/or Hemipteran pest from its transcription, (such as plant is posted Natural disposition nematode) in gene iRNA molecules transgenic event；Encoding insecticidal proteins (such as B. thuringiensis insecticidal egg In vain, such as Cry34Ab1 (U.S. Patent number 6,127,180,6,340,593 and 6,624,145), Cry35Ab1 (U.S. Patent numbers 6,083,499,6,340,593 and 6,548,291), individual event (such as maize event DAS-59122-7；U.S. Patent number 7,323,556) " Cry34/35Ab1 " combination, Cry3A (such as U.S. Patent number 7,230,167), Cry3B (such as U.S. in The patent No. 8,101,826), Cry6A (such as U.S. Patent number 6,831,062) and combinations thereof (such as U.S. Patent Application No. 2013/0167268,2013/0167269 and gene 2013/0180016)；Herbicide tolerance gene is (for example, provide to grass The gene of sweet phosphine, glufosinate-ammonium, the tolerance of Mediben or 2,4-D (such as U.S. Patent number 7,838,733))；And facilitates and turning The base of desired phenotype (such as yield increases, fatty acid metabolism changes or cytoplasmic male sterility restores) in gene plant Cause.In certain embodiments, the sequence and other insect controllings of iRNA molecules of the present invention can will be encoded in plant Shape or disease resistance trait combination, to realize the anticipant character of control of the enhancing to insect damage and plant disease.Unique make will be used The probability due to can for example be formed in field to the resistance of one or more characters is combined with the insect control character of pattern It reduces, the protected genetically modified plants with the outstanding durability better than the plant containing single control character can be provided.
V. the target gene in coleoptera and/or Hemipteran pest is suppressed
A. it summarizes
In some embodiments of the present invention, at least one can be provided to coleoptera and/or Hemipteran pest can be used for The nucleic acid molecules of coleoptera and/or Hemipteran pest are controlled, wherein the nucleic acid molecules are done harm in the coleoptera and/or Semiptera The gene silencing for causing RNAi to mediate in worm.In certain embodiments, it can be provided to coleoptera and/or Hemipteran pest IRNA molecules (such as dsRNA, siRNA, miRNA, shRNA and hpRNA).It in some embodiments, can be by making can be used for The nucleic acid molecules of control coleoptera and/or Hemipteran pest are contacted with coleoptera and/or Hemipteran pest, to be carried to the pest For the nucleic acid molecules.It, can be in coleoptera and/or the feed matrix of Hemipteran pest in these and other embodiments The nucleic acid molecules that can be used for controlling the coleoptera and/or Hemipteran pest are provided in (such as alimentation composition).These and In other embodiments, can by take in by coleoptera and/or Hemipteran pest take in comprising can be used for controlling the sheath The vegetable material of the nucleic acid molecules of wing mesh and/or Hemipteran pest, to provide the nucleic acid molecules.In certain embodiments, Nucleic acid molecules are present in by the recombinant nucleic acid sequence in expression importing vegetable material in the vegetable material, the expression example Such as by converting plant cell with the carrier comprising recombinant nucleic acid sequence, then from inverted Plant cell regeneration vegetable material or Whole plant and carry out.
The target gene that B.RNAi is mediated is suppressed
In embodiments, the present invention offer be designed to targeting coleoptera and/or Hemipteran pest (such as WCR, NCR, SCR, MCR, cucumber strip root firefly are chrysomelid, 11 asterophyllite first, South America of cucumber is chrysomelid, D.u.undecimpunctata, BSB, rice Acrosternumhilare, Gaede intend wall stinkbug, eating attraction, green stinkbug, brown smelly stinkbug, Chinese toon worm, Dichelops furcatus, Edessa meditabunda、Thyanta perditor、Chinavia marginatum、Horcias nobilellus、Taedia Stigmosa, Peru red cotton bug, Neomegalotomus parvus, Leptoglossus zonatus, Niesthrea Sidae, lygushesperus and US lyguslineolaris) required native nucleotide sequence (such as indispensable gene) in transcript profile IRNA molecules (such as dsRNA, siRNA, miRNA, shRNA and hpRNA), such as contained comprising at least one and target by design Mark the iRNA molecules of the chain of the nucleotide sequence of sequence-specific complementation.The sequence of the iRNA molecules so designed can be with target Sequence is identical, or can mix the mispairing for not preventing the specific hybrid between iRNA molecules and its target sequence.
The iRNA molecules of the present invention can make in the method suppressed for the gene in coleoptera and/or Hemipteran pest With to reduce the water damaged as caused by pests on plants (for example, shielded inverted plant comprising iRNA molecules) Flat or incidence.As used herein, term " gene is suppressed " refers to for reducing since genetic transcription is at mRNA and subsequent mRNA Horizontal any well-known process of the protein of translation and generation, including reduce the albumen expressed by gene or coded sequence Inhibit expression and transcription repression after matter, including transcription.Inhibit through the genetic transcription suppressed from being targeted after transcription Specific cognate between all or part of mRNA and the corresponding iRNA molecules for suppressing mediates.In addition, after transcription Inhibition refers to that the amount of the available mRNA for being combined by ribosomes in cell substantive and measurable decline occurs.
In the particular embodiment that wherein iRNA molecules are dsRNA molecules, enzyme DICER can cut into dsRNA molecules Short siRNA molecule (length is about 20 nucleotide).The double-strand siRNA that the activity of dsRNA molecules is generated by DICER Molecule can be divided into two single-stranded siRNA：" passerby chain " and " guiding chain ".Passerby chain is degradable, and guiding chain can then mix in RISC. Inhibit, by the specific hybrid of guiding chain and the complementary specificity sequence of mRNA molecules, then to pass through enzyme after transcription Argonaute (catalyst component of RISC compounds) cuts and occurs.
In embodiments of the invention, any type of iRNA molecules can be used.It will be understood by those within the art that During in preparation process and the step of providing iRNA molecules to cell, dsRNA molecules are usually more than single strand RNA molecule Stablize, and is generally also more stable in cell.Although thus, for example, in some embodiments siRNA molecule and MiRNA molecule may be equally effective, but dsRNA molecules may be selected due to its stability.
In certain embodiments, the nucleic acid molecules comprising nucleotide sequence are provided, which can be in body Outer expression is to generate iRNA molecules, the iRNA molecules and the nucleotide sequence institute in coleoptera and/or Hemipteran pest genome The nucleic acid molecules of coding are substantially homologous.In certain embodiments, the iRNA molecules of in-vitro transcription can be include stem ring knot The stabilisation dsRNA molecules of structure.After coleoptera and/or Hemipteran pest contact the iRNA molecules of in-vitro transcription, it can occur To inhibiting after the transcription of the target gene (such as indispensable gene) in the coleoptera and/or Hemipteran pest.
In some embodiments of the present invention, inhibit the method for the target gene in coleopteran pest after for transcription The expression of the nucleic acid molecules of at least 15 contiguous nucleotide of the middle use comprising nucleotide sequence, wherein the nucleotide sequence selects From：SEQ ID NO:1；SEQ ID NO:1 complementary series；SEQ ID NO:3；SEQ ID NO:3 complementary series；SEQ ID NO:5；SEQ ID NO:5 complementary series；SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:At least 15 of 5 are adjoined The segment of nucleotide；SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:The segment of 5 at least 15 contiguous nucleotides Complementary series；The chrysomelid natural coding sequence for belonging to organism (for example, WCR), it includes SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；The complementary series of the chrysomelid natural coding sequence for belonging to organism, the natural coding sequence include SEQ ID NO: 1、SEQ ID NO:3 or SEQ ID NO:5；The chrysomelid natural non-coding sequence for belonging to organism, is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule；The complementation of the chrysomelid natural non-coding sequence for belonging to organism Sequence, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA Molecule；The complementary series of the chrysomelid natural non-coding sequence for belonging to organism, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule；The chrysomelid natural volume for belonging to organism (for example, WCR) The segment of at least 15 contiguous nucleotides of code sequence, the natural coding sequence include SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；The complementary series of the segment of at least 15 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism, should Natural coding sequence includes SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；The chrysomelid natural non-coding for belonging to organism The segment of at least 15 contiguous nucleotides of sequence, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule；Adjoin core at least 15 of the chrysomelid natural non-coding sequence for belonging to organism The complementary series of the segment of thuja acid, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule.In certain embodiments, can use with it is aforementioned in any one at least 80% (for example, 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% and 100%) The expression of identical nucleic acid molecules.In these and other embodiments, it can express and be present in coleopteran pest extremely The nucleic acid molecules of RNA molecule specific hybrid in a few cell.
In certain embodiments of the invention, inhibit the method for the target gene in Hemipteran pest after for transcription The expression of the nucleic acid molecules of at least 15 contiguous nucleotide of the middle use comprising nucleotide sequence, wherein the nucleotide sequence selects From：SEQ ID NO:79；SEQ ID NO:79 complementary series；SEQ ID NO:The piece of 79 at least 15 contiguous nucleotides Section；SEQ ID NO:The complementary series of the segment of 79 at least 15 contiguous nucleotides；The natural code sequence of Semiptera organism Arrange SEQ ID NO:79；The complementary series of the natural coding sequence of Semiptera organism, the natural coding sequence include SEQ ID NO:79；It is transcribed into the natural non-coding sequence of the Semiptera organism of natural RNA molecule, the natural RNA molecule includes SEQ ID NO:79；It is transcribed into the complementary series of the natural non-coding sequence of the Semiptera organism of natural RNA molecule, the day Right RNA molecule includes SEQ ID NO:79；It is transcribed into the mutual of the natural non-coding sequence of the Semiptera organism of natural RNA molecule Complementary series, the natural RNA molecule include SEQ ID NO:79；At least 15 of the natural coding sequence of Semiptera organism are adjoined The even segment of nucleotide, the natural coding sequence include SEQ ID NO:79；The natural coding sequence of Semiptera organism The complementary series of the segment of at least 15 contiguous nucleotides, the natural coding sequence include SEQ ID NO:79；Transcription is all day long The segment of at least 15 contiguous nucleotides of the natural non-coding sequence of the Semiptera organism of right RNA molecule, the natural RNA Molecule includes SEQ ID NO:79；And be transcribed into natural RNA molecule Semiptera organism natural non-coding sequence extremely The complementary series of the segment of few 15 contiguous nucleotides, the natural RNA molecule include SEQ ID NO:79.In certain embodiment party In case, can use with it is aforementioned in any one at least 80% (for example, 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% and 100%) the expression of identical nucleic acid molecules.At these and in addition In embodiment, the core of RNA molecule specific hybrid that can express and be present at least one cell of Hemipteran pest Acid molecule.
In some embodiments, inhibit to make in the method for the target gene in coleopteran pest after for transcription With the expression of at least one nucleic acid molecules of at least 15 contiguous nucleotides comprising nucleotide sequence, wherein the nucleotides sequence Column selection is certainly：SEQ ID NO:1；SEQ ID NO:1 complementary series；SEQ ID NO:3；SEQ ID NO:3 complementary series； SEQ ID NO:5；SEQ ID NO:5 complementary series；SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 at least The segment of 15 contiguous nucleotides；SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 at least 15 contiguous nucleotides Segment complementary series；The chrysomelid natural coding sequence for belonging to organism (for example, WCR), it includes SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；The complementary series of the chrysomelid natural coding sequence for belonging to organism (for example, WCR), the natural volume Code sequence includes SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；The chrysomelid natural non-coding sequence for belonging to organism, It is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule；Chrysomelid category organism The complementary series of natural non-coding sequence, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule；At least 15 of the chrysomelid natural coding sequence for belonging to organism (for example, WCR) adjoin core The segment of thuja acid, the natural coding sequence include SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；Chrysomelid category biology The complementary series of the segment of at least 15 contiguous nucleotides of the natural coding sequence of body, the natural coding sequence include SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5；At least 15 of the chrysomelid natural non-coding sequence for belonging to organism adjoin nucleosides The segment of acid, the natural non-coding sequence are transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 it is natural RNA molecule；It, should with the complementary series of the segment of at least 15 contiguous nucleotides of the chrysomelid natural non-coding sequence for belonging to organism Natural non-coding sequence is transcribed into comprising SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:5 natural RNA molecule. In certain embodiments, can use with it is aforementioned in any one at least 80% (for example, 80%, about 81%, about 82%, about 83%, About 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, About 95%, about 96%, about 97%, about 98%, about 99%, about 100% and 100%) the expression of identical nucleic acid molecules.At these In other embodiments, the RNA molecule that can be expressed and be present at least one cell of coleopteran pest is specific The nucleic acid molecules of hybridization.In specific example, such nucleic acid molecules may include containing SEQ ID NO:1、SEQ ID NO:3 Or SEQ ID NO:5 nucleotide sequence.
In the particular embodiment of the present invention, inhibit the method for the target gene in Hemipteran pest after for transcription The expression of the nucleic acid molecules of at least 15 contiguous nucleotide of the middle use comprising nucleotide sequence, wherein the nucleotide sequence selects From：SEQ ID NO:79；SEQ ID NO:79 complementary series；SEQ ID NO:The piece of 79 at least 15 contiguous nucleotides Section；SEQ ID NO:The complementary series of the segment of 79 at least 15 contiguous nucleotides；The natural code sequence of Semiptera organism Arrange SEQ ID NO:79；The complementary series of the natural coding sequence of Semiptera organism, the natural coding sequence include SEQ ID NO:79；It is transcribed into the natural non-coding sequence of the Semiptera organism of natural RNA molecule, the natural RNA molecule includes SEQ ID NO:79；It is transcribed into the complementary series of the natural non-coding sequence of the Semiptera organism of natural RNA molecule, the day Right RNA molecule includes SEQ ID NO:79；It is transcribed into the mutual of the natural non-coding sequence of the Semiptera organism of natural RNA molecule Complementary series, the natural RNA molecule include SEQ ID NO:79；At least 15 of the natural coding sequence of Semiptera organism are adjoined The even segment of nucleotide, the natural coding sequence include SEQ ID NO:79；The natural coding sequence of Semiptera organism The complementary series of the segment of at least 15 contiguous nucleotides, the natural coding sequence include SEQ ID NO:79；Transcription is all day long The segment of at least 15 contiguous nucleotides of the natural non-coding sequence of the Semiptera organism of right RNA molecule, the natural RNA Molecule includes SEQ ID NO:79；And be transcribed into natural RNA molecule Semiptera organism natural non-coding sequence extremely The complementary series of the segment of few 15 contiguous nucleotides, the natural RNA molecule include SEQ ID NO:79.In certain embodiment party In case, can use with it is aforementioned in any one at least 80% (for example, 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% and 100%) the expression of identical nucleic acid molecules.At these and in addition In embodiment, the core of RNA molecule specific hybrid that can express and be present at least one cell of Hemipteran pest Acid molecule.In specific example, such nucleic acid molecules may include containing SEQ ID NO:79 nucleotide sequence.
The important feature of some embodiments of the present invention is that suppression system can tolerate target gene after RNAi transcriptions The sequence variations that middle expection may occur due to genetic mutation, strain polymorphism or evolutionary divergence.The nucleic acid molecules of importing can With need not be absolutely homologous with the primary transcript of target gene or the mRNA processed completely, as long as the nucleic acid molecules and target that import The mRNA for marking the primary transcript of gene or processing completely can specific hybrid.In addition, relative to the first of target gene Grade transcription product or the mRNA processed completely, the nucleic acid molecules of importing may not necessarily be overall length.
IRNA technology suppression target genes using the present invention are sequence-specifics；That is, targeting with it is a kind of or The substantially homologous nucleotide sequence of a variety of iRNA molecules carries out hereditary inhibition.In some embodiments, can use comprising Inhibited with the RNA molecule of a part of identical nucleotide sequence of target gene sequence.In these and other embodiment party In case, it can use comprising the nucleotide relative to target gene sequence with one or more insertions, missing and/or point mutation The RNA molecule of sequence.In certain embodiments, a part for iRNA molecules and target gene can be shared for example, at least from about 80%, at least from about 81%, at least from about 82%, at least from about 83%, at least from about 84%, at least from about 85%, at least from About 86%, at least from about 87%, at least from about 88%, at least from about 89%, at least from about 90%, at least from about 91%, at least From about 92%, at least from about 93%, at least from about 94%, at least from about 95%, at least from about 96%, at least from about 97%, to Less from about 98%, at least from about 99%, at least from the sequence identity of about 100% and 100%.Alternatively, dsRNA molecules Duplex area can specific hybrid with a part for target gene transcript.In specifically hybridized molecule, performance Go out larger homology compensates longer, the lower sequence of homology less than the sequence of overall length.In the duplex area of dsRNA molecules Length with a part of identical nucleotide sequence of target gene transcript can be at least about 15,16,17,18,19,20, 21,22,23,24,25,26,27,28,29,30,35,40,45,25,50,100,200,300,400,500 or at least about 1000 bases.In some embodiments, it can use and be more than 15 sequences to 100 nucleotide.Specifically implementing In scheme, greater than about 200 sequences to 300 nucleotide can be used.In certain embodiments, according to target gene Size, can use greater than about 500 sequences to 1000 nucleotide.
It in certain embodiments, can be by the expression of target gene in coleoptera and/or Hemipteran pest in the elytrum The intracellular inhibition at least 10%, at least 33%, at least 50% or at least 80% of mesh and/or Hemipteran pest so that occur aobvious It writes and inhibits.It refers to the inhibition for being higher than threshold value to significantly inhibit, which causes the phenotype that can be detected (for example, growth stops, feed stops Only, stopping, induced death etc. are developed), or RNA corresponding with the target gene inhibited and/or gene outcome appearance can The reduction of detection.Although in certain embodiments of the invention, in the coleoptera and/or the substantially institute of Hemipteran pest Have in cell and inhibit, but in other embodiments, only inhibits in the cell subset of expression target gene.
In some embodiments, the transcription repression in cell is by showing and promoter DNA sequence or its complementary series The presence of dsRNA molecules of substantial sequence homogeneity mediated, to realize so-called " promoter trans-repression ".Gene Suppressing can be in the coleoptera and/or Hemipteran pest that can take in or contact such dsRNA molecules (such as by taking in or connecing Touch the vegetable material containing the dsRNA molecules) it works for target gene.The dsRNA used in promoter trans-repression Molecule can specifically be designed as inhibiting or suppress one or more homologous in coleoptera and/or Hemipteran pest cell or The expression of complementary series.It discloses and passes through in U.S. Patent number 5,107,065,5,231,020,5,283,184 and 5,759,829 The RNA that antisense or ariyoshi are orientated, which carries out posttranscriptional gene, to be suppressed to regulate and control the gene expression in plant cell.
C. it is supplied to the expression of the iRNA molecules of coleoptera and/or Hemipteran pest
Can by many external forms or in vivo any one of form expression in coleoptera and/or Hemipteran pest The iRNA molecules that the middle gene for carrying out RNAi mediations inhibits.Then iRNA molecules can be provided to coleoptera and/or Hemipteran pest, Such as by making iRNA molecules and contacting pests, or by causing pest to take in or be otherwise internalized by iRNA molecules.This hair Some bright embodiments include the inverted host plant, inverted plant cell and warp of coleoptera and/or Hemipteran pest Convert the offspring of plant.Inverted plant cell and inverted plant can be engineered for for example in the control of heterologous promoter One or more of described iRNA molecules of the lower expression of system, to provide pest protection effect.Therefore, when coleoptera and/or half wing Mesh pest on the feed during eat genetically modified plants or when plant cell, which can take in genetically modified plants or cell and express IRNA molecules.Also the nucleotide sequence of the present invention can be imported diversified prokaryotic micro-organisms host and eukaryotic microorganisms place To generate iRNA molecules in master.Term " microorganism " includes protokaryon species and eukaryon species, such as bacterium and fungi.
Controlling gene expression may include partially or completely suppressing to this expression.In another embodiment, it is used for Suppress the method for the gene expression in coleoptera and/or Hemipteran pest to be included in offer gene in the tissue of pest host to suppress Amount is listed at least one dsRNA molecules for being formed after transcription by nucleotides sequence as described herein, at least one section with Coleoptera and/or the intracellular mRNA sequence of Hemipteran pest are complementary.It is taken the photograph by coleoptera and/or Hemipteran pest according to the present invention The dsRNA molecules (including its modified forms, such as siRNA, miRNA, shRNA or hpRNA molecule) taken can with from comprising containing There are SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5 or SEQ ID NO:The nucleic acid molecules of 79 nucleotide sequence are transcribed RNA molecule at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, About 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, About 100 or 100% identical.It thus provides the core through detaching and substantially purifying of the dsRNA molecules for providing the present invention Acid molecule, including but not limited to non-naturally occurring nucleotide sequence and recombinant dna construct, import coleoptera and/or Suppress or inhibit the expression of endogenous coded sequence or target coded sequence therein when Hemipteran pest.
Specific embodiment is provided for delivering iRNA molecules to inhibit coleoptera and/or Semiptera to plant after transcribing One or more target genes in object pest and control the coleoptera and/or Hemipteran plant pest group delivering System.In some embodiments, the delivery system includes to host transgenic plant cell or included in host cell The intake of the host cell content of the RNA molecule of transcription.In these and other embodiments, it is thin to create genetically modified plants Born of the same parents or genetically modified plants, the recombinant dna construct containing the stabilisation dsRNA molecules for being useful for the offer present invention.Including coding The transgenic plant cells of the nucleic acid sequence of specific iRNA molecules and genetically modified plants can be generated by following manner：Using recombination IRNA molecule of DNA technique (these basic technologies are well known in the art) structure comprising the coding present invention is (for example, stabilized DsRNA molecules) nucleotide sequence plant conversion carrier, plant cell or plant are converted with this, and generate containing turning with this The transgenic plant cells of the iRNA molecules of record or genetically modified plants.
It, can be for example by recombinant DNA molecules in order to assign resistance of the genetically modified plants to coleoptera and/or Hemipteran pest It is transcribed into iRNA molecules, such as dsRNA molecules, siRNA molecule, miRNA molecule, shRNA molecule or hpRNA molecules.At some In embodiment, the RNA molecule transcribed from recombinant DNA molecules can form dsRNA points in the tissue or fluid of recombinant plant Son.Such dsRNA molecules may be embodied in a part for nucleotide sequence, the nucleotide sequence with from host can be infected The corresponding nucleotide sequence of the coleoptera of the type of plant and/or the DNA sequence dna transcription in Hemipteran pest is identical.Target gene Expression in coleoptera and/or Hemipteran pest is inhibited by the dsRNA molecules taken in, and coleoptera and/or half wing The inhibition that target gene is expressed in mesh pest causes such as coleoptera and/or Hemipteran pest to stop feed, and final result is example If genetically modified plants are from the further damage of coleoptera and/or Hemipteran pest.The regulating and controlling effect that dsRNA molecules have been displayed is suitable Several genes for being expressed in pest, including for example it is responsible for the endogenous gene of cell metabolism or cell transformation, including house keeper Gene；Transcription factor；Husking related gene；And coding is related to other bases of cell metabolism or normal growth and the polypeptide of development Cause.
For transgenosis or expression construct transcription from the living body, control region (example can be used in some embodiments Such as, promoter, enhancer, silencer and polyadenylation signal) transcribe one or more RNA chains.Therefore, in some realities Apply in scheme, as shown in above, the nucleotide sequence that is used in generating iRNA molecules can in plant host cell Have functional one or more promoter sequences to be operably connected.Promoter can be usually resided in host genome Internal promoter.The nucleotide sequence of the present invention under the promoter sequence control being operably connected can further side Connecing advantageously influences the additional sequences of its transcription and/or gained transcript stability.Such sequence, which can be located at, to be operably connected Promoter upstream, expression construct 3 ' hold downstream, and can not only be present in the promoter upstream but be present in expression structure Body 3 ' holds downstream.
Some embodiments provide for mitigate by with plant be food coleoptera and/or Hemipteran pest caused by it is right The method of the damage of host plant (such as corn plant), wherein the method includes providing the expression present invention in host plant At least one nucleic acid molecules inverted plant cell, wherein the nucleic acid molecules are by the coleoptera and/or Semiptera It is played a role after pest intake to inhibit the expression of target sequence in the coleoptera and/or Hemipteran pest, the expression inhibiting The coleoptera and/or Hemipteran pest death, growth is caused to slow down and/or breed reduction, to mitigate by the coleoptera And/or the damage caused by Hemipteran pest to host plant.In some embodiments, the nucleic acid molecules include dsRNA Molecule.In these and other embodiments, the nucleic acid molecules include dsRNA molecules, and the dsRNA molecules respectively contain More than the specifically hybridized nucleotide sequence of nucleic acid molecules expressed in a kind of and coleoptera and/or Hemipteran pest cell. In some embodiments, the nucleic acid molecules are made of a kind of nucleotide sequence, the nucleotide sequence and coleoptera and/or The nucleic acid molecules expressed in Hemipteran pest cell can specific hybrid.
In other embodiments, the method for improving corn crop yield is provided, wherein the method includes will At least one nucleic acid molecules of the present invention import in corn plant；The corn plant is cultivated, to allow expression to include the nucleic acid The iRNA molecules of sequence, wherein the expression inhibiting coleoptera of the iRNA molecules comprising the nucleic acid sequence and/or Hemipteran pest Growth and/or coleoptera and/or Hemipteran pest damage, to reduce or eliminate since coleoptera and/or Hemipteran pest are invaded Production loss caused by dye.In some embodiments, the iRNA molecules are dsRNA molecules.In these and other implementation In scheme, the nucleic acid molecules include dsRNA molecules, and the dsRNA molecules are respectively contained more than a kind of and coleoptera and/or half The specifically hybridized nucleotide sequence of nucleic acid molecules expressed in wing mesh pest cell.In some embodiments, the core Acid molecule is made of a kind of nucleotide sequence, is expressed in the nucleotide sequence and coleoptera and/or Hemipteran pest cell Nucleic acid molecules can specific hybrid.
In an alternative embodiment, the table for regulating and controlling target gene in coleoptera and/or Hemipteran pest is provided The method reached, the method includes：With the carrier conversion of the nucleic acid sequence of at least one nucleic acid molecules comprising the coding present invention Plant cell, wherein the nucleotide sequence is operably connected with promoter and transcription terminator；Include being enough to allow Inverted plant cell is cultivated under conditions of the plant cell cultures development of multiple inverted plant cells；Selection will be described Nucleic acid molecules are integrated into the inverted plant cell in its genome；For the iRNA molecules of the nucleic acid molecule encoding by integrating Expression, screens inverted plant cell；The transgenic plant cells of selection expression iRNA molecules；Then the transgenosis of selection is used to plant Object cell feeds the coleoptera and/or Hemipteran pest.It can also be from expression by the iRNA molecules for the nucleic acid molecule encoding integrated Inverted Plant cell regeneration plant.In some embodiments, the iRNA molecules are dsRNA molecules.At these and separately In outer embodiment, the nucleic acid molecules include dsRNA molecules, and the dsRNA molecules are respectively contained more than a kind of and elytrum The specifically hybridized nucleotide sequence of nucleic acid molecules expressed in mesh and/or Hemipteran pest cell.In some embodiments In, the nucleic acid molecules are made of a kind of nucleotide sequence, the nucleotide sequence and coleoptera and/or Hemipteran pest cell The nucleic acid molecules of middle expression can specific hybrid.
Can by the present invention iRNA molecules with from incorporation plant cell gene group in recombination expression product or Person with mix be applied to plantation before seed coating or seed treatment in, and mix plant species (such as corn) seed it It is interior.Including the plant cell of recombination is considered as transgenic event.Further include for by iRNA in embodiment of the present invention Molecule is delivered to the delivery system of coleoptera and/or Hemipteran pest.For example, can sheath be introduced directly into the iRNA molecules of the present invention In the cell of wing mesh and/or Hemipteran pest.Method for importing may include iRNA and come from coleoptera and/or Semiptera The plant tissue of pest host directly mixes, and the combination of the iRNA molecules comprising the present invention is applied to host plant tissue Object.For example, iRNA molecules can be sprayed onto on plant surface.Alternatively, can then may be used by microbial expression iRNA molecules Microorganism is administered on plant surface, or is such as injected and is imported in root or stem by physical means.As previously discussed, also may be used It is genetically engineered to be carried out to genetically modified plants, make it to be enough to kill known coleoptera and/or half wing that infect plant The amount of mesh pest expresses at least one iRNA molecules.The iRNA molecules generated by chemical method or enzymatic synthesis method can also be pressed The mode for meeting common agricultural practice is prepared, and is used as spray product to control coleoptera and/or Hemipteran pest institute The plant damage of cause.Preparaton may include appropriate sticker and wetting agent needed for effective foliage cover, and protection iRNA molecules (such as dsRNA molecules) is from the ultraviolet protective agent of ultraviolet damage.Such additives are usually used in biological insecticides industry, And it is well known to those skilled in the art.Such application (can be based on biology or its other party with the application of other aerosol bombs Face) combination, to enhance protective of the plant to coleoptera and/or Hemipteran pest.
All references (including publications, patents and patent applications) are incorporated by reference accordingly, Incorporated extent does not conflict with the clear details of the disclosure, and to be incorporated in this way with following identical degree：As individually and Specifically indicate that every bibliography is incorporated by reference and shows in full herein.It provides discussed herein with reference to text It offers just for the sake of referring to its disclosure before the application submitting day.Any content herein shall not be construed as Recognize that inventor haves no right due to formerly inventing prior to such disclosure.
It is to illustrate certain specific features and/or aspect to provide following embodiment.These embodiments are not understood that For the disclosure is limited to described special characteristic or aspect.
Embodiment
Embodiment 1
Insect diet bioassay
Sample preparation and bioassayIt synthesizes and has purified many dsRNA molecules and (including correspond to wupA-1 reg1 (SEQ ID NO:7)、wupA-2 reg2(SEQ ID NO:8)、wupA-3 reg3(SEQ ID NO:9)、wupA-1 reg4(SEQ ID NO:10)、wupA-3 ver1(SEQ ID NO:11)、wupA-3 ver2(SEQ ID NO:Those of 13)), wherein usingRNAi kits (AMBION, LIFE TECHNOLOGIES, Grand Island, NY) orT7 in-vitro transcription kits (NEW ENGLAND BIOLABS, Ipswich, MA).Prepare warp in TE buffer solutions The dsRNA molecules of purifying, all bioassay contain the control treatment being made of the buffer solution, serve as WCR (corn root fireflies It is chrysomelid) the death rate or growth inhibiting background inspection.Use NANODROPTM8000 spectrophotometer (THERMO SCIENTIFIC, Wilmington, DE) measure bioassay buffer solution in dsRNA molecules concentration.
The insect of test sample lives in the bioassay carried out using the neonate insect larva of feeding artificial insect's foodstuff Property.WCR ovum are obtained from CROP CHARACTERISTICS, INC. (Farmington, MN).
Bioassay designed specifically for insect bioassay 128 hole plastic pallets (C-D INTERNATIONAL, Pitman, NJ) in carry out.Artificial foodstuff of each hole equipped with about 1.0mL designed for supporting coleopteron growth.Use liquid relief (40 μ L/cm on the surface for the foodstuff that the dsRNA samples of 60 μ L aliquots are delivered to each hole by pipe2).DsRNA sample concentration conducts Surface area (1.5cm every square centimeter in hole2) dsRNA amounts (ng/cm2) calculate.Processed pallet is maintained at draught cupboard In, until on foodstuff surface liquid evaporation or until be absorbed into foodstuff.
In several hours after hatching, with the camel hairbrush pickup larva individual of moistening, place it in processed (per one or two larva of hole) on foodstuff.Then transparent plastic bonding sheet is used to seal the hole with worm on 128 hole plastic pallets, and Ventilation is to allow gas exchanges.Make bioassay pallet control ambient condition (28 DEG C, about 40% relative humidity, 16:8 (light According to：It is dark)) under is kept for 9 days, record the insect populations for being exposed to each sample, dead insects number and surviving insects later Weight.Calculate the average mortality percentage each handled and average growth inhibition.Growth inhibition (GI) calculates as follows：
GI=[1-(TWIT/TNIT)/(TWIBC/TNIBC)]
Wherein TWIT is the total weight of the work insect in processing；
TNIT is the sum of the insect in processing；
TWIBC is the total weight of the work insect in background inspection (buffer control)；
TNIBC is the sum of the insect in background inspection (buffer control).
Use JMPTMSoftware (SAS, Cary, NC) is for statistical analysis.
LC50Dosage when the test insect that (lethasl concentration) is defined as 50% is killed.GI50(growth inhibition) is defined as The average production (such as live body weight) of test insect is dosage when background checks the 50% of the average value observed in sample.
Repeat bioassay prove, take in specific sample cause Corn rootworm larvae it is astonishing and imaginary not The death rate and growth inhibition arrived.
Embodiment 2
Identify candidate targets gene
The transcriptome analysis that multiple WCR (diabroticavirgifera) puberties are collected is selected, is turned by RNAi with providing The candidate targets gene order of gene plant insect-resistant technical controlling.
In one example, from the complete first age WCR larva of about 0.9g (4 to 5 days after hatching；It is maintained at 16 DEG C) separation Total serum IgE, and it is based on phenol/TRI using followingMethod (MOLECULAR RESEARCH CENTER, Cincinnati, OH) purifying：
Larva is placed in equipped with 10mL TRI at room temperature15mL homogenizers in homogenize, until obtain Until uniform suspension.It incubates at room temperature after five minutes, homogenate is assigned in 1.5mL microcentrifugal tubes (often pipe 1mL), is added Strong oscillating shakes mixture 15 seconds after adding 200 μ L chloroforms.After allowing extraction process to stand 10 minutes at room temperature, by 4 DEG C Each phase is detached with 12,000x g centrifugations.Upper layer phase (including about 0.6mL) is carefully transferred to another sterile 1.5mL pipe In, add isometric room temperature isopropanol.After incubating 5 to 10 minutes at room temperature, it will be mixed with 12,000x g (4 DEG C or 25 DEG C) Object is closed to centrifuge 8 minutes.
Liquid is carefully taken out and discarded supernatant, is then washed twice RNA precipitate by being vortexed with 75% ethyl alcohol, is washed every time Afterwards by being recycled within 5 minutes with (4 DEG C or 25 DEG C) centrifugations of 7,500x g.Ethyl alcohol is carefully removed, precipitation is allowed to air-dry 3 to 5 points Clock is then dissolved in the sterile water of nuclease free.It is dense to measure RNA by measuring absorbance (A) at 260nm and 280nm Degree.It is more than the total serum IgE of 1mg, wherein A from the generation of the typical extraction process of about 0.9g larvas260With A280Ratio be 1.9.So The RNA of extraction is stored at -80 DEG C, until further processing.
RNA mass is measured by making equal portions run 1% Ago-Gel.In the container through high-temperature sterilization, using by It is handled through DEPC (pyrocarbonic acid diethyl ester) water-reducible through high-temperature sterilization 10x TAE buffer solutions (Tris acetates EDTA；1x is dense Degree is 0.04M Tris acetates, 1mM EDTA (disodium edta), pH 8.0) Ago-Gel solution is made.Make Use 1x TAE as running buffer.Before use, using RNAseAwayTM(INVITROGENLIFE TECHNOLOGIES,Grand Island, NY) clean electrophoresis tank and pore-creating comb.Take 2 μ L RNA samples and 8 μ L TE buffer solutions (10mM Tris HCl, pH 7.0；1mM EDTA) and 10 μ L RNA samples buffer solutions (Catalog number (Cat.No.) 70606；EMD4 Bioscience, Gibbstown, NJ) mixing.Sample is heated at 70 DEG C 3 minutes, (contain 1 μ g to 2 μ g per 5 μ L of hole loading after being cooled to room temperature RNA).Commercially available RNA molecule amount label is placed in the hole of separation while being run, to compare molecular size.It is run under 60 volts solidifying Glue 2 hours.
It is total from larva using random initiation by commerce services provider (EUROFINSGENOMICS, Huntsville, AL) RNA prepares standardized cDNA library.Pass through GS FLX 454Titanium in EUROFINSMWG OperonTMSequence of chemical product Standardized larval cDNA library is sequenced with 1/2 plate gauge mould, it is more than 600 to generate average read length as 348bp, 000 read.350,000 reads are assembled into more than 50,000 contigs.Use publicly available program FORMATDB (available from NCBI) by unassembled read and contig both of which be converted into can BLAST database.
Similarly by the material preparation that is harvested in other WCR puberties total serum IgE and standardized cDNA library.Merge generation Thus each budding cDNA library member of table builds the transcript profile library collected for Screening target gene.
The candidate gene of RNAi targetings utilizes the lethal about specific gene in other insects such as drosophila and red flour beetle The information of RNAi effects selects.Assuming that these genes are required for the survival and growth of coleopteron.For selection Target gene, its homologue is identified in transcript profile sequence library, as described below.Pass through the complete of PCR amplification target gene Long or partial sequence, to prepare the template for generating double-stranded RNA (dsRNA).
It is directed to using candidate protein coded sequence and contains unassembled chrysomelid category sequence read or assembled contig Can BLAST databases operation TBLASTN search.Confirmed to chrysomelid category sequence for NCBI non-redundant databases using BLASTX It is notable hit (be defined as：For contig homology, it is better than e-20；For unassembled sequence read homology, it is better than e-10).The result of this BLASTX search confirms that the chrysomelid category homologue candidate gene sequence identified in TBLASTN search is certain Including chrysomelid category gene, or for the non-chrysomelid best hit for belonging to candidate gene sequence present in chrysomelid category sequence. In most cases, Tribolium (Tribolium) candidate gene mark is noted as coding protein, provides and chrysomelid category transcript profile The determination sequence homology of one or more of sequence sequence.In a few cases it will be evident that some are based on and n omicronn-leaf The chrysomelid category contig of the homology selection of first category candidate gene or unassembled sequence read have overlapping, and to contig Assembling fails to have connected these overlappings.In these cases, using SequencherTMv4.9(GENE CODES CORPORATION, Ann Arbor, MI) by sequence assembling at longer contig.
Encode chrysomelid candidate targets gene (the SEQ ID NO for belonging to wupA:1、SEQ ID NO:3 and SEQ ID NO:5) quilt Being accredited as can cause coleopteran pest dead, and WCR growth inhibitions, development inhibit and/or the gene of Reproduction suppression.
SEQ ID NO:1、SEQ ID NO:3 and SEQ ID NO:5 sequence is novel.The sequence is not in common data It is provided in library, also not in WO/2011/025860, U.S. Patent Application No. 20070124836, U.S. Patent Application No. 20090306189, U.S. Patent Application No. US20070050860, U.S. Patent Application No. 20100192265 or U.S. Patent number It is disclosed in 7,612,194.Chrysomelid category wupA-1 sequences (SEQ ID NO:1) and from red flour beetle (Tribolium Castaneum the segment (GENBANK accession number XM_008194295.1) of sequence) is related to a certain extent.Chrysomelid category WUPA-1 amino acid sequences (SEQ ID NO:2) immediate homologue is red flour beetle albumen, and GENBANK accession number is (99% is similar by XP_008192517.1；97% is identical on homologous region).Chrysomelid category wupA-2 sequences (SEQ ID NO:3) and come It is related to a certain extent from the short-movie section (GENBANK accession number XM_008194291.1) of the sequence of red flour beetle.Chrysomelid category WUPA-2 amino acid sequences (SEQ ID NO:4) immediate homologue is red flour beetle albumen, and GENBANK accession number is (98% is similar by XP_008192513.1；94% is identical on homologous region).Chrysomelid category wupA-3 sequences (SEQ ID NO:5) and come The short-movie section (GENBANK accession number XM_002430857.1) of the sequence of pediculus humanus corporis (Pediculus humanus corporis) It is related to a certain extent.Chrysomelid category WUPA-3 amino acid sequences (SEQ ID NO:6) immediate homologue is housefly (Musca domestica) albumen, GENBANK accession number are that (92% is similar by XP_005179219.1；87% on homologous region It is identical).
WupA dsRNA transgenosis can with other dsRNA molecular combinations, with provide redundancy RNAi target and collaboration RNAi effects.The transgenic corn events of the dsRNA of expression targeting wupA can be used for preventing feeding damage of the corn rootworm to root. WupA dsRNA transgenosis represent in insect-resistant management gene is cumulative with B. thuringiensis insecticidal protein techniques phase In conjunction with new role pattern, to hinder to resist the development of the rootworm group of any one of these rootworm control technologies.
PCR amplification object is generated using the overall length of the sequence of chrysomelid category candidate gene (herein referred as wupA) or part clone So that dsRNA is synthesized.
SEQ ID NO:1 shows the chrysomelid 1077bp DNA sequence dnas for belonging to wupA-1.
SEQ ID NO:3 show the chrysomelid 1077bp DNA sequence dnas for belonging to wupA-2.
SEQ ID NO:5 show the chrysomelid 355bp DNA sequence dnas for belonging to wupA-3.
SEQ ID NO:7 show the 499bp DNA sequence dnas of wupA-1 reg1.
SEQ ID NO:8 show the 498bp DNA sequence dnas of wupA-2 reg2.
SEQ ID NO:9 show the 353bp DNA sequence dnas of wupA-3 reg3.
SEQ ID NO:10 show the 254bp DNA sequence dnas of wupA-1 reg4.
SEQ ID NO:11 show the 130bp DNA sequence dnas of wupA-3 v1.
SEQ ID NO:12 show the 133bp DNA sequence dnas of wupA-3 v2.
Embodiment 3
Target gene is expanded to generate dsRNA
Design primer, will pass through the code area part of each target gene of PCR amplification.Referring to table 1.In appropriate situation Under, by T7 bacteriophage promoter sequences (TTAATACGACTCACTATAGGGAGA；SEQ ID NO:13) having through amplification is mixed 5 ' ends of adopted chain or antisense strand.Referring to table 1.Total serum IgE, and the template for using the first chain cDNA to be reacted as PCR are extracted from WCR, The PCR reactions expand all or part of native target gene order using the primer reverse-located.Also expand from DNA clone Increase dsRNA, which includes code area (the SEQ ID NO of yellow fluorescence protein (YFP):14；Shagin et al., (2004) Mol.Biol.Evol.21(5):841-50)。
Table 1. is used for expanding the primer of the code area part of exemplary wupA target genes and YFP negative control genes and draws Object pair.
Embodiment 4
RNAi constructs
Template and dsRNA synthesis are prepared by PCR.
It is shown in Fig. 1 for providing specific template to generate the strategy of wupA and YFP dsRNA.Using in table 1 Primer pair, and the first chain cDNA (as pcr template) by being isolated from the total serum IgE preparation of the first instar larvaes of WCR, pass through PCR It is prepared for the template DNA for being intended to use in wupA dsRNA synthesis.For each selected wupA and YFP target genes area, PCR amplification has imported a T7 promoter sequence (YFP sections is amplified from YFP at 5 ' ends of sense strand and antisense strand through amplification The DNA clone of code area).At the ends 5' of sense strand and antisense strand there is the PCR product of T7 promoter sequences to be used as generating dsRNA Transcription templates.Referring to Fig. 1.It is to the sequence of the dsRNA templates of amplification with specific primer：SEQ ID NO:7(wupA-1 reg1)、SEQ ID NO:8(wupA-2 reg2)、SEQ ID NO:9(wupA-3 reg3)、SEQ ID NO:10(wupA-1 reg4)、SEQ ID NO:11(wupA-3 v1)、SEQ ID NO:12 (wupA-3 v2) and YFP (SEQ ID NO:14).It usesRNAi kits follow explanation (the INVITROGEN LIFE of manufacturer TECHNOLOGIES), or use HiScribeTMT7 high yield RNA synthetic agent box follows the explanation (New of manufacturer England Biolabs), it synthesizes and has purified the double-stranded RNA for insect bioassay.Use NANODROPTM8000 light splitting Photometer (THERMO SCIENTIFIC, Wilmington, DE) measures the concentration of dsRNA.
Build plant conversion carrier
Combination using chemical synthesis segment (DNA2.0, Menlo Park, CA) and standard molecule cloning process, assembling Entry vector, the entry vector include section (the SEQ ID NO with wupA:1、SEQ ID NO:3 or SEQ ID NO:5) The target gene construct for being used to form hair clip.By (in single transcript unit) with reciprocal orientation arrangement wupA Two copies of target gene sequence carry out easyization RNA primary transcripts and form intramolecular hair clip, and described two sections are connect by one Head polynucleotides are (for example, ring (such as SEQ ID NO:And ST-LS1 intrones (Vancanneyt et al., (1990) 102) Mol.Gen.Genet.220(2):245-50)) separate.Therefore, primary mRNA transcript contains separated by the joint sequence Two wupA gene segment sequences, the two sector sequences inverted repeats big each other.Using promoter (for example, beautiful another name for Sichuan Province Broomcorn millet ubiquitin 1, U.S. Patent number 5,510,474；35S from cauliflower mosaic virus (CaMV)；Sugarcane bacilliform virus (ScBV) Promoter；Promoter from rice actin gene；Ubiquitin promoter, pEMU, MAS, maize H3 histones promoter, ALS promoters, phaseolin gene promoter, cab, rubisco, LAT52, Zm13 and/or apg) copy drive primary The generation of mRNA hair clip transcripts, be used in combination one comprising 3 ' non-translational regions (for example, 5 gene (ZmPer5 of maize peroxidase 3'UTR v2；United States Patent (USP) 6,699,984), AtUbi10, AtEf1 or StPinII) segment terminate expression hairpin RNA The transcription of gene.
In standardAbove-mentioned entry vector and typical binary purpose carrier are used in recombining reaction, Produce the wupA shrna expression conversion carriers for agriculture bacillus mediated maize embryo conversion.
Binary purpose carrier includes in plant operable promoter (for example, sugarcane bacilliform virus (ScBV) promoter (Schenk et al., (1999) Plant Mol.Biol.39:1221-30) or ZmUbi1 (U.S. Patent number 5,510,474)) Herbicide tolerance gene (aryloxy group alkanoate dioxygenase under regulation and control；AAD-1 v3) (United States Patent (USP) 7838733 (B2) and Wright et al., (2010) Proc.Natl.Acad.Sci.U.S.A.107:20240-5).5'UTR and connector are fixed Position is between 3 ' ends of the promoter section and the initiation codon of the code areas AAD-1.Using one comprising from maize 3 ' non-translational regions (the ZmLip 3'UTR of lipase gene；U.S. Patent number 7,179,902) segment terminate AAD-1mRNA Transcription.
By the standard for using typical binary purpose carrier and entry vectorRecombining reaction, structure Include the negative control binary vector of the gene of expression YFP protein.The binary purpose carrier includes to be in maize ubiquitin 1 Herbicide tolerance gene (aryloxy group alkanoate dioxygenase under the expression regulation of promoter (above)；AAD-1 V3) (above) and one include 3 ' non-translational regions (the ZmLip 3'UTR from maize lipase gene；Piece such as above) Section.The entry vector includes the code areas YFP and one under the expression control in 1 promoter (above) of maize ubiquitin A segment for including 3 ' the non-translational region (above)s from 5 gene of maize peroxidase.
Embodiment 5
Screen candidate targets gene
In the measurement based on foodstuff, the synthesis dsRNA for the target gene sequence for inhibiting to identify in embodiment 2 will be designed as When being applied to WCR, dead and growth inhibition is caused.Observe wupA-1 reg4, wupA-3 reg3 and wupA-3 v1 at this The effect of showing to greatly enhance compared to the YFP dsRNA and control screened in measurement.
The bioassay repeated proves that intake is from wupA-1 reg4, wupA-3 reg3 and wupA-3 v1 DsRNA prepared products cause death and/or the growth inhibition of western corn rootworm larva.Table 2 and table 3 are shown in WCR larvas Be exposed to these dsRNA after 9 days based on foodstuff feeding bioassay as a result, and by yellow fluorescence protein (YFP) Code area (SEQ ID NO:14) result that the dsRNA negative control samples prepared obtain.
The knot that the wupA dsRNA foodstuffs feeding that table 2. is obtained after being fed 9 days using western corn rootworm larva measures Fruit.ANOVA analyses are found that the significant difference on average mortality % and average growth inhibition (GI) %.Use Tukey- Kramer examines separation average value.
* the letter in SEM=average standard errors bracket indicates statistics level.It is not by the level of same letter connection There are significant difference (P<0.05).
* TE=Tris HCl (1mM) plus EDTA (1mM) buffer solution, pH7.2.
* * YFP=yellow fluorescence proteins
Oral potency (ng/cms of the table 3.wupA dsRNA to WCR larvas2) summarize.
It has been proposed that, certain chrysomelid species genes can be used for the insect control of RNAi mediations in the past.Referring to United States Patent (USP) (it discloses 9,112 sequences for publication No. 2007/0124836 (it discloses 906 sequences) and U.S. Patent number 7,612,194 Row).However, technical staff determine, many be suggested effective gene is controlled to the RNAi insects mediated can not be effectively Control chrysomelid category.Technical staff also determines, compared with being suggested and controlling other effective genes to the RNAi insects mediated, sequence Row wupA-1 reg4, wupA-3 reg3 and wupA-3 v1 respectively provide astonishing and unexpected to chrysomelid category Go out color control.
For example, being proposed in U.S. Patent number 7,612,194, annexin, β spectrin 2 and mtRP-L4 are mediated in RNAi Insect control in all effectively.SEQ ID NO:23 be the DNA sequence dna of annexin region 1 (Reg 1), and SEQ ID NO: 24 be the DNA sequence dna of annexin region 2 (Reg 2).SEQ ID NO:25 be the DNA sequences in 2 region 1 (Reg 1) of β spectrin Row, and SEQ ID NO:26 be the DNA sequence dna in 2 region 2 (Reg 2) of β spectrin.SEQ ID NO:27 be the regions mtRP-L4 1 (Reg1) DNA sequence dna, and SEQ ID NO:28 be the DNA sequence dna of the regions mtRP-L4 2 (Reg 2).Also use YFP sequences (SEQ ID NO:14) dsRNA as negative control is generated.
DsRNA is generated by the method for embodiment 3 using each in foregoing sequences.It is shown in Fig. 2 for carrying For specific template to generate the strategy of dsRNA.Using the primer pair in table 4, and by being isolated from the total of the first instar larvaes of WCR First chain cDNA (as pcr template) prepared by RNA, the template DNA for being prepared for being intended to use in dsRNA is synthesized by PCR. (YFP is expanded from DNA clone.) for the target gene area of each selection, execute individual PCR amplification twice.First time PCR expands Increase and imports T7 promoter sequences at the 5 ' ends through expanding sense strand.5 ' end incorporation T7 promoter sequences of second secondary response in antisense strand Row.Then two segments through PCR amplification in each target gene area are mixed with roughly equal amount, and mixture is used as Generate the transcription templates of dsRNA.Referring to Fig. 2.It usesRNAi kits, it then follows manufacture The explanation (INVITROGEN LIFE TECHNOLOGIES) of quotient synthesizes and purifies double-stranded RNA.Use NANODROPTM8000 light splitting Photometer (THERMO SCIENTIFIC, Wilmington, DE) measure dsRNA concentration, and by it is same as described above based on The bioassay method of foodstuff tests each dsRNA.Table 4 is listed for generating YFP, annexin Reg 1, annexin 2 dsRNA points of Reg 2,2 Reg 1 of β spectrin, 2 Reg 2 of β spectrin, mtRP-L4 Reg 1 and mtRP-L4 Reg The sequence of the primer of son.YFP primer sequences in the discribed methods of Fig. 2 are also listed in table 4.Table 5 presents WCR childrens The result of feeding bioassay based on foodstuff of the worm after being exposed to these dsRNA molecules 9 days.The bioassay card repeated It is bright, it takes in these dsRNA and western corn rootworm larva is not caused to occur more than using TE buffer solutions, water or YFP protein etc. pair The seen death rate or growth inhibition when product in the same old way.
Table 4. is used for the primer and primer pair of the code area part of amplification gene.
The result that the foodstuff feeding that table 5. is obtained using the western corn rootworm larva after 9 days measures.
* TE=Tris HCl (10mM) plus EDTA (1mM) buffer solution, pH8.
* YFP=yellow fluorescence proteins
Embodiment 6
Generate the transgenic maize tissue for including desinsection hair clip dsRNA
Agrobacterium-medialed transformation.After Agrobacterium-medialed transformation, it is prepared for being stably integrated into plant by expression Mosaic gene in object genome and generate one or more desinsection dsRNA molecules (for example, at least one dsRNA molecules, including Targeting includes wupA-1 (SEQ ID NO:1)、wupA-2(SEQ ID NO:3)、wupA-3(SEQ ID NO:5)、wupA-1 reg1(SEQ ID NO:7)、wupA-2 reg2(SEQ ID NO:8)、wupA-3 reg3(SEQ ID NO:9)、wupA-1 reg4(SEQ ID NO:10)、wupA-3 v1(SEQ ID NO:11)、wupA-3 v2(SEQ ID NO:12)、BSB_wupA (SEQ ID NO:79)、BSB_wupA reg1(SEQ ID NO:81)、BSB_wupA v1(SEQ ID NO:Or BSB_ 82) wupA v2(SEQ ID NO:83) the dsRNA molecules of gene) transgenic maize cell, tissue and plant.Using surpassing two The maize method for transformation of first conversion carrier or binary transformation vector is known in the art, such as such as U.S. Patent number 8,304, Described in 604, which is herein incorporated by reference.According to the energy grown on the culture medium containing haloxyfop Power selects inverted tissue, and takes the circumstances into consideration to screen inverted tissue to generate dsRNA.By inverted tissue training as a part Foster object is supplied to newborn Corn rootworm larvae to execute bioassay, generally as described in example 1 above.
Agrobacterium culture starts.Will include above-mentioned (embodiment 4) binary transformation vector agrobacterium strains DAt13192 it is thin The glycerol stocks streak inoculation of born of the same parents (WO 2012/016222A2) is in the AB minimal medium tablets containing appropriate antibiotic (Watson et al., (1975) J.Bacteriol.123:On 255-264), and grown 3 days at 20 DEG C.Then culture is drawn Line is inoculated into YEP tablets (yeast extract, 10g/L containing identical antibiotic；Peptone, 10g/L；NaCl, 5g/L) on, and It is incubated 1 day at 20 DEG C.
Agrobacterium is cultivated.Experimental day, be suitable for experiment in construct number volume prepare inoculation medium and The storing solution of acetosyringone, and be moved in the disposable sterilized flasks of 250mL.Inoculation medium (Frame et al., (2011) Genetic Transformation Using Maize Immature Zygotic Embryos, are loaded in Plant Embryo Culture Methods and Protocols:Methods in Molecular Biology.T.A.Thorpe With E.C.Yeung (editor), 327-341 pages of Springer Science and Business Media, LLC., the) contain： 2.2g/L MS salt, the MS vitamins (Frame et al., ibid) of 1X ISU improvement, 68.4g/L sucrose, 36g/L glucose, 115mg/L L-PROLINEs and 100mg/L inositols；PH is 5.4.By acetosyringone from the 1M in 100% dimethyl sulfoxide (DMSO) Storing solution is added in the flask equipped with inoculation medium, reaches 200 μM of ultimate density, and is sufficiently mixed solution.
For each construct, it is disposable that the Agrobacterium of 1 or 2 full oese from YEP tablets is suspended in 50mL In 15mL inoculation mediums/acetosyringone storing solution in sterile centrifugation tube, solution is then measured in spectrophotometer and is existed Optical density (OD at 550nm550).Then suspension is diluted to using additional inoculation medium/acetosyringone mixture 0.3 to 0.4 OD550.Then the pipe equipped with agrobacterium suspension platform shaker is lain in a horizontal plane in (to be arranged at room temperature, about On 75rpm), shaken 1 to 4 hour while carrying out embryo incision.
Fringe disinfection is detached with embryo.From corn inbred strais B104 (Hallauer et al., (1997) Crop Science37: 1405-1406) plant obtains prematurity maize embryo, and the plant cultivates in the greenhouse, and carries out self-pollination or nearly edge is awarded Powder is to generate fringe.About 10 to the 12 days harvest fringes after pollination.Experimental day shells fringe, by being immersed in commercially available bleaching agent (ULTRASterilize bleaching agent, 6.15% sodium hypochlorite；Add two drop TWEEN 20) 20% solution in and shake It carries out surface sterilization within 20 to 30 minutes, is subsequently placed in laminar flow hood and is rinsed three times in aseptic deionized water.From each fringe without It cuts to bacterium immature zygotic embryos (1.8 to 2.2mm long) and is assigned randomly in microcentrifugal tube, every microcentrifugal tube is equipped with The 2.0mL suspension of appropriate agrobatcerium cell in liquid inoculation culture medium, wherein containing 200 μM of acetosyringones and being added to 2 μ The 10% of LS233 surfactants (EVONIK INDUSTRIES；Essen,Germany).For A set of given experiment, every time conversion use the embryo from the fringe collected.
Agrobacterium co-cultures.After separation, embryo is placed 5 minutes on shaking platform.Then the content of pipe is toppled over On the tablet for co-culturing culture medium, the culture medium contains 4.33g/L MS salt, 1X ISU are improved MS vitamins, 30g/L Sucrose, 700mg/L L-PROLINEs, 3.3mg/L Medibens (bis- chloro- 2- methoxybenzenes first of 3,6- dichloro-o-anisic acids or 3,6- Acid) KOH solution, 100mg/L inositols, 100mg/L casein enzyme hydrolysates, 15mg/L AgNO3, 200 μM of acetosyringones DMSO solution and 3g/L GELZANTM, pH 5.8.Liquid agrobacterium suspension is removed with disposable sterilized pipette.Then it borrows Microscope is helped, so that embryo is oriented to scultellum using aseptic nipper face-up.Tablet is covered, 3M is usedTMMICROPORETMMedical adhesive tape is close Envelope, being then placed within has about 60 μm of ol m-2s-1In 25 DEG C of incubators of the continuous illumination of photosynthetically active radiation (PAR).
Select callus and regeneration of transgenic event.After the co-cultivation phase, embryo is transferred on tranquillization culture medium, it is quiet The group of breath culture medium becomes：MS vitamins, 30g/L sucrose, the 700mg/L L- dried meat ammonia that 4.33g/L MS salt, 1X ISU are improved Acid, the KOH solution of 3.3mg/L Medibens, 100mg/L inositols, 100mg/L casein enzyme hydrolysates, 15mg/L AgNO3、 0.5g/L MES (2- (N- morpholinoes) ethanesulfonic acid monohydrates；PHYTOTECHNOLOGIES LABR.；Lenexa,KS)、 250mg/L carbenicillins and 2.3g/L GELZANTM, pH 5.8.It will be moved on on each tablet no more than 36 embryos.By tablet It is placed in transparent plastic casing, in 27 DEG C and about 50 μm of ol m-2s-1It is incubated 7 to 10 days under the continuous illumination of PAR.Then By the transfer of the embryo of callus (<18/plate) on Selective agar medium I, the culture medium is by with 100nM R- haloxyfop acid (0.0362mg/L；Callus for selecting to include AAD-1 genes) tranquillization culture medium (above) composition.Tablet is put It returns in transparent box, in 27 DEG C and about 50 μm of ol m-2s-1It is incubated 7 days under the continuous illumination of PAR.Then the embryo of callus is shifted (<12/plate) on Selective agar medium II, the culture medium is by with the quiet of 500nM R- haloxyfops sour (0.181mg/L) Cease culture medium (above) composition.Tablet is put back in transparent box, in 27 DEG C and about 50 μm of ol m-2s-1The continuous illumination of PAR It is lower to incubate 14 days.This selection step allows transgenic calli further proliferation and differentiation.
By in proliferation embryo callus transfer (<9/plate) on pre- regeneration culture medium.Pre- regeneration culture medium contains 4.33g/L MS salt, the MS vitamins of 1X ISU improvement, 45g/L sucrose, 350mg/L L-PROLINEs, 100mg/L inositols, 50mg/L casein enzyme hydrolysates, 1.0mg/L AgNO3, 0.25g/L MES, the NaOH solution of 0.5mg/L methyl α-naphthyl acetates, 2.5mg/ Ethanol solution, 1mg/L 6- benzylaminopurines, 250mg/L carbenicillins, the 2.5g/L GELZAN of L abscisic acidsTMWith 0.181mg/L haloxyfop acid, pH 5.8.Tablet is stored in transparent box, in 27 DEG C and about 50 μm of ol m-2s- 1It is incubated 7 days under the continuous illumination of PAR.Then by regeneration callus transfer (<6/plate) arrive PHYTATRAYSTM (SIGMA-ALDRICH) on the regeneration culture medium in, with daily 16 hours illumination/8 hour dark (about 160 μ at 28 DEG C mol m-2s-1PAR it) incubates 14 days, or until sending out bud and root.Regeneration culture medium contains 4.33g/L MS salt, 1X ISU MS vitamins, 60g/L sucrose, 100mg/L inositols, 125mg/L carbenicillins, the 3g/L GELLAN of improvementTMGlue and 0.181mg/L R- haloxyfop acid, pH 5.8.Then budlet of the separation with primary root, it is not chosen to be transferred directly to In elongation medium.MS vitamins, 30g/L sucrose and the 3.5g/ that elongation medium contains 4.33g/L MS salt, 1X ISU are improved L GELRITETM, pH 5.8.
Inverted plant sprout is selected according to the ability grown on the culture medium containing haloxyfop, by these buds From PHYTATRAYSTMIt is transplanted to intussusception growth culture medium (PROMIX BX；PREMIER TECH HORTICULTURE) small basin In, small basin cup or HUMI-DOMES (ARCO PLASTICS) are covered, then hardening (the daytime in the growth rooms CONVIRON 24 DEG C of 27 DEG C/night, 16 hour photoperiod, 50-70%RH, 200 μm of ol m-2s-1PAR).In some cases, analysis presumption Transgenosis plantlet transgenosis Relative copy number, this is integrated into AAD1 in maize genome using detection is designed to The primer of herbicide tolerance gene measures to complete by quantitatively real-time PCR.In addition, detecting presumption using qPCR measurement It whether there is joint sequence and/or target sequence in transformant.Then the inverted plantlet of selection is moved on in greenhouse, so as to Further growth and test.
Shift T0Plant is simultaneously colonized in the greenhouse, to carry out bioassay and generate seed.When plant reaches the V3-V4 phases When, it is transplanted in IE CUSTOM BLEND (PROFILE/METRO MIX 160) soil mixture, (light is sudden and violent in the greenhouse Reveal type：Photosynthetic or assimilation；Bloom limit value：1200PAR；16 hour daytime is long；24 DEG C of 27 DEG C/night on daytime) it cultivates to blooming.
By for the plant of insect bioassay from small pot transplanting to TINUSTM350-4 (SPENCER-LEMAIRE INDUSTRIES, Acheson, Alberta, Canada) is (eachEach One plant of event).It is being transplanted toAfter about four days, plant is infected to carry out bioassay.
By to T0(wherein pollen is from non-transgenic inbred strais B104 plants or other are suitable for the fringe silk pollination of genetically modified plants When pollen donor collect) and plant gained seed and obtain T1Generation plants.It executes when possible and mutually hands over.
Embodiment 7
The analysis of molecules of transgenic maize tissue
The sample of leaf to biting the herborization that root damage is cultivated from greenhouse on the same day in assessment performs maize tissue Analysis of molecules (such as RT-qPCR).
The expression of transgenosis is verified using the result of the RT-qPCR of Per53'UTR measurement.It can also use expressed The RT-qPCR measurement results of joint sequence (essential to form dsRNA Hairpin Molecules) in RNA verify whether to exist Hair clip transcript.It measures horizontal relative to the transgenosis rna expression of the rna level of endogenous maize gene.
By a part for the code areas AAD1 in DNA qPCR analysis detection genomic DNAs, for estimating that transgenosis is inserted into Copy number.It is analyzed from the herborization sample cultivated in environmental chamber for these.By result and it is designed to detect single copy The DNA qPCR results of the measuring method of a part for natural gene are compared, and simple event (is had wupA transgenosis One or two copy) be advanced to the further research in greenhouse.
In addition, using detection spectinomycin resistance gene (SpecR is designed to；Binary vector outside T-DNA On plasmid) a part qPCR measure determine genetically modified plants whether contain external integrated plasmid backbone sequences.
Hairpin RNA transcript expression：Target qPCR.It is analyzed by the real-time quantitative PCR (qPCR) of target sequence Callus cell event or genetically modified plants are to determine the relative expression levels of overall length hair clip transcript, with internal maize base Because of (SEQ ID NO:57, GENBANK accession number BT069734) transcript level compare, the internal maize gene code TIP41 samples albumen is (that is, the maize homologue of GENBANK accession number AT4G34270；TBLASTX is scored at 74% homogeneity). RNA is detached using Norgen BioTek total serum IgEs separating kits (Norgen, Thorold, ON).According to the side of kit suggestion Case carries out DNaseI processing on column to total serum IgE.Then at 8000 spectrophotometers of NANODROP (THERMO SCIENTIFIC) On RNA is quantified, and concentration is normalized to 50ng/ μ L.Basically according to the scheme that manufacturer is recommended, high power capacity cDNA is used Synthetic agent box (INVITROGEN) prepares the first chain cDNA, and reaction volume is 10 μ L, and RNA is denaturalized containing 5 μ L.Slightly modification should Scheme includes by 100 μM of T20VN oligonucleotides (IDT) (SEQ ID NO of 10 μ L:58； TTTTTTTTTTTTTTTTTTTTVN, wherein V are A, C or G, and N is A, C, G or T/U) it is added to random primer deposit mixture 1mL pipes in, to prepare the working stock liquid that random primer and widow dT are mixed.
After cDNA synthesis, with the water of nuclease free by sample with 1:3 dilutions, and be stored in -20 DEG C and be when measuring Only.
In LIGHTCYCLERTMWith 10 μ L reaction volumes on 480 (ROCHE DIAGNOSTICS, Indianapolis, IN) The real-time PCR measurement to target gene and TIP41 sample transcripts is executed respectively.Target gene is measured, primer wupA is utilized (F)(SEQ ID NO:And wupA (R) (SEQ ID NO 59):60) and IDT customizes oligonucleotide probe wupA PRB Set1 (being marked with FAM, Zen and Iowa Black quenchers is used in combination to give dual be quenched) (SEQ ID NO:103) it is reacted.For TIP41 sample reference genes measure, and use primer TIPmxF (SEQ ID NO:And TIPmxR (SEQ ID NO 61):62), Yi Jiyong Probe HXTIP (the SEQ ID NO of HEX (chlordene fluorescein) labels:63).
All measurement all include the negative control (only mixture) of not template.To prepare standard curve, in source plate Further include blank (in source aperture plus water), to check sample cross contamination.The sequence of primer and probe is shown in table 6.For examining The reactive component formula for surveying various transcripts discloses in table 7, and PCR reaction conditions are summarized in table 8.FAM is excited at 465nm (6- Fluoresceincarboxylic acids phosphoramidite) fluorescence part, and measure the fluorescence at 510nm；HEX (chlordene fluorescein) fluorescence part Respective value is 533nm and 580nm.
Table 6. is used for the oligonucleotide sequence of the analysis of molecules of transcript level in transgenic maize.
Table 7. is used to detect the PCR reaction formulas of transcript.
Table 8. is used for the thermal cycler condition of RNA qPCR
Use LIGHTCYCLERTMSoftware v1.5 calculates Cq according to the recommendation of supplier using second dervative maximum algorithm Value, passes through relative quantitative assay data.For expression analysis, counted using Δ Δ Ct methods (i.e. 2- (Cq TARGET-Cq REF)) Operator expression value, this method depend on the difference for comparing the Cq values between two targets, wherein it is assumed that the PCR for optimization reacts, Each circulation products double, and base value is selected as 2.
Hair clip transcript size and integrality：Northern traces measureIn some cases, using Northern traces (RNA traces) is analyzed to determine the molecular size of the wupA hair clips dsRNA in the genetically modified plants of expression wupA dsRNA, to Obtain the additional characterization of molecules of genetically modified plants.
All material and facilities use RNAZAP (AMBION/INVITROGEN) to handle before the use.By tissue sample (100mg to 500mg) is collected in 2mL SAFELOCKEPPENDORF pipes, with the KLECKO for being equipped with three tungsten pearlsTMTissue crushes Device (GARCIAMANUFACTURING, Visalia, CA) is crushed 5 minutes in 1mL TRIZOL (INVITROGEN), is then existed It is incubated 10 minutes under room temperature (RT).Optionally, sample is centrifuged 10 minutes at 4 DEG C with 11,000rpm, then turns supernatant It moves on in fresh 2mL SAFELOCKEPPENDORF pipes.It, should by overturning after being added to 200 μ L chloroforms in homogenate Pipe is mixed for 2 to 5 minutes, is incubated at RT 10 minutes, is then centrifuged 15 minutes with 12,000x g at 4 DEG C.By upper layer phase It is transferred in sterile 1.5mL EPPENDORF pipes, adds 100% isopropanol of 600 μ L, incubated at RT 10 minutes to 2 small When after, centrifuged 10 minutes with 12,000x g at 4 to 25 DEG C.Liquid is discarded supernatant, is washed RNA precipitate with 70% ethyl alcohol of 1mL It washs twice, between washing twice, is centrifuged 10 minutes with 7,500x g at 4 to 25 DEG C.Ethyl alcohol is discarded, of short duration air-dry will be precipitated It 3 to 5 minutes, is then resuspended in the water of 50 μ L nuclease frees.
It uses(THERMO-FISHER) quantitative to total serum IgE, and sample is normalized to 5 μ g/10μL.Then 10 μ L glyoxals (AMBION/INVITROGEN) are added into each sample.By 5 to 14ng DIG RNA marks Fiducial mark note mixture (ROCHE APPLIED SCIENCE, Indianapolis, IN) distributes and is added to isometric glyoxal In.So that sample and labeled RNA is denaturalized at 50 DEG C 45 minutes, then preserves on ice, until being loaded in NORTHERNMAX In 10X glyoxals running buffer (AMBION/INVITROGEN) 1.25%SEAKEMGOLD agaroses (LONZA, Allendale, NJ) on gel until.By at 65V/30mA electrophoresis 15 minutes 2 hours detach RNA.
After electrophoresis, in 2X SSC by gel rinse 5 minutes, then GEL DOC work stations (BIORAD, Hercules, CA) on be imaged, then at RT overnight, so that RNA is passively transferred on nylon membrane (MILLIPORE), wherein making Use 10X SSC as transfering buffering liquid (20X SSC, pH 7.0 that are made of 3M sodium chloride and the Chinese catalpas 300M lemon acid trisodium).Transfer Afterwards, film is rinsed 5 minutes in 2X SSC, so that RNA is crosslinked (AGILENT/STRATAGENE) with film using ultraviolet light, then makes Film is most 2 days dry at RT.
Make film prehybridization 1 to 2 hour in ULTRAHYB buffer solutions (AMBION/INVITROGEN).Probe is by containing thoughts The pcr amplification product of sequence of interest forms, by ROCHE APPLIED SCIENCE DIG programs digoxigenin marks Note.In the buffer solution recommended in hybrid pipe, the hybridized overnight at a temperature of 60 DEG C.After hybridization, DIG washings are carried out to trace, Packaging, is exposed to film 1 to 30 minute, then by film development, all these operations all pass through the institute of supplier of DIG kits The method of recommendation carries out.
Determine transgene copy number
It will be approximately equivalent to collection tablet of the maize blade collection in 96 holes of 2 leaf punching blocks (punch) (QIAGEN) in.With the KLECKO for being equipped with a stainless shotTMTissue pulverizer (GARCIA MANUFACTURING, Visalia, CA) it (is provided with together with BIOSPRINT96PLANT KIT in BIOSPRINT96AP1 lysis buffers；QIAGEN) Middle carry out historrhexis.After tissue is macerated, BIOSPRINT96 botanical agents box and BIOSPRINT96 extraction machine people are used With high throughput format separation genomic DNA (gDNA).Before setting up qPCR reactions, with 1:3 DNA:Water dilution gene group DNA。
QPCR is analyzedBy usingThe real-time PCR of 480 systems comes by hydrolysis probes measurement Execute detection GMOs.It usesProbe design software 2.0 is devised to be used in hydrolysis probes measurement In detection target gene, joint sequence (for example, ring) and/or for detecting SpecR genes (that is, being supported on binary vector Spectinomycin resistance gene on plasmid；SEQ ID NO:64；SPC1 oligonucleotides in table 9) a part few nucleosides Acid.It is used in hydrolysis probes measurement in addition, being devised using PRIMER EXPRESS softwares (APPLIED BIOSYSTEMS) Detect AAD-1 herbicide tolerance genes (SEQ ID NO:65；GAAD1 oligonucleotides in table 9) section few nucleosides Acid.Table 9 shows the sequence of primer and probe.With endogenous maize chromosomal gene (invertase (SEQ ID NO:66； GENBANK accession number U16123；Referred to herein as IVR1) reagent will measure multiplex, the gene is used as internal reference Sequence is to ensure that there are gDNA in each measurement.In order to expand, the 1x being prepared in the multiple reaction object of 10 μ L volumes Ultimate density480 probe mother liquor mixtures (ROCHE APPLIED SCIENCE) contain every Kind of primer it is each 0.4 μM and each probe it is each 0.2 μM (table 10).Two step amplified reactions are executed as summarized in table 11. The fluorogen of FAM label probes and HEX label probes activates and transmitting is as described above；CY5 conjugates are maximum at 650nm to swash Hair, and maximum fluorescence is sent out at 670nm.
Using match point algorithm (Software publishing version 1.5) and relative quantification module (be based on Δ Δ Ct methods), Cp scores (point that fluorescence signal intersects with background threshold) are determined by real-time PCR data.Processed as described above Data are (above；RNA qPCR).
Table 9. is used to determine that the primer and probe of gene copy number and detection binary vector plasmid trunk to be (conjugated with fluorescence Object) sequence.
* CY5=cyanines -5
Table 10. is used to analyze gene copy number and detect the reactive component of plasmid trunk.
* NA=is not applicable
* ND=are not determined
Table 11. is used for the thermal cycler condition of DNA qPCR
Embodiment 8
The bioassay of transgenic maize
External insect bioassayThe subject innovation generated in plant cell is confirmed by bioassay method The bioactivity of dsRNA.See, for example, Baum et al., (2007) Nat.Biotechnol.25 (11):1322-1326.Technology people Member can be for example by giving target insect feeding from the various of the plant for generating desinsection dsRNA under controlled feeding environment Plant tissue or tissue confirm effect.Alternatively, various plant tissues of the origin derived from the plant for generating desinsection dsRNA Extract is prepared, and by the distribution of the nucleic acid of extraction on the artificial foodstuff for bioassay such as described previously herein.It will Appropriate control group of the use from the host plant for not generating desinsection dsRNA for the result and similar progress that such feeding measures It knits or the bioassay of other control samples is compared.
Use the insect bioassay of transgenic maize eventSelect two western corns from washed egg hatching Rootworm larvae (1 to 3 age in days), and place it in each hole of bioassay pallet.Then by this some holes with " draw-take off " (PULL N ' PEEL) protecting cover (BIO-CV-16, BIO-SERV) covers, and is placed in the illumination with 18 hours/6 hours/dark week In 28 DEG C of incubators of phase.After initially infecting nine days, larval mortality is assessed, is existed according to dead insects in each processing Shared percentage calculates in insect populations.Insect specimen is freezed two days at -20 DEG C, is then collected from each processing Insect larvae is simultaneously weighed.The average weight that growth inhibition percentage is handled according to the average weight of experiment process divided by two control wells The mean value of amount calculates.Data are expressed as (negative control) growth inhibition percentage.By being averaged more than control average weight Weight is normalized to zero.
Insect bioassay in greenhouse.It is received from CROP CHARACTERISTICS (Farmington, MN) with west The soil of square corn rootworm (WCR, diabroticavirgifera) ovum.WCR ovum are incubated at 28 DEG C 10 to 11 days.Wash off the soil on ovum Ovum is placed in 0.15% agar solution by earth, and concentration is adjusted to about 75 to 100 ovum of every 0.25mL equal portions.By a ovum Suspension is added in culture dish hatches tablet with setting, for monitoring hatching rate.
It is infected with 150 to 200 WCR ovumSoil around the maize plant of middle growth. Allow insect to feed 2 weeks, after such time, is provided " root grading " for each plant.Divided using section damage scale Grade, substantially in accordance with Oleson et al., (2005, J.Econ.Entomol.98:1-8).The plant of the bioassay will have been passed through It is transplanted in 5 gallons of basin for generating seed.Object is transplanted with pesticide treatments, to prevent further rootworm damage and insect to release It is put into greenhouse.It pollinates by hand to generate seed to plant.The seed generated by these plants is preserved to assess the T of plant1Generation Generation and subsequent generation.
Transgene negative check plant by with include be designed to generate yellow fluorescence protein (YFP) gene carrier It converts and generates.Bioassay is carried out, wherein including negative control in each group of vegetable material.
Table 12. expresses greenhouse bioassay and the analysis of molecules result of the maize plant and YFP check plants of wupA.
Embodiment 9
Include the transgenic corns of coleopteran pest sequence[indication]
10 to 20 plants of transgenosis T are generated as described in example 6 above0Corn plant.Obtain 10 to 20 other expression The T of the hair clip dsRNA of RNAi constructs1Corn independent lines are attacked for corn rootworm.It can derive comprising SEQ ID NO: 1、SEQ ID NO:3 and SEQ ID NO:5 all or part of hair clip dsRNA.Additional hair clip dsRNA can derive from example Such as coleopteran pest sequence, such as Caf1-180 (U.S. Patent Application Publication No. 2012/0174258), (U.S. is special by VatpaseC Sharp application publication number 2012/0174259), Rho1 (U.S. Patent Application Publication No. 2012/0174260), (U.S. VatpaseH Patent application publication number 2012/0198586), PPI-87B (U.S. Patent Application Publication No. 2013/0091600), RPA70 it is (beautiful State's patent application publication number is 2013/0091601), RPS6 (U.S. Patent Application Publication No. 2013/0097730), (U.S. is special by ROP Sharp application number 14/577,811), rna plymerase ii 140 (U.S. Patent Application No. 14/577,854), the 1 (U.S. of rna plymerase i Number of patent application 62/133,214), rna plymerase ii -215 (U.S. Patent Application No. 62/133,202), RNA polymerase 33 (U.S. Patent Application No. 62/133,210), ncm (U.S. Patent Application No. 62/095487), Dre4 (U.S. Patent Application No.s 14/705,807), COPI α (U.S. Patent Application No. 62/063,199), COPI β (U.S. Patent Application No. 62/063,203), COPI γ (U.S. Patent Application No. 62/063,192), COPI δ (U.S. Patent Application No. 62/063,216).These pass through RT- PCR or other molecular analysis methods are confirmed.The total serum IgE prepared product of independent T1 strains from selection is optionally for RT- PCR, wherein primer are designed to combine in the connector of the hair clip expression cassette in each RNAi constructs.In addition, being used for RNAi The specific primer of each target gene generates the required preprocessings of siRNA optionally for amplification in plant in construct MRNA, and for confirming the mRNA for producing the preprocessing.The amplification of the desired band of each target gene is confirmed every Hairpin RNA is expressed in a rotaring gene corn plant.Subsequently optionally utilize RNA blot hybridizations in independent transgenic strain Confirm that the dsRNA hair clips of target gene have been processed into siRNA.
In addition, with there are the RNAi molecules of the mismatch of 80% or more sequence identity to influence corn with target gene The mode of rootworm seen mode when being similar to using the RNAi molecule with target gene with 100% sequence identity.Mispairing The pairing of sequence and native sequences forms hair clip dsRNA in the same RNAi constructs, and thus delivering can influence in feed The growth of coleopteran pest, development and viability the siRNA processed through plant.
In plant delivering corresponding to target gene dsRNA, siRNA or miRNA, then by coleopteran pest by into It eats and absorbs, the target gene in coleopteran pest is caused to be lowered due to the gene silencing that RNA is mediated.When target gene is being sent out When the one or more stages educated play a significant role, growth, development and the breeding of coleopteran pest are affected, and just WCR, NCR, SCR, MCR, cucumber strip root firefly be chrysomelid, 11 asterophyllite first of cucumber and D.u.undecimpunctata Mannerheim At least one of for, cause coleopteran pest that can not successfully infect, feed, develop and/or breed, or cause coleoptera Pest is dead.Then coleopteran pest is controlled by selecting target gene and successful application RNAi.
Transgenic RNAi strain and the phenotype of non-transformed corn compare.Select the target elytrum for creating hair clip dsRNA Mesh pest gene or sequence and any of plant genetic sequences are all without similitude.Therefore, it is contemplated that by targeting these elytrums The construct of mesh pest gene or sequence generates or activation (systematicness) RNAi will not generate any harmful shadow to genetically modified plants It rings.However, by the development of transgenic strain and morphological feature with non-transformed plant and with " sky " of no hair clip expressing gene Those of carrier conversion transgenic strain is compared.Compare root, bud, leaf and the reproduction characteristics of plant.Record the bud of plant Feature, such as size and appearance of height, the number of blade and size, flowering time, flower.It is, in general, that ought be in vitro and in greenhouse When being cultivated in soil, not expressing in transgenic strain and between those of target iRNA molecules strain does not have observable form Difference.
Embodiment 10
Include the transgenic corns of coleopteran pest sequence and additional RNAi constructs
Rotaring gene corn plant includes heterologous coding sequence in its genome, which is transcribed into The iRNA molecules for targeting the organism except coleopteran pest, to such rotaring gene corn plant via Agrobacterium or WHISKERSTMMethod is (referring to Petolino and Arnold, (2009) Methods Mol.Biol.526:It 59-67) carries out secondary Conversion, to generate one or more desinsection dsRNA molecules (for example, at least one dsRNA molecules, including targeting include SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:The dsRNA molecules of 5 gene).Plant is generally prepared as described in example 4 above Plasmid vector is converted, via Agrobacterium or WHISKERSTMThe method for transformation of mediation is delivered to beautiful obtained from transgenosis Hi II or B104 In the maize suspension cell or prematurity maize embryo of rice plant, the corn plant includes that heterologous is compiled in its genome Code sequence, the heterologous coding sequence are transcribed into the iRNA molecules of the organism except targeting coleopteran pest.
Embodiment 11
Include the transgenic corns of RNAi constructs and additional coleopteran pest control sequence
Rotaring gene corn plant includes the iRNA molecules for being transcribed into targeting coleopteran pest organism in its genome Heterologous coding sequence (for example, at least one dsRNA molecules, including targeting includes SEQ ID NO:1、SEQ ID NO:3 or SEQ ID NO:The dsRNA molecules of 5 gene), to such rotaring gene corn plant via Agrobacterium or WHISKERSTMMethod (referring to Petolino and Arnold, (2009) Methods Mol.Biol.526:Secondary conversion 59-67) is carried out, to generate one Kind or a variety of insecticidal proteins molecules, such as Cry3 or Cry34/Cry35Ab1 insecticidal proteins.Generally make as described in example 4 above Standby plant transformation plasmid carrier, via Agrobacterium or WHISKERSTMThe method for transformation of mediation is delivered to beautiful obtained from transgenosis B104 In the maize suspension cell or prematurity maize embryo of rice plant, the corn plant includes that heterologous is compiled in its genome Code sequence, the heterologous coding sequence are transcribed into the iRNA molecules of targeting coleopteran pest organism.It obtains to generate and be used for Control the dual conversion plant of the iRNA molecules and insecticidal proteins of coleopteran pest.
Embodiment 12
The death rate of the neotropical realm palm fibre stinkbug (heroic America stinkbug) after injecting wupA RNAi
Neotropical realm palm fibre stinkbug (BSB；Heroic America stinkbug) colony.BSB is in 27 DEG C of incubator, in 65% relative humidity With 16 hours:Illumination in 8 hours:It is raised under dark cycle.The 1 gram of ovum collected after 2 to 3 days, which is seeded in bottom, filter paper disk 5L containers in, cover container with 18 mesh nets to divulge information.Each raising container generates about 300 to 400 BSB adults.Institute There is the stage, feeds fresh green soya bean three times per circumferential direction insect, replace weekly and sunflower seeds, soybean and peanut (weight are once housed Than 3:1:1) pouch of seed mix.Water is supplemented in the vial, uses tampon as spill.It is initial after two weeks, weekly Once insect is transferred on new container.
The artificial foodstuffs of BSB.The artificial foodstuffs of BSB prepare (used in two weeks after preparation) as follows.In MAGICFreeze-drying green soya bean is blended into fine powder in blender, while in another MAGICIn blender Raw (organic) peanut is blended.In big MAGICMerge the dry ingredients (weight percent of blending in blender： Green soya bean 35%, peanut 35%, sucrose 5%, vitamin complex (for example, the Vanderzant vitamin mixtures for insect, SIGMA-ALDRICH, catalog number (Cat.No.) V1007) 0.9%), and it is capped simultaneously shake well, to mix these ingredients.Then by mixing Dry ingredients are added in mixing bowl.In another container, by water and benomyl antifungal agent (50ppm；25μL 20,000ppm Solution/50mL foodstuffs solution) it is sufficiently mixed, it is then added in dry ingredients mixture.Manual mixing all the components, until solution Until being thoroughly mixed.Foodstuff is configured to desired size, is loosely wrapped in aluminium foil, 60 DEG C are heated 4 hours, are then cooled down And it is stored in 4 DEG C.
The assembling of BSB transcript profiles.Six BSB puberties of selection are used to prepare the libraries mRNA.From the insect for being frozen in -70 DEG C Total serum IgE is extracted, is then placed it inCracking matrix A (Lysing on instrument (MP BIOMEDICALS) MATRIX A) 2mL pipe (MP BIOMEDICALS, Santa Ana, CA) in 10 times of volumes cracking/combination buffer in Matter.Use mirVanaTMMiRNA separating kits (AMBION；INVITROGEN), extracted according to the scheme of manufacturer total mRNA.It usesHiSeqTMThe RNA sequencings of system (San Diego, CA) are provided in RNAi insect control technologies The middle candidate targets gene order used.HiSeqTMGenerate total about 3.78 hundred million reads for six samples.It uses TRINITY assemblers software (Grabherr et al., (2011) Nature Biotech.29:644-652) it is directed to each sample Read is collected one by one.Merge the transcript of compilation to generate the transcript profile collected.The transcript profile that this BSB collects contains 378, 457 sequences.
BSB wupA ortholog things are identified.It is executed using search sequence Drosophila wupA protein isoforms A to M sequence The tBLASTn for the transcript profile that BSB collects is searched for：GENBANK accession number NP_523398, NP_728137, NP_728138, NP_ 728139, NP_728140, NP_728141, NP_728142, NP_001245734, NP_001245732 and NP_001245733. BSB wupA(SEQ ID NO:79) it is accredited as heroic America stinkbug candidate targets gene outcome, there is the peptide sequence of prediction SEQ ID NO:80。
Template prepares and dsRNA synthesis.It usesReagent (LIFE TECHNOLOGIES), it is single by extracting from Total BSB RNA of young adult (about 90mg) prepare cDNA.Use depositing abrasive stick (pellet pestle) (FISHERBRAND Catalog number (Cat.No.) 12-141-363) and grinding rod electromechanical shakers (Pestle Motor Mixer) (COLE-PARMER, Vernon Hills, IL), at room temperature equipped with 200 μ L1.5mL microcentrifugal tubes in insect is homogenized.Homogenize it Afterwards, 800 μ L are added thenSo that homogenate is vortexed, then incubates five minutes at room temperature.It is broken that cell is removed by centrifugation Piece is transferred to supernatant in new pipe.Follow manufacturer's recommendation is directed to 1mL'sExtraction scheme, RNA precipitate is dried at room temperature for, is then resuspended in from GFX PCR DNA and gel extraction kit (IllustraTM；GE HEALTHCARE LIFE SCIENCES) 200 μ L Tris buffer solutions in, use 4 (i.e. 10mM of elution buffer type Tris-HCl pH 8.0).Use NANODROPTM8000 spectrophotometers (THERMO SCIENTIFIC, Wilmington, DE) Measure RNA concentration.
CDNA is expanded.Use the SUPERSCRIPT III FIRST-STRAND SYNTHESIS for RT-PCR SYSTEMTM(INVITROGEN LIFE TECHNOLOGIES), it then follows the suggested design of supplier, from the BSB total serum IgE moulds of 5 μ g Plate and oligo dT primer reverse transcription go out cDNA.The final volume of responsive transcription is adjusted to 100 μ L with the water of nuclease free.
By primer BSB_wupA_reg1-For (SEQ ID NO:And BSB_wupA_reg1-Rev (SEQ ID NO 84): 85) it is used to expand the regions BSB_wupA 1, also referred to as BSB_wupA reg1 templates.Using 1 μ L cDNA (above)s as template, Pass through (touch-down) PCR that contacts to earth (annealing temperature is down to 50 DEG C from 60 DEG C, is reduced with 1 DEG C/cycle) DNA amplification template. 349bp sections (the SEQ ID NO comprising BSB_wupA reg1 are generated during 35 PCR cycles:81) segment.Also use Above procedure utilizes YFPv2-F (SEQ ID NO:And YFPv2-R (SEQ ID NO 87):88) primer is negative to expand 301bp Contrast template YFPv2 (SEQ ID NO:86).BSB_wupA reg1 and YFPv2 primer contain T7 bacteriophage promoters at its 13 ' end Subsequence (SEQ ID NO:5), so that YFPv2 and BSB_wupA reg1DNA segments can be used in dsRNA transcriptions.
DsRNA is synthesized.Utilize MEGAscriptTMRNAi kits (AMBION) use 2 μ L according to the explanation of manufacturer PCR product (above) synthesizes dsRNA as template.(referring to Fig. 1).In NANODROPTMIt will on 8000 spectrophotometers DsRNA is quantitative, and is diluted in the 0.1X TE buffer solutions of nuclease free (1mM Tris HCL, 0.1mM EDTA, pH7.4) 500ng/μL。
It injects in dsRNA to BSB haemocoeles.BSB was in 27 DEG C of incubator, in 65% relative humidity and 16 hours:8 hours Illumination:Under dark photoperiod, with colony form raising on green soya bean and seed foodstuff.If gently operating for the second age with small brushes They are placed in culture dish on ice by worm (every weight 1 to 1.5mg) with antisitic defect, so that insect feels cold to solid It is fixed motionless.The 500ng/ μ L dsRNA solution of 55.2nL is injected (that is, 27.6ng dsRNA to every insect；18.4 to 27.6 μ g/ The dosage of g weight).It is noted using equipped with made of 3.5 inches of #3-000-203-G/X capillary glass tubies drawings of Drummond Penetrate the NANOJECT of needleTMII syringes (DRUMMOND SCIENTIFIC, Broomhall, PA) are injected.Needle point is broken, Capillary is loaded with light mineral oil, is subsequently filled the dsRNA of 2 to 3 μ L.DsRNA is injected into the abdomen of nymph (experiment every time Every part of dsRNA injects 10 insects), it is tested in different repetitions in three days.Insect through injection is transferred to (per 5, hole) and is equipped with Artificial BSB foodstuffs piller is simultaneously covered with Pull-N-PeelTMCover plate (BIO-CV-4；BIO-SERV 32 hole pallet (Bio-RT-) 32 raising pallets (Bio-RT-32 Rearing Tray)；BIO-SERV, Frenchtown, NJ) in.By band cotton spill and dress There are the 1.5mL microcentrifugal tubes of 1.25mL water to provide moisture.By these pallets 26.5 DEG C, 60% humidity and 16 hours:8 hours Illumination:It is incubated under dark photoperiod.After injection 7 days, viability counts and weight are obtained.
BSB wupA are determined as to the injection of lethal dsRNA targets.The dsRNA of the section YFPv2 of the code areas YFP will be targeted As the negative control in BSB injection experiments.As summarized in table 14,27.6ng BSB_wupA reg1 dsRNA are injected into In the haemocoele of second age BSB nymph high mortality is produced in seven days.The death rate is bright caused by BSB_wupA reg1 dsRNA It is aobvious to be different from the death rate seen in same amount of injection YFPv2 dsRNA (negative control), p=0.00263 (student t is examined).
Table 14BSB_wupA reg1 dsRNA are injected into the result after seven days in the haemocoele of the second age palm fibre stinkbug nymph.
* each dsRNA tests 10 insects of injection every time.
SEM- average standard errors
Embodiment 13
Include the transgenic corns of Hemipteran pest sequence
As described in example 6 above, the transgenosis T of 10 to 20 plants of expression vectors comprising nucleic acid is generated0Corn plant, it is described Nucleic acid includes SEQ ID NO:79、SEQ ID NO:81、SEQ ID NO:82 and/or SEQ ID NO:83.Obtain other 10 To the T of the hair clip dsRNA of 20 expression RNAi constructs1Corn independent lines are attacked for BSB.Hair clip dsRNA can be such as SEQ ID NO:81、SEQ ID NO:82、SEQ ID NO:Further include shown in 83 or in addition SEQ ID NO:79 and derive.These It is confirmed by RT-PCR or other molecular analysis methods.Independent T from selectionThe total serum IgE prepared product of 1 strain is optionally for RT- PCR, wherein primer are designed to combine in the connector of the hair clip expression cassette in each RNAi constructs.In addition, being used for RNAi The specific primer of each target gene generates the required preprocessings of siRNA optionally for amplification in plant in construct MRNA, and for confirming the mRNA for producing the preprocessing.The amplification of the desired band of each target gene is confirmed every Hairpin RNA is expressed in a rotaring gene corn plant.Subsequently optionally utilize RNA blot hybridizations in independent transgenic strain Confirm that the dsRNA hair clips of target gene have been processed into siRNA.
In addition, with there are the RNAi molecules of the mismatch of 80% or more sequence identity to influence corn with target gene The mode of rootworm seen mode when being similar to using the RNAi molecule with target gene with 100% sequence identity.Mispairing The pairing of sequence and native sequences forms hair clip dsRNA in the same RNAi constructs, and thus delivering can influence in feed The growth of Hemipteran pest, development and viability the siRNA processed through plant.
Delivering corresponds to dsRNA, siRNA, shRNA or miRNA of target gene in plant, then by Hemipteran pest It is absorbed by feed, the target gene in Hemipteran pest is caused to be lowered due to the gene silencing that RNA is mediated.When target base The function of cause when being of great significance in one or more stages of development, growth, development and the breeding of Hemipteran pest by It influences, and intends the feelings of at least one of wall stinkbug, eating attraction, green rice bug, happiness acrosternumhilare and brown America stinkbug in heroic America stinkbug, Gaede Under condition, cause successfully infect, feed, develop and/or breed, or causes Hemipteran pest dead.Then by selecting target Mark gene controls Hemipteran pest with successful application RNAi.
Transgenic RNAi strain and non-transformedThe phenotype of soybean compares.Select half wing of target for creating hair clip dsRNA Mesh pest gene or sequence and any of plant genetic sequences are all without similitude.Therefore, it is contemplated that by targeting these half wings The construct of mesh pest gene or sequence generates or activation (systematicness) RNAi will not generate any harmful shadow to genetically modified plants It rings.However, by the development of transgenic strain and morphological feature with non-transformed plant and with " sky " of no hair clip expressing gene Those of carrier conversion transgenic strain is compared.Compare root, bud, leaf and the reproduction characteristics of plant.Genetically modified plants and Non-transformed plant does not have observable difference on root long degree and growth pattern.The bud feature of plant such as height, the number of blade Size and appearance with size, flowering time, flower is similar.It is, in general, that when cultivating in vitro and in greenhouse soil, Not expressing in transgenic strain and between those of target iRNA molecules strain does not have observable morphological differences.
Embodiment 14
Include the genetically engineered soybean of Hemipteran pest sequence
Generate the transgenosis T of 10 to 20 plants of expression vectors comprising nucleic acid0Bean plant, the nucleic acid contain SEQ ID NO79、SEQ ID NO:81、SEQ ID NO:82 and/or SEQ ID NO:83, the plant is in a manner known in the art It generates, including for example passes through Agrobacterium-medialed transformation as described below.With chlorine by ripe soybean (Glycine max) seed Sterilize 16 hours overnight.After disinfection by chlorine, seed is placed in LAMINARTMTo disperse in open container in laminar flow hood Chlorine.Then, using black box, make the sterile H of sterilized neutron absorption at 24 DEG C in the dark2O 16 hours.
Prepare segmentation seed soybean.Including the splitting scheme of the soya seeds of part plumular axis need to prepare it is longitudinally slit big Beans seed material, it is longitudinally slit using No. 10 blades being attached on scalpel, it is detached along the hilum of seed and removes kind of a skin, so Seed is divided into two sub- leaf portions point afterwards.Part plumular axis is carefully removed, wherein about 1/2-1/3 plumular axis remains adhered to son The section end of leaf.
Inoculation.Then the segmentation soya seeds comprising part plumular axis are placed in Agrobacterium tumefaciems (for example, bacterial strain EHA 101 Or EHA 105) solution in submerge about 30 minutes, it includes SEQ ID NO that the Agrobacterium tumefaciems, which carries,:79、SEQ ID NO: 81、SEQ ID NO:82 and/or SEQ ID NO:83.Before immersing the cotyledon with plumular axis, Agrobacterium tumefaciems solution is diluted To λ=0.6OD650Ultimate density.
It co-cultures.After inoculation, allow segmentation soya seeds and Agrobacterium tumefaciens strain co-culture culture medium (Wang, Kan.Agrobacterium Protocols.2.1.New Jersey:Humana Press, 2006.Print.) on co-culture 5 It co-cultures culture medium and is placed in culture dish, and culture dish is covered with a piece of filter paper.
Bud induces.After co-culturing 5 days, the soya seeds of segmentation are placed in by B5 salt, B5 vitamins, 28mg/L divalent Iron, 38mg/L Na2EDTA, 30g/L sucrose, 0.6g/L MES, 1.11mg/L BAP, 100mg/L TIMENTINTM、200mg/L Washing in liquid bud induction (SI) culture medium (pH 5.7) of cefotaxime and 50mg/L vancomycins composition.Then by segmentation Soya seeds are placed in by B5 salt, B5 vitamins, 7g/L noble's agars, 28mg/L ferrous irons, 38mg/L Na2EDTA、30g/L Sucrose, 0.6g/L MES, 1.11mg/L BAP, 50mg/L TIMENTINTM, 200mg/L cefotaxime, 50mg/L vancomycins It is cultivated on bud induction I (SI I) culture mediums (pH 5.7) of composition, the flat side of wherein cotyledon is face-up, and the section end of cotyledon It is embedded in culture medium.After culture 2 weeks, the explant from inverted segmentation soya seeds is transferred to bud and induces II In (SI II) culture medium, which contains supplemented with 6mg/L glufosinate-ammoniumsSI I culture mediums.
Bud extends.After cultivating 2 weeks on SI II culture mediums, cotyledon is removed from explant, passes through the base portion in cotyledon Notch and cut the bud pad flushed containing plumular axis.The bud pad for being isolated from cotyledon is transferred on bud elongation (SE) culture medium.It should SE culture mediums are by MS salt, 28mg/L ferrous irons, 38mg/L Na2EDTA, 30g/L sucrose and 0.6g/L MES, 50mg/L asparagus fern acyls Amine, 100mg/L L-Glutimic acids, 0.1mg/L IAA, 0.5mg/L GA3,1mg/L ribosylzeatins, 50mg/L TIMENTINTM, 200mg/L cefotaxime, 50mg/L vancomycins, 6mg/L glufosinate-ammoniums, 7g/L noble's agars composition, pH is 5.7.Culture is transferred on fresh SE culture mediums every 2 weeks.Culture is in CONVIRONTMIt is raw at 24 DEG C in growth room Long, using the 18h photoperiods, luminous intensity is 80 to 90 μm of ol/m2s。
It takes root.The elongation bud sent out from cotyledon bud pad is detached by cutting elongation bud in cotyledon bud pad base, and will It extends bud and immerses in 1mg/L IBA (indoles 3- butyric acid) 1 to 3 minute with hestening rooting.Then, elongation bud is transferred to Phyta Root media (MS salt, B5 vitamins, 28mg/L ferrous irons, 38mg/L Na in pallet2EDTA, 20g/L sucrose and 0.59g/L MES, 50mg/L asparagines, 100mg/L L-Glutimic acids, 7g/L noble's agars, pH 5.6) in.
Cultivation.In CONVIRONTMIn growth room, after cultivating for 1 to 2 week under 24 DEG C and 18 hour photoperiod, it will take root Bud be transferred in the soil mixture in sundae cup with cover, be put into CONVIRONTMGrowth room (CMP4030 and CMP3244 Type, Controlled Environments Limited, Winnipeg, Manitoba, Canada) in, it is placed in long-day conditions Under (16 hours illumination/8 hour dark), luminous intensity be 120 to 150 μm of ol/m2S, temperature (22 DEG C) and humidity (40-50%) are permanent It is fixed, to tame plantlet.After the plantlet taken root tames several weeks in sundae cup, it is transferred in greenhouse further to tame And it is colonized healthy and strong transgenic soy bean plant.
Obtain the T of the hair clip dsRNA of 10 to 20 other expression RNAi constructs1Soybean independent lines are attacked for BSB It hits.Hair clip dsRNA can be such as SEQ ID NO:81、SEQ ID NO:82、SEQ ID NO:It further includes shown in 83 or in addition SEQ ID NO:79 and derive.These are confirmed by RT-PCR or other molecular analysis methods.Independent T from selection1 strain it is total RNA prepared products are designed to connecing for the hair clip expression cassette in each RNAi constructs optionally for RT-PCR, wherein primer It is combined in head.In addition, the specific primer for each target gene in RNAi constructs optionally for amplification in plant The required preprocessing mRNA of siRNA are generated, and for confirming the mRNA for producing the preprocessing.For each target gene The amplification of desired band confirm in each transgenic soy bean plant and express hairpin RNA.Subsequently optionally utilize RNA traces miscellaneous It hands over and confirms that the dsRNA hair clips of target gene have been processed into siRNA in independent transgenic strain.
In addition, with there are the RNAi molecules of the mismatch of 80% or more sequence identity to influence corn with target gene The mode of rootworm seen mode when being similar to using the RNAi molecule with target gene with 100% sequence identity.Mispairing The pairing of sequence and native sequences forms hair clip dsRNA in the same RNAi constructs, and thus delivering can influence in feed The growth of Hemipteran pest, development and viability the siRNA processed through plant.
Delivering corresponds to dsRNA, siRNA, shRNA or miRNA of target gene in plant, then by Hemipteran pest It is absorbed by feed, the target gene in Hemipteran pest is caused to be lowered due to the gene silencing that RNA is mediated.When target base The function of cause when being of great significance in one or more stages of development, growth, development and the breeding of Hemipteran pest by It influences, and intends the feelings of at least one of wall stinkbug, eating attraction, green rice bug, happiness acrosternumhilare and brown America stinkbug in heroic America stinkbug, Gaede Under condition, cause successfully infect, feed, develop and/or breed, or causes Hemipteran pest dead.Then by selecting target Mark gene controls Hemipteran pest with successful application RNAi.
Transgenic RNAi strain and the phenotype of non-transformed soybean compare.Select half wing of target for creating hair clip dsRNA Mesh pest gene or sequence and any of plant genetic sequences are all without similitude.Therefore, it is contemplated that by targeting these half wings The construct of mesh pest gene or sequence generates or activation (systematicness) RNAi will not generate any harmful shadow to genetically modified plants It rings.However, by the development of transgenic strain and morphological feature with non-transformed plant and with " sky " of no hair clip expressing gene Those of carrier conversion transgenic strain is compared.Compare root, bud, leaf and the reproduction characteristics of plant.Genetically modified plants and Non-transformed plant does not have observable difference on root long degree and growth pattern.The bud feature of plant such as height, the number of blade Size and appearance with size, flowering time, flower is similar.It is, in general, that when cultivating in vitro and in greenhouse soil, Not expressing in transgenic strain and between those of target iRNA molecules strain does not have observable morphological differences.
Although the disclosure may be allowed various modifications and alternative form, tool is described in detail herein by example The embodiment of body.It should be appreciated, however, that the disclosure is not intended to be limited to particular forms disclosed.On the contrary, the disclosure is intended to Cover all modifications, the equivalent within the scope of the disclosure for falling into and being limited by appended below book and its legal equivalents And substitute.
Embodiment 15
With the bioassay for the heroic America stinkbug that artificial foodstuff is food
Identical as injection experiment (embodiment 12) in being measured using the dsRNA of artificial foodstuff feedings, setting has one The artificial foodstuff piller of about 18mg and 32 hole pallets of water.The dsRNA of a concentration of 200ng/ μ l is added to food pellet and water In sample, the 100 μ l of each addition into two holes.The heroic America stinkbug nymph in 5 the second ages is added into each hole.It will The dsRNA of water sample and targeting YFP transcripts is used as negative control.It repeats to test three different dates.To surviving insects It weighs, and the death rate is measured after handling 8 days.
Embodiment 16
Include the transgenic arabidopsis (Arabidopsis thaliana) of Hemipteran pest sequence
It is generated containing the target gene construct for being used to form hair clip using standard molecular methods similar to Example 4 Arabidopsis (Arabidopsis) conversion carrier, the target gene construct include section (the SEQ ID NO of wupA:79).Make Arabidopsis conversion is executed with the method based on Agrobacterium of standard.T is selected with glufosinate tolerant selectable marker1Kind Son.Generate transgenosis T1Arabidopsis plant, and generate homozygous single copy T2Genetically modified plants are studied for insect.To having Arabidopsis plant in the growth of inflorescence executes bioassay.Five to ten insects are taken to be placed in each plant, and 14 Survival condition is monitored in it.
Build Arabidopsis conversion carrier.Using the combination of chemical synthesis segment (DNA2.0, Menlo Park, CA), with And the molecular cloning method of standard, the entry clones based on entry vector are assembled, these entry clones, which contain, is used to form hair clip Target gene construct, which includes section (the SEQ ID NO of wupA:79).By (individually transcribing In unit) with the next easyization RNA primary transcripts formation intramolecular hair of two copies of opposite orientation arrangement target gene section Folder, described two sections are by a joint sequence (such as ring (such as SEQ ID NO:Or ST-LS1 intrones 102)； Vancanneyt et al. (1990) Mol.Gen.Genet.220 (2):245-50) separate.Therefore, primary mRNA transcript contains By two separated wupA gene segment sequences of the joint sequence, the two sector sequences inverted repeats big each other. Use 10 promoter of arabidopsis ubiquitin (Callis et al., (1990) J.Biological Chem.265:12486-12493) It copies to drive the generation of primary mRNA hair clips transcript, and using non-comprising 3 ' from Agrobacterium tumefaciems open reading frame 23 Translated region (AtuORF23 3'UTR v1；U.S. Patent number 5,428,147) segment terminate the gene of expression hairpin RNA Transcription.
By the hair clip clone in above-mentioned entry vector for standardRecombining reaction, the reaction use Typical binary purpose carrier is to generate the shrna expression conversion carrier for agriculture bacillus mediated Arabidopsis conversion.
Binary purpose carrier be included in cassava vein mosaic virus promoters (CsVMV promoter v2, U.S. Patent number 7, 601,885；Verdaguer et al., (1996) Plant Molecular Biology, 31:Weeding under 1129-1139) regulating and controlling Agent genes conferring resistance DSM-2v2 (U.S. Patent Publication number 2011/0107455).Using comprising from Agrobacterium tumefaciems open read 3 ' non-translational regions (the AtuORF1 3'UTR v6 of frame 1；Huang et al., (1990) J.Bacteriol.172:1814-1822) Segment terminate the transcription of DSM2v2 mRNA.
By the standard for using typical binary purpose carrier and entry vectorRecombining reaction, structure Include the negative control binary constructs of the gene of expression YFP hairpin RNAs.Introduction construct is opened included in Arabidopsis ubiquitin 10 YFP hairpins under the expression control of mover (above), and turn over comprising the ORF23 3 ' from Agrobacterium tumefaciems is non- Translate the segment (above) in area.
Generate the transgenic arabidopsis category for including desinsection hairpin RNA：Agrobacterium-medialed transformation.Hairpin will be contained In binary plasmid electroporation to agrobacterium strains GV3101 (pMP90RK).Pass through the Plasmid Preparation to recombinational agrobacterium bacterium colony Restriction analysis confirm recombinational agrobacterium clone.It uses the big extraction reagent kit of Qiagen plasmids (Plasmid Max Kit) (Qiagen, catalog number (Cat.No.) 12162), it then follows the scheme that manufacturer is recommended extracts plasmid from Agrobacterium culture.
Arabidopsis converts and T1Selection.Take 12 to 15 plants of Arabidopsis plants (Columbia varieties) in the greenhouse 4 inches of basins in grow, the luminous intensity in greenhouse be 250 μm of ol/m2, temperature was 25 DEG C, using 18 hours:Illumination in 6 hours: Dark condition.Convert the main scape of the last week trimming.It is vibrated with 225rpm by being placed in 10 μ l recombinational agrobacterium glycerol stocks 28 DEG C at 100ml LB meat soups (Sigma L3022)+100mg/L spectinomycin+50mg/L kanamycins in incubate it is 72 small When prepare Agrobacterium inoculation object.Agrobatcerium cell is harvested, 5% sucrose+0.04%Silwet-L77 (Lehle are suspended in Seeds catalog number (Cat.No.) VIS-02) in+10 μ g/L aminotoluene base purine (BA) solution, until OD6000.8~1.0, then carry out inflorescence It dips.The aerial part of plant is immersed into Agrobacterium solution 5 to 10 minutes, gentle agitation.Then plant is transferred in greenhouse Normal growth, and regular watering, fertilizing are carried out, until seed shapes.
Embodiment 17
The growth and bioassay that transgenic arabidopsis belongs to。
The T that selection is converted with hairpin RNA i constructs1Arabidopsis.It will be from the up to T of 200mg converted every time1Seed It is placed in 0.1% agarose solution and is layered.Seed is planted in the germination equipped with No. 5 sunlight culture mediums (sunshine media) (10.5 inches × 21 inches × 1 inch of pallet；T.O.Plastics Inc., Clearwater, MN.) in.6 days after planting With 9 days, select to 280g/ha's(glufosinate-ammonium) has the transformant of tolerance.The event selected is transplanted to directly In the basin that 4 inches of diameter.In one week of transplanting, real-time PCR is quantified via the hydrolysis of Roche LightCycler480 is used (qPCR) it executes and is inserted into copy analysis.Using LightCycler probes design software 2.0 (Roche), may be selected for DSM2v2 Label design PCR primer and hydrolysis probes.Plant is maintained 24 DEG C, intensity be 100-150mE/m2 × s fluorescent lamp and With 16 hours under incandescent lamp:Illumination in 8 hours:Dark photoperiod is cultivated.
Heroic America stinkbug plant feeds bioassay.At least four low-copies (1 to 2 insertion) are selected for each construct Event, copy (2 to 3 insertions) event and four high copy (>=4 insertions) events in four.Make plant growth to florescence (plant has flower and siliqua).Soil surface is covered with the white sand of about 50ml volumes, in order to differentiate insect.By 5 to 10 Only the heroic America stinkbug nymph in the second age is guided in each plant.Plant a diameter of 3 inches, 16 inches high, 0.03 English of wall thickness Very little plastic tube (production number 484485, Visipack Fenton MO) covering, pipe is covered so that insect is isolated with nylon wire. Plant is maintained under the conditions of normal temperature, illumination and watering in Conviron incubators.In 14 days, collects insect and claim Weight calculates percentage mortality and growth inhibition (1-processing weight/control weight).Use expression YFP hair clips plant as Control.
Generate T2Arabidopsis seed and T2Bioassay.For each construct, by the low-copy that selects, (1 to 2 is inserted Enter) event generation T2Seed.As described above, feeding biometric to plant (homozygous and/or heterozygosis) carry out hero America stinkbug It is fixed.T is harvested from homozygote3Seed is simultaneously stored for analyzing in the future.
Embodiment 18
Convert additional crop species
It should to provide the control to hemipteran with wupA (with or without chloroplast transit peptides) converting cotton Method known to those skilled in the art is utilized in process, for example, in the past in the embodiment of U.S. Patent number 7,838,733 Substantially the same technology described in the embodiment 12 of 14 or pct international patent publication No. WO 2007/053482.
Embodiment 19
WupA dsRNA in insect management
By other dsRNA molecular combinations in WupA dsRNA transgenosis and genetically modified plants, to provide the RNAi of redundancy The RNAi effects of targeting and collaboration.Expression targeting wupA dsRNA genetically modified plants include (be such as, but not limited to) corn, greatly Beans and cotton, feeding damage caused by these genetically modified plants can be used for preventing coleopteron and hemipteran. WupAdsRNA transgenosis is combined also in plant with B. thuringiensis insecticidal protein techniques, to represent insect-resistant management New role pattern during gene is cumulative.When other dsRNA molecules and/or Su Yun in transgenic plants with targeting insect pest When golden Bacillus insecticidal protein binding, the insecticidal effect of collaboration is observed, which also slows down the growth of resistant insects group Speed.
Although the disclosure may be allowed various modifications and alternative form, tool is described in detail herein by example The embodiment of body.It should be appreciated, however, that the disclosure is not intended to be limited to particular forms disclosed.On the contrary, the disclosure is intended to Cover all modifications, the equivalent within the scope of the disclosure for falling into and being limited by appended below book and its legal equivalents And substitute.
Sequence table
<110> Dow AgroSciences LLC
Narva, Ken E.
Fishilevich, Elane
Worden, Sarah E.
Frey, Meghan
Rangasamy, Murugesan
Gandra, Premchand
Lo, Wendy
<120>Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
<130> 77333
<160> 103
<170>PatentIn 3.5 editions
<210> 1
<211> 1077
<212> DNA
<213>Corn root leaf A
<400> 1
tctacacatc aacctacaga gttcgatcat tactgacggg atatcgagtt tctgaaaatt 60
ctaattttgg cgtcaagctc cctcaaaaat agacgacagc aaaaagctgg atacaaattt 120
cctcggcaag gtaggggaag cagggaaggg aactctcagc atccgagaga aaaatttgca 180
acagtcagca ctgagtcctt gttgactgct cacattttcc atcgttgaga ccagaacaac 240
taaaacactt ccaacatggc ggacgatgag gaaaagaaga ggaaacaggc cgaaattgaa 300
cgcaaaaggg ccgaggtcag ggctcgtatg gaagaggcct caaaagccaa gaaggccaag 360
aaaggtttca tgacccctga gagaaagaag aaacttaggt tactgttgag aaagaaagcc 420
gccgaagaat taaagaaaga acaagaacgc aaagcagccg aaaggaggcg tatcattgaa 480
gaaaggtgcg gtaaacccaa acttgtcgat gacgcaaatg aagggacact taagaagatt 540
tgcaaagact attatgaccg catgtatata tgtgaagaac agaagtggga tttggaacgt 600
gaagttagaa aacgggattg ggagatctcc gaattgaaca gccaagtaaa cgaccttaga 660
ggcaaattcg tcaaaccaac cttgaagaag gtatccaaat acgaaaacaa attcgccaaa 720
cttcaaaaga aggcagctga atttaacttc cgtaaccaac tcaaagttgt caagaagaaa 780
gaattcacct tagaagaaga agacaaagaa aagaaaccag actggtcaaa gaagggagac 840
gaaaagaagg tacaagaggc tgaagcatga tttttctcct ttgttaaagc ccttttgtca 900
acatcaaggg atatgtcgtt atttcgatga tcccatcgtg atttcgatat cttaaatata 960
tttattttat tcattacttt ccagactaaa agagtgtctg tccgcatgta tattatttgt 1020
ttatgtataa cttattaaaa aatgtgaagt attgtaaaaa aaaaaaaaaa aaaaaaa 1077
<210> 2
<211> 204
<212> PRT
<213>Corn root leaf A
<400> 2
Met Ala Asp Asp Glu Glu Lys Lys Arg Lys Gln Ala Glu Ile Glu Arg
1 5 10 15
Lys Arg Ala Glu Val Arg Ala Arg Met Glu Glu Ala Ser Lys Ala Lys
20 25 30
Lys Ala Lys Lys Gly Phe Met Thr Pro Glu Arg Lys Lys Lys Leu Arg
35 40 45
Leu Leu Leu Arg Lys Lys Ala Ala Glu Glu Leu Lys Lys Glu Gln Glu
50 55 60
Arg Lys Ala Ala Glu Arg Arg Arg Ile Ile Glu Glu Arg Cys Gly Lys
65 70 75 80
Pro Lys Leu Val Asp Asp Ala Asn Glu Gly Thr Leu Lys Lys Ile Cys
85 90 95
Lys Asp Tyr Tyr Asp Arg Met Tyr Ile Cys Glu Glu Gln Lys Trp Asp
100 105 110
Leu Glu Arg Glu Val Arg Lys Arg Asp Trp Glu Ile Ser Glu Leu Asn
115 120 125
Ser Gln Val Asn Asp Leu Arg Gly Lys Phe Val Lys Pro Thr Leu Lys
130 135 140
Lys Val Ser Lys Tyr Glu Asn Lys Phe Ala Lys Leu Gln Lys Lys Ala
145 150 155 160
Ala Glu Phe Asn Phe Arg Asn Gln Leu Lys Val Val Lys Lys Lys Glu
165 170 175
Phe Thr Leu Glu Glu Glu Asp Lys Glu Lys Lys Pro Asp Trp Ser Lys
180 185 190
Lys Gly Asp Glu Lys Lys Val Gln Glu Ala Glu Ala
195 200
<210> 3
<211> 1077
<212> DNA
<213>Corn root leaf A
<400> 3
tctacacatc aacctacaga gttcgatcat tactgacggg atatcgagtt tctgaaaatt 60
ctaattttgg cgtcaagctc cctcaaaaat agacgacagc aaaaagctgg atacaaattt 120
cctcggcaag gtaggggaag cagggaaggg aactctcagc atccgagaga aaaatttgca 180
acagtcagca ctgagtcctt gttgactgct cacattttcc atcgttgaga ccagaacaac 240
taaaacactt ccaacatggc ggacgatgag gaaaagaaga ggaaacaggc cgaaattgaa 300
cgcaaaaggg ccgaggtcag ggctcgtatg gaagaggcct caaaagccaa gaaggccaag 360
aaaggtttca tgacccctga gagaaagaag aaacttaggt tactgttgag aaagaaagcc 420
gccgaagaat taaagaaaga acaagaacgc aaagcagccg aaaggaggcg tatcattgaa 480
gaaaggtgcg gtaaacccaa acttgtcgat gacgcaaatg aaggctcatt aaaacaagta 540
tgtgagggat atcacagacg tattgtagac ctagaaaata agaaatttga cctcgaaaaa 600
gaagtggaat tcagagattt tcagatctcc gaattgaaca gccaagtaaa cgaccttaga 660
ggcaaattcg tcaaaccaac cttgaagaag gtatccaaat acgaaaacaa attcgccaaa 720
cttcaaaaga aggcagctga atttaacttc cgtaaccaac tcaaagttgt caagaagaaa 780
gaattcacct tagaagaaga agacaaagaa aagaaaccag actggtcaaa gaagggagac 840
gaaaagaagg tacaagaggc tgaagcatga tttttctcct ttgttaaagc ccttttgtca 900
acatcaaggg atatgtcgtt atttcgatga tcccatcgtg atttcgatat cttaaatata 960
tttattttat tcattacttt ccagactaaa agagtgtctg tccgcatgta tattatttgt 1020
ttatgtataa cttattaaaa aatgtgaagt attgtaaaaa aaaaaaaaaa aaaaaaa 1077
<210> 4
<211> 204
<212> PRT
<213>Corn root leaf A
<400> 4
Met Ala Asp Asp Glu Glu Lys Lys Arg Lys Gln Ala Glu Ile Glu Arg
1 5 10 15
Lys Arg Ala Glu Val Arg Ala Arg Met Glu Glu Ala Ser Lys Ala Lys
20 25 30
Lys Ala Lys Lys Gly Phe Met Thr Pro Glu Arg Lys Lys Lys Leu Arg
35 40 45
Leu Leu Leu Arg Lys Lys Ala Ala Glu Glu Leu Lys Lys Glu Gln Glu
50 55 60
Arg Lys Ala Ala Glu Arg Arg Arg Ile Ile Glu Glu Arg Cys Gly Lys
65 70 75 80
Pro Lys Leu Val Asp Asp Ala Asn Glu Gly Ser Leu Lys Gln Val Cys
85 90 95
Glu Gly Tyr His Arg Arg Ile Val Asp Leu Glu Asn Lys Lys Phe Asp
100 105 110
Leu Glu Lys Glu Val Glu Phe Arg Asp Phe Gln Ile Ser Glu Leu Asn
115 120 125
Ser Gln Val Asn Asp Leu Arg Gly Lys Phe Val Lys Pro Thr Leu Lys
130 135 140
Lys Val Ser Lys Tyr Glu Asn Lys Phe Ala Lys Leu Gln Lys Lys Ala
145 150 155 160
Ala Glu Phe Asn Phe Arg Asn Gln Leu Lys Val Val Lys Lys Lys Glu
165 170 175
Phe Thr Leu Glu Glu Glu Asp Lys Glu Lys Lys Pro Asp Trp Ser Lys
180 185 190
Lys Gly Asp Glu Lys Lys Val Gln Glu Ala Glu Ala
195 200
<210> 5
<211> 355
<212> DNA
<213>Corn root leaf A
<400> 5
gaaggcaaag aaaggtttca tgacaccgga aagaaagaag aagctcagat tgttgttgcg 60
taaaaaagcc gccgaagaat tgaaaaaaga acaggaacgt aaagctgctg aacgtagacg 120
catcatcgaa caacgttgcg gaaagccaag agatcttcaa agcgccaatg aagccatgct 180
gaagaaatac tgtcaagagt attacgaccg aatgtatttg tgtgagaatc aaaaatggga 240
tttggaatac gaagtcaaga aaagagactg ggagatcgct gaccttaatg cccaagttaa 300
cgactcccgc ggtaaattcg tcaaaccagc tttgaagaag gtctccaaat acgaa 355
<210> 6
<211> 118
<212> PRT
<213>Corn root leaf A
<400> 6
Lys Ala Lys Lys Gly Phe Met Thr Pro Glu Arg Lys Lys Lys Leu Arg
1 5 10 15
Leu Leu Leu Arg Lys Lys Ala Ala Glu Glu Leu Lys Lys Glu Gln Glu
20 25 30
Arg Lys Ala Ala Glu Arg Arg Arg Ile Ile Glu Gln Arg Cys Gly Lys
35 40 45
Pro Arg Asp Leu Gln Ser Ala Asn Glu Ala Met Leu Lys Lys Tyr Cys
50 55 60
Gln Glu Tyr Tyr Asp Arg Met Tyr Leu Cys Glu Asn Gln Lys Trp Asp
65 70 75 80
Leu Glu Tyr Glu Val Lys Lys Arg Asp Trp Glu Ile Ala Asp Leu Asn
85 90 95
Ala Gln Val Asn Asp Ser Arg Gly Lys Phe Val Lys Pro Ala Leu Lys
100 105 110
Lys Val Ser Lys Tyr Glu
115
<210> 7
<211> 499
<212> DNA
<213>Corn root leaf A
<400> 7
gaacgcaaaa gggccgaggt cagggctcgt atggaagagg cctcaaaagc caagaaggcc 60
aagaaaggtt tcatgacccc tgagagaaag aagaaactta ggttactgtt gagaaagaaa 120
gccgccgaag aattaaagaa agaacaagaa cgcaaagcag ccgaaaggag gcgtatcatt 180
gaagaaaggt gcggtaaacc caaacttgtc gatgacgcaa atgaagggac acttaagaag 240
atttgcaaag actattatga ccgcatgtat atatgtgaag aacagaagtg ggatttggaa 300
cgtgaagtta gaaaacggga ttgggagatc tccgaattga acagccaagt aaacgacctt 360
agaggcaaat tcgtcaaacc aaccttgaag aaggtatcca aatacgaaaa caaattcgcc 420
aaacttcaaa agaaggcagc tgaatttaac ttccgtaacc aactcaaagt tgtcaagaag 480
aaagaattca ccttagaag 499
<210> 8
<211> 498
<212> DNA
<213>Corn root leaf A
<400> 8
gccgaaattg aacgcaaaag ggccgaggtc agggctcgta tggaagaggc ctcaaaagcc 60
aagaaggcca agaaaggttt catgacccct gagagaaaga agaaacttag gttactgttg 120
agaaagaaag ccgccgaaga attaaagaaa gaacaagaac gcaaagcagc cgaaaggagg 180
cgtatcattg aagaaaggtg cggtaaaccc aaacttgtcg atgacgcaaa tgaaggctca 240
ttaaaacaag tatgtgaggg atatcacaga cgtattgtag acctagaaaa taagaaattt 300
gacctcgaaa aagaagtgga attcagagat tttcagatct ccgaattgaa cagccaagta 360
aacgacctta gaggcaaatt cgtcaaacca accttgaaga aggtatccaa atacgaaaac 420
aaattcgcca aacttcaaaa gaaggcagct gaatttaact tccgtaacca actcaaagtt 480
gtcaagaaga aagaattc 498
<210> 9
<211> 353
<212> DNA
<213>Corn root leaf A
<400> 9
gaaggcaaag aaaggtttca tgacaccgga aagaaagaag aagctcagat tgttgttgcg 60
taaaaaagcc gccgaagaat tgaaaaaaga acaggaacgt aaagctgctg aacgtagacg 120
catcatcgaa caacgttgcg gaaagccaag agatcttcaa agcgccaatg aagccatgct 180
gaagaaatac tgtcaagagt attacgaccg aatgtatttg tgtgagaatc aaaaatggga 240
tttggaatac gaagtcaaga aaagagactg ggagatcgct gaccttaatg cccaagttaa 300
cgactcccgc ggtaaattcg tcaaaccagc tttgaagaag gtctccaaat acg 353
<210> 10
<211> 254
<212> DNA
<213>Corn root leaf A
<400> 10
gaaagaaagc cgccgaagaa ttaaagaaag aacaagaacg caaagcagcc gaaaggaggc 60
gtatcattga agaaaggtgc ggtaaaccca aacttgtcga tgacgcaaat gaagggacac 120
ttaagaagat ttgcaaagac tattatgacc gcatgtatat atgtgaagaa cagaagtggg 180
atttggaacg tgaagttaga aaacgggatt gggagatctc cgaattgaac agccaagtaa 240
acgaccttag aggc 254
<210> 11
<211> 130
<212> DNA
<213>Corn root leaf A
<400> 11
aacgtaaagc tgctgaacgt agacgcatca tcgaacaacg ttgcggaaag ccaagagatc 60
ttcaaagcgc caatgaagcc atgctgaaga aatactgtca agagtattac gaccgaatgt 120
atttgtgtga 130
<210> 12
<211> 133
<212> DNA
<213>Corn root leaf A
<400> 12
gccatgctga agaaatactg tcaagagtat tacgaccgaa tgtatttgtg tgagaatcaa 60
aaatgggatt tggaatacga agtcaagaaa agagactggg agatcgctga ccttaatgcc 120
caagttaacg act 133
<210> 13
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The promoter oligonucleotides of synthesis
<400> 13
ttaatacgac tcactatagg gaga 24
<210> 14
<211> 503
<212> DNA
<213>Artificial sequence
<220>
<223>The partial coding region of synthesis
<400> 14
caccatgggc tccagcggcg ccctgctgtt ccacggcaag atcccctacg tggtggagat 60
ggagggcaat gtggatggcc acaccttcag catccgcggc aagggctacg gcgatgccag 120
cgtgggcaag gtggatgccc agttcatctg caccaccggc gatgtgcccg tgccctggag 180
caccctggtg accaccctga cctacggcgc ccagtgcttc gccaagtacg gccccgagct 240
gaaggatttc tacaagagct gcatgcccga tggctacgtg caggagcgca ccatcacctt 300
cgagggcgat ggcaatttca agacccgcgc cgaggtgacc ttcgagaatg gcagcgtgta 360
caatcgcgtg aagctgaatg gccagggctt caagaaggat ggccacgtgc tgggcaagaa 420
tctggagttc aatttcaccc cccactgcct gtacatctgg ggcgatcagg ccaatcacgg 480
cctgaagagc gccttcaaga tct 503
<210> 15
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 15
ttaatacgac tcactatagg gagagaaggc aaagaaaggt ttcatgac 48
<210> 16
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 16
ttaatacgac tcactatagg gagacgtatt tggagacctt cttcaaag 48
<210> 17
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 17
ttaatacgac tcactatagg gagagaaaga aagccgccga agaattaaag 50
<210> 18
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 18
ttaatacgac tcactatagg gagagcctct aaggtcgttt acttggctg 49
<210> 19
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 19
ttaatacgac tcactatagg gagaaacgta aagctgctga acgtag 46
<210> 20
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 20
ttaatacgac tcactatagg gagatcacac aaatacattc ggtcg 45
<210> 21
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 21
ttaatacgac tcactatagg gagagccatg ctgaagaaat actgtcaag 49
<210> 22
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 22
ttaatacgac tcactatagg gagaagtcgt taacttgggc attaaggtc 49
<210> 23
<211> 218
<212> DNA
<213>Corn root leaf A
<400> 23
tagctctgat gacagagccc atcgagtttc aagccaaaca gttgcataaa gctatcagcg 60
gattgggaac tgatgaaagt acaatmgtmg aaattttaag tgtmcacaac aacgatgaga 120
ttataagaat ttcccaggcc tatgaaggat tgtaccaacg mtcattggaa tctgatatca 180
aaggagatac ctcaggaaca ttaaaaaaga attattag 218
<210> 24
<211> 424
<212> DNA
<213>Corn root leaf A
<220>
<221> misc_feature
<222> (393)..(393)
<223>N is a, c, g or t
<220>
<221> misc_feature
<222> (394)..(394)
<223>N is a, c, g or t
<220>
<221> misc_feature
<222> (395)..(395)
<223>N is a, c, g or t
<400> 24
ttgttacaag ctggagaact tctctttgct ggaaccgaag agtcagtatt taatgctgta 60
ttctgtcaaa gaaataaacc acaattgaat ttgatattcg acaaatatga agaaattgtt 120
gggcatccca ttgaaaaagc cattgaaaac gagttttcag gaaatgctaa acaagccatg 180
ttacacctta tccagagcgt aagagatcaa gttgcatatt tggtaaccag gctgcatgat 240
tcaatggcag gcgtcggtac tgacgataga actttaatca gaattgttgt ttcgagatct 300
gaaatcgatc tagaggaaat caaacaatgc tatgaagaaa tctacagtaa aaccttggct 360
gataggatag cggatgacac atctggcgac tannnaaaag ccttattagc cgttgttggt 420
taag 424
<210> 25
<211> 397
<212> DNA
<213>Corn root leaf A
<400> 25
agatgttggc tgcatctaga gaattacaca agttcttcca tgattgcaag gatgtactga 60
gcagaatagt ggaaaaacag gtatccatgt ctgatgaatt gggaagggac gcaggagctg 120
tcaatgccct tcaacgcaaa caccagaact tcctccaaga cctacaaaca ctccaatcga 180
acgtccaaca aatccaagaa gaatcagcta aacttcaagc tagctatgcc ggtgatagag 240
ctaaagaaat caccaacagg gagcaggaag tggtagcagc ctgggcagcc ttgcagatcg 300
cttgcgatca gagacacgga aaattgagcg atactggtga tctattcaaa ttctttaact 360
tggtacgaac gttgatgcag tggatggacg aatggac 397
<210> 26
<211> 490
<212> DNA
<213>Corn root leaf A
<400> 26
gcagatgaac accagcgaga aaccaagaga tgttagtggt gttgaattgt tgatgaacaa 60
ccatcagaca ctcaaggctg agatcgaagc cagagaagac aactttacgg cttgtatttc 120
tttaggaaag gaattgttga gccgtaatca ctatgctagt gctgatatta aggataaatt 180
ggtcgcgttg acgaatcaaa ggaatgctgt actacagagg tgggaagaaa gatgggagaa 240
cttgcaactc atcctcgagg tataccaatt cgccagagat gcggccgtcg ccgaagcatg 300
gttgatcgca caagaacctt acttgatgag ccaagaacta ggacacacca ttgacgacgt 360
tgaaaacttg ataaagaaac acgaagcgtt cgaaaaatcg gcagcggcgc aagaagagag 420
attcagtgct ttggagagac tgacgacgtt cgaattgaga gaaataaaga ggaaacaaga 480
agctgcccag 490
<210> 27
<211> 330
<212> DNA
<213>Corn root leaf A
<400> 27
agtgaaatgt tagcaaatat aacatccaag tttcgtaatt gtacttgctc agttagaaaa 60
tattctgtag tttcactatc ttcaaccgaa aatagaataa atgtagaacc tcgcgaactt 120
gcctttcctc caaaatatca agaacctcga caagtttggt tggagagttt agatacgata 180
gacgacaaaa aattgggtat tcttgagctg catcctgatg tttttgctac taatccaaga 240
atagatatta tacatcaaaa tgttagatgg caaagtttat atagatatgt aagctatgct 300
catacaaagt caagatttga agtgagaggt 330
<210> 28
<211> 320
<212> DNA
<213>Corn root leaf A
<400> 28
caaagtcaag atttgaagtg agaggtggag gtcgaaaacc gtggccgcaa aagggattgg 60
gacgtgctcg acatggttca attagaagtc cactttggag aggtggagga gttgttcatg 120
gaccaaaatc tccaacccct catttttaca tgattccatt ctacacccgt ttgctgggtt 180
tgactagcgc actttcagta aaatttgccc aagatgactt gcacgttgtg gatagtctag 240
atctgccaac tgacgaacaa agttatatag aagagctggt caaaagccgc ttttgggggt 300
ccttcttgtt ttatttgtag 320
<210> 29
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 29
ttaatacgac tcactatagg gagacaccat gggctccagc ggcgccc 47
<210> 30
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 30
agatcttgaa ggcgctcttc agg 23
<210> 31
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 31
caccatgggc tccagcggcg ccc 23
<210> 32
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 32
ttaatacgac tcactatagg gagaagatct tgaaggcgct cttcagg 47
<210> 33
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 33
ttaatacgac tcactatagg gagagctcca acagtggttc cttatc 46
<210> 34
<211> 29
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 34
ctaataattc ttttttaatg ttcctgagg 29
<210> 35
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 35
gctccaacag tggttcctta tc 22
<210> 36
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 36
ttaatacgac tcactatagg gagactaata attctttttt aatgttcctg agg 53
<210> 37
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 37
ttaatacgac tcactatagg gagattgtta caagctggag aacttctc 48
<210> 38
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 38
cttaaccaac aacggctaat aagg 24
<210> 39
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 39
ttgttacaag ctggagaact tctc 24
<210> 40
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 40
ttaatacgac tcactatagg gagacttaac caacaacggc taataagg 48
<210> 41
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 41
ttaatacgac tcactatagg gagaagatgt tggctgcatc tagagaa 47
<210> 42
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 42
gtccattcgt ccatccactg ca 22
<210> 43
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 43
agatgttggc tgcatctaga gaa 23
<210> 44
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 44
ttaatacgac tcactatagg gagagtccat tcgtccatcc actgca 46
<210> 45
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 45
ttaatacgac tcactatagg gagagcagat gaacaccagc gagaaa 46
<210> 46
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 46
ctgggcagct tcttgtttcc tc 22
<210> 47
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 47
gcagatgaac accagcgaga aa 22
<210> 48
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 48
ttaatacgac tcactatagg gagactgggc agcttcttgt ttcctc 46
<210> 49
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 49
ttaatacgac tcactatagg gagaagtgaa atgttagcaa atataacatc c 51
<210> 50
<211> 26
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 50
acctctcact tcaaatcttg actttg 26
<210> 51
<211> 27
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 51
agtgaaatgt tagcaaatat aacatcc 27
<210> 52
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 52
ttaatacgac tcactatagg gagaacctct cacttcaaat cttgactttg 50
<210> 53
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 53
ttaatacgac tcactatagg gagacaaagt caagatttga agtgagaggt 50
<210> 54
<211> 25
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 54
ctacaaataa aacaagaagg acccc 25
<210> 55
<211> 26
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 55
caaagtcaag atttgaagtg agaggt 26
<210> 56
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 56
ttaatacgac tcactatagg gagactacaa ataaaacaag aaggacccc 49
<210> 57
<211> 1150
<212> DNA
<213>Corn
<400> 57
caacggggca gcactgcact gcactgcaac tgcgaatttc cgtcagcttg gagcggtcca 60
agcgccctgc gaagcaaact acgccgatgg cttcggcggc ggcgtgggag ggtccgacgg 120
ccgcggagct gaagacagcg ggggcggagg tgattcccgg cggcgtgcga gtgaaggggt 180
gggtcatcca gtcccacaaa ggccctatcc tcaacgccgc ctctctgcaa cgctttgaag 240
atgaacttca aacaacacat ttacctgaga tggtttttgg agagagtttc ttgtcacttc 300
aacatacaca aactggcatc aaatttcatt ttaatgcgct tgatgcactc aaggcatgga 360
agaaagaggc actgccacct gttgaggttc ctgctgcagc aaaatggaag ttcagaagta 420
agccttctga ccaggttata cttgactacg actatacatt tacgacacca tattgtggga 480
gtgatgctgt ggttgtgaac tctggcactc cacaaacaag tttagatgga tgcggcactt 540
tgtgttggga ggatactaat gatcggattg acattgttgc cctttcagca aaagaaccca 600
ttcttttcta cgacgaggtt atcttgtatg aagatgagtt agctgacaat ggtatctcat 660
ttcttactgt gcgagtgagg gtaatgccaa ctggttggtt tctgcttttg cgtttttggc 720
ttagagttga tggtgtactg atgaggttga gagacactcg gttacattgc ctgtttggaa 780
acggcgacgg agccaagcca gtggtacttc gtgagtgctg ctggagggaa gcaacatttg 840
ctactttgtc tgcgaaagga tatccttcgg actctgcagc gtacgcggac ccgaacctta 900
ttgcccataa gcttcctatt gtgacgcaga agacccaaaa gctgaaaaat cctacctgac 960
tgacacaaag gcgccctacc gcgtgtacat catgactgtc ctgtcctatc gttgcctttt 1020
gtgtttgcca catgttgtgg atgtacgttt ctatgacgaa acaccatagt ccatttcgcc 1080
tgggccgaac agagatagct gattgtcatg tcacgtttga attagaccat tccttagccc 1140
tttttccccc 1150
<210> 58
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<220>
<221> misc_feature
<222> (22)..(22)
<223>N is a, c, g or t
<400> 58
tttttttttt tttttttttt vn 22
<210> 59
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 59
agaaagccgc cgaagaatta 20
<210> 60
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 60
gtcatcgaca agtttgggtt tac 23
<210> 61
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 61
tgagggtaat gccaactggt t 21
<210> 62
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 62
gcaatgtaac cgagtgtctc tcaa 24
<210> 63
<211> 32
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 63
tttttggctt agagttgatg gtgtactgat ga 32
<210> 64
<211> 151
<212> DNA
<213>Escherichia coli
<400> 64
gaccgtaagg cttgatgaaa caacgcggcg agctttgatc aacgaccttt tggaaacttc 60
ggcttcccct ggagagagcg agattctccg cgctgtagaa gtcaccattg ttgtgcacga 120
cgacatcatt ccgtggcgtt atccagctaa g 151
<210> 65
<211> 69
<212> DNA
<213>Artificial sequence
<220>
<223>The partial coding region of synthesis
<400> 65
tgttcggttc cctctaccaa gcacagaacc gtcgcttcag caacacctca gtcaaggtga 60
tggatgttg 69
<210> 66
<211> 4233
<212> DNA
<213>Corn
<400> 66
agcctggtgt ttccggagga gacagacatg atccctgccg ttgctgatcc gacgacgctg 60
gacggcgggg gcgcgcgcag gccgttgctc ccggagacgg accctcgggg gcgtgctgcc 120
gccggcgccg agcagaagcg gccgccggct acgccgaccg ttctcaccgc cgtcgtctcc 180
gccgtgctcc tgctcgtcct cgtggcggtc acagtcctcg cgtcgcagca cgtcgacggg 240
caggctgggg gcgttcccgc gggcgaagat gccgtcgtcg tcgaggtggc cgcctcccgt 300
ggcgtggctg agggcgtgtc ggagaagtcc acggccccgc tcctcggctc cggcgcgctc 360
caggacttct cctggaccaa cgcgatgctg gcgtggcagc gcacggcgtt ccacttccag 420
ccccccaaga actggatgaa cggttagttg gacccgtcgc catcggtgac gacgcgcgga 480
tcgttttttt cttttttcct ctcgttctgg ctctaacttg gttccgcgtt tctgtcacgg 540
acgcctcgtg cacatggcga tacccgatcc gccggccgcg tatatctatc tacctcgacc 600
ggcttctcca gatccgaacg gtaagttgtt ggctccgata cgatcgatca catgtgagct 660
cggcatgctg cttttctgcg cgtgcatgcg gctcctagca ttccacgtcc acgggtcgtg 720
acatcaatgc acgatataat cgtatcggta cagagatatt gtcccatcag ctgctagctt 780
tcgcgtattg atgtcgtgac attttgcacg caggtccgct gtatcacaag ggctggtacc 840
acctcttcta ccagtggaac ccggactccg cggtatgggg caacatcacc tggggccacg 900
ccgtctcgcg cgacctcctc cactggctgc acctaccgct ggccatggtg cccgatcacc 960
cgtacgacgc caacggcgtc tggtccgggt cggcgacgcg cctgcccgac ggccggatcg 1020
tcatgctcta cacgggctcc acggcggagt cgtcggcgca ggtgcagaac ctcgcggagc 1080
cggccgacgc gtccgacccg ctgctgcggg agtgggtcaa gtcggacgcc aacccggtgc 1140
tggtgccgcc gccgggcatc gggccgacgg acttccgcga cccgacgacg gcgtgtcgga 1200
cgccggccgg caacgacacg gcgtggcggg tcgccatcgg gtccaaggac cgggaccacg 1260
cggggctggc gctggtgtac cggacggagg acttcgtgcg gtacgacccg gcgccggcgc 1320
tgatgcacgc cgtgccgggc accggcatgt gggagtgcgt ggacttctac ccggtggccg 1380
cgggatcagg cgccgcggcg ggcagcgggg acgggctgga gacgtccgcg gcgccgggac 1440
ccggggtgaa gcacgtgctc aaggctagcc tcgacgacga caagcacgac tactacgcga 1500
tcggcaccta cgacccggcg acggacacct ggacccccga cagcgcggag gacgacgtcg 1560
ggatcggcct ccggtacgac tatggcaagt actacgcgtc gaagaccttc tacgaccccg 1620
tccttcgccg gcgggtgctc tgggggtggg tcggcgagac cgacagcgag cgcgcggaca 1680
tcctcaaggg ctgggcatcc gtgcaggtac gtctcagggt ttgaggctag catggcttca 1740
atcttgctgg catcgaatca ttaatgggca gatattataa cttgataatc tgggttggtt 1800
gtgtgtggtg gggatggtga cacacgcgcg gtaataatgt agctaagctg gttaaggatg 1860
agtaatgggg ttgcgtataa acgacagctc tgctaccatt acttctgaca cccgattgaa 1920
ggagacaaca gtaggggtag ccggtagggt tcgtcgactt gccttttctt ttttcctttg 1980
ttttgttgtg gatcgtccaa cacaaggaaa ataggatcat ccaacaaaca tggaagtaat 2040
cccgtaaaac atttctcaag gaaccatcta gctagacgag cgtggcatga tccatgcatg 2100
cacaaacact agataggtct ctgcagctgt gatgttcctt tacatatacc accgtccaaa 2160
ctgaatccgg tctgaaaatt gttcaagcag agaggccccg atcctcacac ctgtacacgt 2220
ccctgtacgc gccgtcgtgg tctcccgtga tcctgccccg tcccctccac gcggccacgc 2280
ctgctgcagc gctctgtaca agcgtgcacc acgtgagaat ttccgtctac tcgagcctag 2340
tagttagacg ggaaaacgag aggaagcgca cggtccaagc acaacacttt gcgcgggccc 2400
gtgacttgtc tccggttggc tgagggcgcg cgacagagat gtatggcgcc gcggcgtgtc 2460
ttgtgtcttg tcttgcctat acaccgtagt cagagactgt gtcaaagccg tccaacgaca 2520
atgagctagg aaacgggttg gagagctggg ttcttgcctt gcctcctgtg atgtctttgc 2580
cttgcatagg gggcgcagta tgtagctttg cgttttactt cacgccaaag gatactgctg 2640
atcgtgaatt attattatta tatatatatc gaatatcgat ttcgtcgctc tcgtggggtt 2700
ttattttcca gactcaaact tttcaaaagg cctgtgtttt agttcttttc ttccaattga 2760
gtaggcaagg cgtgtgagtg tgaccaacgc atgcatggat atcgtggtag actggtagag 2820
ctgtcgttac cagcgcgatg cttgtatatg tttgcagtat tttcaaatga atgtctcagc 2880
tagcgtacag ttgaccaagt cgacgtggag ggcgcacaac agacctctga cattattcac 2940
ttttttttta ccatgccgtg cacgtgcagt caatccccag gacggtcctc ctggacacga 3000
agacgggcag caacctgctc cagtggccgg tggtggaggt ggagaacctc cggatgagcg 3060
gcaagagctt cgacggcgtc gcgctggacc gcggatccgt cgtgcccctc gacgtcggca 3120
aggcgacgca ggtgacgccg cacgcagcct gctgcagcga acgaactcgc gcgttgccgg 3180
cccgcggcca gctgacttag tttctctggc tgatcgaccg tgtgcctgcg tgcgtgcagt 3240
tggacatcga ggctgtgttc gaggtggacg cgtcggacgc ggcgggcgtc acggaggccg 3300
acgtgacgtt caactgcagc accagcgcag gcgcggcggg ccggggcctg ctcggcccgt 3360
tcggccttct cgtgctggcg gacgacgact tgtccgagca gaccgccgtg tacttctacc 3420
tgctcaaggg cacggacggc agcctccaaa ctttcttctg ccaagacgag ctcaggtatg 3480
tatgttatga cttatgacca tgcatgcatg cgcatttctt agctaggctg tgaagcttct 3540
tgttgagttg tttcacagat gcttaccgtc tgctttgttt cgtatttcga ctaggcatcc 3600
aaggcgaacg atctggttaa gagagtatac gggagcttgg tccctgtgct agatggggag 3660
aatctctcgg tcagaatact ggtaagtttt tacagcgcca gccatgcatg tgttggccag 3720
ccagctgctg gtactttgga cactcgttct tctcgcactg ctcattattg cttctgatct 3780
ggatgcacta caaattgaag gttgaccact ccatcgtgga gagctttgct caaggcggga 3840
ggacgtgcat cacgtcgcga gtgtacccca cacgagccat ctacgactcc gcccgcgtct 3900
tcctcttcaa caacgccaca catgctcacg tcaaagcaaa atccgtcaag atctggcagc 3960
tcaactccgc ctacatccgg ccatatccgg caacgacgac ttctctatga ctaaattaag 4020
tgacggacag ataggcgata ttgcatactt gcatcatgaa ctcatttgta caacagtgat 4080
tgtttaattt atttgctgcc ttccttatcc ttcttgtgaa actatatggt acacacatgt 4140
atcattaggt ctagtagtgt tgttgcaaag acacttagac accagaggtt ccaggagtat 4200
cagagataag gtataagagg gagcagggag cag 4233
<210> 67
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 67
tgttcggttc cctctaccaa 20
<210> 68
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 68
caacatccat caccttgact ga 22
<210> 69
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 69
cacagaaccg tcgcttcagc aaca 24
<210> 70
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 70
tggcggacga cgacttgt 18
<210> 71
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 71
aaagtttgga ggctgccgt 19
<210> 72
<211> 26
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 72
cgagcagacc gccgtgtact tctacc 26
<210> 73
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 73
cttagctgga taacgccac 19
<210> 74
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 74
gaccgtaagg cttgatgaa 19
<210> 75
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 75
cgagattctc cgcgctgtag a 21
<210> 76
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 76
ggaacgagct gcttgcgtat 20
<210> 77
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 77
cacggtgcag ctgattgatg 20
<210> 78
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 78
tcccttccgt agtcagag 18
<210> 79
<211> 1161
<212> DNA
<213>Heroic America stinkbug
<400> 79
ctttgtcagt atcaggcgat ttattgaata aagtcgaatt tctagtagtt ttactcctta 60
atagtcaatc gtattaataa tattacgtca taagaaatat ttactcggct atcttcggaa 120
atggtcggtc agctacgagc cggcaactgt agcccccacc agccagtgag acactaggat 180
tcgcgggtgt ctgtgtcgag acctccttca gttatatcag gttcctgtcc ttaaaccaaa 240
agcaaaatgg cggatgatga agcgaagaaa gcaaaacagg ccgagattga gcggaagagg 300
gcggaggtcc gaaagaggat ggaggaggcc tcaagaggca agaaggccaa aaagggcttc 360
atgacgccag acaggaagaa gaaactccga cttctgctga ggaagaaagc tgctgaagaa 420
ctgaagaaag aacaggagag gaaagcagcg gagagaagga ggatcattga ggagcgctgt 480
ggaaagattt gcgatgttga caatgccagt gaagaaaaat tgaagaaaat ctgctctgat 540
taccaccagc gaattggacg attggaggat gaaaaatttg acttggaata cgttgtaaaa 600
aagaaagatt ttgagattgc ggatcttaac agccaagtca atgatcttcg tggcaagttt 660
gttaaaccca ccttgaaaaa ggtttccaag tatgaaaaca aatttgccaa gctccagaag 720
aaggctgctg aattcaactt cagaaatcaa ctaaaagttg taaagaagaa agagtttacc 780
cttgaagaag aagacaaaga gaaaaaggga ggcattgtcg actggtccaa gaaggatgaa 840
aaggcaaagg tagaggcatg aagcgcatga agaaaaaatc atcccttatt ggatattttg 900
tccttatgtt gtacgtcctt gttgttttct gttatttaaa acctgatact ttttttatcc 960
tgttcgcatc atttataact atgaagtaag atacaaagtc aagcatgacc ctttagttct 1020
ttggaatcca aagcatgtta aaaaaaaaat ttctccttaa aaaaagaatg aaaatcagca 1080
cacccataaa tgatattttg tatgtatctt ttgtctgaaa tatatatata tgataagttt 1140
aaaaaaaaaa aaaaaaaaaa a 1161
<210> 80
<211> 204
<212> PRT
<213>Heroic America stinkbug
<400> 80
Met Ala Asp Asp Glu Ala Lys Lys Ala Lys Gln Ala Glu Ile Glu Arg
1 5 10 15
Lys Arg Ala Glu Val Arg Lys Arg Met Glu Glu Ala Ser Arg Gly Lys
20 25 30
Lys Ala Lys Lys Gly Phe Met Thr Pro Asp Arg Lys Lys Lys Leu Arg
35 40 45
Leu Leu Leu Arg Lys Lys Ala Ala Glu Glu Leu Lys Lys Glu Gln Glu
50 55 60
Arg Lys Ala Ala Glu Arg Arg Arg Ile Ile Glu Glu Arg Cys Gly Lys
65 70 75 80
Ile Cys Asp Val Asp Asn Ala Ser Glu Glu Lys Leu Lys Lys Ile Cys
85 90 95
Ser Asp Tyr His Gln Arg Ile Gly Arg Leu Glu Asp Glu Lys Phe Asp
100 105 110
Leu Glu Tyr Val Val Lys Lys Lys Asp Phe Glu Ile Ala Asp Leu Asn
115 120 125
Ser Gln Val Asn Asp Leu Arg Gly Lys Phe Val Lys Pro Thr Leu Lys
130 135 140
Lys Val Ser Lys Tyr Glu Asn Lys Phe Ala Lys Leu Gln Lys Lys Ala
145 150 155 160
Ala Glu Phe Asn Phe Arg Asn Gln Leu Lys Val Val Lys Lys Lys Glu
165 170 175
Phe Thr Leu Glu Glu Glu Asp Lys Glu Lys Lys Gly Gly Ile Val Asp
180 185 190
Trp Ser Lys Lys Asp Glu Lys Ala Lys Val Glu Ala
195 200
<210> 81
<211> 349
<212> DNA
<213>Heroic America stinkbug
<400> 81
gtcaacatcg caaatctttc cacagcgctc ctcaatgatc ctccttctct ccgctgcttt 60
cctctcctgt tctttcttca gttcttcagc agctttcttc ctcagcagaa gtcggagttt 120
cttcttcctg tctggcgtca tgaagccctt tttggccttc ttgcctcttg aggcctcctc 180
catcctcttt cggacctccg ccctcttccg ctcaatctcg gcctgttttg ctttcttcgc 240
ttcatcatcc gccattttgc ttttggttta aggacaggaa cctgatataa ctgaaggagg 300
tctcgacaca gacacccgcg aatcctagtg tctcactggc tggtggggg 349
<210> 82
<211> 104
<212> DNA
<213>Heroic America stinkbug
<400> 82
gatcctcctt ctctccgctg ctttcctctc ctgttctttc ttcagttctt cagcagcttt 60
cttcctcagc agaagtcgga gtttcttctt cctgtctggc gtca 104
<210> 83
<211> 126
<212> DNA
<213>Heroic America stinkbug
<400> 83
gccctttttg gccttcttgc ctcttgaggc ctcctccatc ctctttcgga cctccgccct 60
cttccgctca atctcggcct gttttgcttt cttcgcttca tcatccgcca ttttgctttt 120
ggttta 126
<210> 84
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 84
ttaatacgac tcactatagg gagagtcaac atcgcaaatc tttccacag 49
<210> 85
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 85
ttaatacgac tcactatagg gagaccccca ccagccagtg agacactagg attc 54
<210> 86
<211> 301
<212> DNA
<213>Artificial sequence
<220>
<223>The artificial sequence of synthesis
<400> 86
catctggagc acttctcttt catgggaaga ttccttacgt tgtggagatg gaagggaatg 60
ttgatggcca cacctttagc atacgtggga aaggctacgg agatgcctca gtgggaaagg 120
ttgatgcaca gttcatctgc acaactggtg atgttcctgt gccttggagc acacttgtca 180
ccactctcac ctatggagca cagtgctttg ccaagtatgg tccagagttg aaggacttct 240
acaagtcctg tatgccagat ggctatgtgc aagagcgcac aatcaccttt gaaggagatg 300
g 301
<210> 87
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 87
ttaatacgac tcactatagg gagagcatct ggagcacttc tctttca 47
<210> 88
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223>The primer tasteless nucleotide of synthesis
<400> 88
ttaatacgac tcactatagg gagaccatct ccttcaaagg tgattg 46
<210> 89
<211> 1077
<212> RNA
<213>Corn root leaf A
<400> 89
ucuacacauc aaccuacaga guucgaucau uacugacggg auaucgaguu ucugaaaauu 60
cuaauuuugg cgucaagcuc ccucaaaaau agacgacagc aaaaagcugg auacaaauuu 120
ccucggcaag guaggggaag cagggaaggg aacucucagc auccgagaga aaaauuugca 180
acagucagca cugaguccuu guugacugcu cacauuuucc aucguugaga ccagaacaac 240
uaaaacacuu ccaacauggc ggacgaugag gaaaagaaga ggaaacaggc cgaaauugaa 300
cgcaaaaggg ccgaggucag ggcucguaug gaagaggccu caaaagccaa gaaggccaag 360
aaagguuuca ugaccccuga gagaaagaag aaacuuaggu uacuguugag aaagaaagcc 420
gccgaagaau uaaagaaaga acaagaacgc aaagcagccg aaaggaggcg uaucauugaa 480
gaaaggugcg guaaacccaa acuugucgau gacgcaaaug aagggacacu uaagaagauu 540
ugcaaagacu auuaugaccg cauguauaua ugugaagaac agaaguggga uuuggaacgu 600
gaaguuagaa aacgggauug ggagaucucc gaauugaaca gccaaguaaa cgaccuuaga 660
ggcaaauucg ucaaaccaac cuugaagaag guauccaaau acgaaaacaa auucgccaaa 720
cuucaaaaga aggcagcuga auuuaacuuc cguaaccaac ucaaaguugu caagaagaaa 780
gaauucaccu uagaagaaga agacaaagaa aagaaaccag acuggucaaa gaagggagac 840
gaaaagaagg uacaagaggc ugaagcauga uuuuucuccu uuguuaaagc ccuuuuguca 900
acaucaaggg auaugucguu auuucgauga ucccaucgug auuucgauau cuuaaauaua 960
uuuauuuuau ucauuacuuu ccagacuaaa agagugucug uccgcaugua uauuauuugu 1020
uuauguauaa cuuauuaaaa aaugugaagu auuguaaaaa aaaaaaaaaa aaaaaaa 1077
<210> 90
<211> 1077
<212> RNA
<213>Corn root leaf A
<400> 90
ucuacacauc aaccuacaga guucgaucau uacugacggg auaucgaguu ucugaaaauu 60
cuaauuuugg cgucaagcuc ccucaaaaau agacgacagc aaaaagcugg auacaaauuu 120
ccucggcaag guaggggaag cagggaaggg aacucucagc auccgagaga aaaauuugca 180
acagucagca cugaguccuu guugacugcu cacauuuucc aucguugaga ccagaacaac 240
uaaaacacuu ccaacauggc ggacgaugag gaaaagaaga ggaaacaggc cgaaauugaa 300
cgcaaaaggg ccgaggucag ggcucguaug gaagaggccu caaaagccaa gaaggccaag 360
aaagguuuca ugaccccuga gagaaagaag aaacuuaggu uacuguugag aaagaaagcc 420
gccgaagaau uaaagaaaga acaagaacgc aaagcagccg aaaggaggcg uaucauugaa 480
gaaaggugcg guaaacccaa acuugucgau gacgcaaaug aaggcucauu aaaacaagua 540
ugugagggau aucacagacg uauuguagac cuagaaaaua agaaauuuga ccucgaaaaa 600
gaaguggaau ucagagauuu ucagaucucc gaauugaaca gccaaguaaa cgaccuuaga 660
ggcaaauucg ucaaaccaac cuugaagaag guauccaaau acgaaaacaa auucgccaaa 720
cuucaaaaga aggcagcuga auuuaacuuc cguaaccaac ucaaaguugu caagaagaaa 780
gaauucaccu uagaagaaga agacaaagaa aagaaaccag acuggucaaa gaagggagac 840
gaaaagaagg uacaagaggc ugaagcauga uuuuucuccu uuguuaaagc ccuuuuguca 900
acaucaaggg auaugucguu auuucgauga ucccaucgug auuucgauau cuuaaauaua 960
uuuauuuuau ucauuacuuu ccagacuaaa agagugucug uccgcaugua uauuauuugu 1020
uuauguauaa cuuauuaaaa aaugugaagu auuguaaaaa aaaaaaaaaa aaaaaaa 1077
<210> 91
<211> 355
<212> RNA
<213>Corn root leaf A
<400> 91
gaaggcaaag aaagguuuca ugacaccgga aagaaagaag aagcucagau uguuguugcg 60
uaaaaaagcc gccgaagaau ugaaaaaaga acaggaacgu aaagcugcug aacguagacg 120
caucaucgaa caacguugcg gaaagccaag agaucuucaa agcgccaaug aagccaugcu 180
gaagaaauac ugucaagagu auuacgaccg aauguauuug ugugagaauc aaaaauggga 240
uuuggaauac gaagucaaga aaagagacug ggagaucgcu gaccuuaaug cccaaguuaa 300
cgacucccgc gguaaauucg ucaaaccagc uuugaagaag gucuccaaau acgaa 355
<210> 92
<211> 499
<212> RNA
<213>Corn root leaf A
<400> 92
gaacgcaaaa gggccgaggu cagggcucgu auggaagagg ccucaaaagc caagaaggcc 60
aagaaagguu ucaugacccc ugagagaaag aagaaacuua gguuacuguu gagaaagaaa 120
gccgccgaag aauuaaagaa agaacaagaa cgcaaagcag ccgaaaggag gcguaucauu 180
gaagaaaggu gcgguaaacc caaacuuguc gaugacgcaa augaagggac acuuaagaag 240
auuugcaaag acuauuauga ccgcauguau auaugugaag aacagaagug ggauuuggaa 300
cgugaaguua gaaaacggga uugggagauc uccgaauuga acagccaagu aaacgaccuu 360
agaggcaaau ucgucaaacc aaccuugaag aagguaucca aauacgaaaa caaauucgcc 420
aaacuucaaa agaaggcagc ugaauuuaac uuccguaacc aacucaaagu ugucaagaag 480
aaagaauuca ccuuagaag 499
<210> 93
<211> 498
<212> RNA
<213>Corn root leaf A
<400> 93
gccgaaauug aacgcaaaag ggccgagguc agggcucgua uggaagaggc cucaaaagcc 60
aagaaggcca agaaagguuu caugaccccu gagagaaaga agaaacuuag guuacuguug 120
agaaagaaag ccgccgaaga auuaaagaaa gaacaagaac gcaaagcagc cgaaaggagg 180
cguaucauug aagaaaggug cgguaaaccc aaacuugucg augacgcaaa ugaaggcuca 240
uuaaaacaag uaugugaggg auaucacaga cguauuguag accuagaaaa uaagaaauuu 300
gaccucgaaa aagaagugga auucagagau uuucagaucu ccgaauugaa cagccaagua 360
aacgaccuua gaggcaaauu cgucaaacca accuugaaga agguauccaa auacgaaaac 420
aaauucgcca aacuucaaaa gaaggcagcu gaauuuaacu uccguaacca acucaaaguu 480
gucaagaaga aagaauuc 498
<210> 94
<211> 353
<212> RNA
<213>Corn root leaf A
<400> 94
gaaggcaaag aaagguuuca ugacaccgga aagaaagaag aagcucagau uguuguugcg 60
uaaaaaagcc gccgaagaau ugaaaaaaga acaggaacgu aaagcugcug aacguagacg 120
caucaucgaa caacguugcg gaaagccaag agaucuucaa agcgccaaug aagccaugcu 180
gaagaaauac ugucaagagu auuacgaccg aauguauuug ugugagaauc aaaaauggga 240
uuuggaauac gaagucaaga aaagagacug ggagaucgcu gaccuuaaug cccaaguuaa 300
cgacucccgc gguaaauucg ucaaaccagc uuugaagaag gucuccaaau acg 353
<210> 95
<211> 254
<212> RNA
<213>Corn root leaf A
<400> 95
gaaagaaagc cgccgaagaa uuaaagaaag aacaagaacg caaagcagcc gaaaggaggc 60
guaucauuga agaaaggugc gguaaaccca aacuugucga ugacgcaaau gaagggacac 120
uuaagaagau uugcaaagac uauuaugacc gcauguauau augugaagaa cagaaguggg 180
auuuggaacg ugaaguuaga aaacgggauu gggagaucuc cgaauugaac agccaaguaa 240
acgaccuuag aggc 254
<210> 96
<211> 130
<212> RNA
<213>Corn root leaf A
<400> 96
aacguaaagc ugcugaacgu agacgcauca ucgaacaacg uugcggaaag ccaagagauc 60
uucaaagcgc caaugaagcc augcugaaga aauacuguca agaguauuac gaccgaaugu 120
auuuguguga 130
<210> 97
<211> 133
<212> RNA
<213>Corn root leaf A
<400> 97
gccaugcuga agaaauacug ucaagaguau uacgaccgaa uguauuugug ugagaaucaa 60
aaaugggauu uggaauacga agucaagaaa agagacuggg agaucgcuga ccuuaaugcc 120
caaguuaacg acu 133
<210> 98
<211> 1161
<212> RNA
<213>Heroic America stinkbug
<400> 98
cuuugucagu aucaggcgau uuauugaaua aagucgaauu ucuaguaguu uuacuccuua 60
auagucaauc guauuaauaa uauuacguca uaagaaauau uuacucggcu aucuucggaa 120
auggucgguc agcuacgagc cggcaacugu agcccccacc agccagugag acacuaggau 180
ucgcgggugu cugugucgag accuccuuca guuauaucag guuccugucc uuaaaccaaa 240
agcaaaaugg cggaugauga agcgaagaaa gcaaaacagg ccgagauuga gcggaagagg 300
gcggaggucc gaaagaggau ggaggaggcc ucaagaggca agaaggccaa aaagggcuuc 360
augacgccag acaggaagaa gaaacuccga cuucugcuga ggaagaaagc ugcugaagaa 420
cugaagaaag aacaggagag gaaagcagcg gagagaagga ggaucauuga ggagcgcugu 480
ggaaagauuu gcgauguuga caaugccagu gaagaaaaau ugaagaaaau cugcucugau 540
uaccaccagc gaauuggacg auuggaggau gaaaaauuug acuuggaaua cguuguaaaa 600
aagaaagauu uugagauugc ggaucuuaac agccaaguca augaucuucg uggcaaguuu 660
guuaaaccca ccuugaaaaa gguuuccaag uaugaaaaca aauuugccaa gcuccagaag 720
aaggcugcug aauucaacuu cagaaaucaa cuaaaaguug uaaagaagaa agaguuuacc 780
cuugaagaag aagacaaaga gaaaaaggga ggcauugucg acugguccaa gaaggaugaa 840
aaggcaaagg uagaggcaug aagcgcauga agaaaaaauc aucccuuauu ggauauuuug 900
uccuuauguu guacguccuu guuguuuucu guuauuuaaa accugauacu uuuuuuaucc 960
uguucgcauc auuuauaacu augaaguaag auacaaaguc aagcaugacc cuuuaguucu 1020
uuggaaucca aagcauguua aaaaaaaaau uucuccuuaa aaaaagaaug aaaaucagca 1080
cacccauaaa ugauauuuug uauguaucuu uugucugaaa uauauauaua ugauaaguuu 1140
aaaaaaaaaa aaaaaaaaaa a 1161
<210> 99
<211> 349
<212> RNA
<213>Heroic America stinkbug
<400> 99
gucaacaucg caaaucuuuc cacagcgcuc cucaaugauc cuccuucucu ccgcugcuuu 60
ccucuccugu ucuuucuuca guucuucagc agcuuucuuc cucagcagaa gucggaguuu 120
cuucuuccug ucuggcguca ugaagcccuu uuuggccuuc uugccucuug aggccuccuc 180
cauccucuuu cggaccuccg cccucuuccg cucaaucucg gccuguuuug cuuucuucgc 240
uucaucaucc gccauuuugc uuuugguuua aggacaggaa ccugauauaa cugaaggagg 300
ucucgacaca gacacccgcg aauccuagug ucucacuggc ugguggggg 349
<210> 100
<211> 104
<212> RNA
<213>Heroic America stinkbug
<400> 100
gauccuccuu cucuccgcug cuuuccucuc cuguucuuuc uucaguucuu cagcagcuuu 60
cuuccucagc agaagucgga guuucuucuu ccugucuggc guca 104
<210> 101
<211> 126
<212> RNA
<213>Heroic America stinkbug
<400> 101
gcccuuuuug gccuucuugc cucuugaggc cuccuccauc cucuuucgga ccuccgcccu 60
cuuccgcuca aucucggccu guuuugcuuu cuucgcuuca ucauccgcca uuuugcuuuu 120
gguuua 126
<210> 102
<211> 153
<212> DNA
<213>Artificial sequence
<220>
<223>Exemplary adapter polynucleotides
<400> 102
agtcatcacg ctggagcgca catataggcc ctccatcaga aagtcattgt gtatatctct 60
catagggaac gagctgcttg cgtatttccc ttccgtagtc agagtcatca atcagctgca 120
ccgtgtcgta aagcgggacg ttcgcaagct cgt 153
<210> 103
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The probe oligonucleotides of synthesis
<400> 103
ttcggctgct ttgcgttctt gttc 24

Claims (60)

1. a kind of separated nucleic acid, it includes at least one polynucleotides being operably connected with heterologous promoter, Described in polynucleotides be selected from：
SEQ ID NO：1；SEQ ID NO：1 complementary series；SEQ ID NO：The segment of 1 at least 15 contiguous nucleotides； SEQ ID NO：The complementary series of the segment of 1 at least 15 contiguous nucleotides；The chrysomelid natural coding sequence for belonging to organism, Including SEQ ID NO：7 or SEQ ID NO：Any one of 10；The complementary series of the chrysomelid natural coding sequence for belonging to organism, The natural coding sequence includes SEQ ID NO：7 or SEQ ID NO：Any one of 10；The chrysomelid natural volume for belonging to organism The segment of at least 15 contiguous nucleotides of code sequence, the natural coding sequence include SEQ ID NO：7 or SEQ ID NO： Any one of 10；The complementary series of the segment of at least 15 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism, The natural coding sequence includes SEQ ID NO：7 or SEQ ID NO：Any one of 10；
SEQ ID NO：3；SEQ ID NO：3 complementary series；SEQ ID NO：The segment of 3 at least 15 contiguous nucleotides； SEQ ID NO：The complementary series of the segment of 3 at least 15 contiguous nucleotides；The chrysomelid natural coding sequence for belonging to organism, Including SEQ ID NO：Any one of 8；The complementary series of the chrysomelid natural coding sequence for belonging to organism, the natural code sequence Row include SEQ ID NO：Any one of 8；At least 15 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism Segment, the natural coding sequence include SEQ ID NO：Any one of 8；The chrysomelid natural coding sequence for belonging to organism is extremely The complementary series of the segment of few 15 contiguous nucleotides, the natural coding sequence include SEQ ID NO：Any one of 8；
SEQ ID NO：5；SEQ ID NO：5 complementary series；SEQ ID NO：The segment of 5 at least 15 contiguous nucleotides； SEQ ID NO：The complementary series of the segment of 5 at least 15 contiguous nucleotides；The chrysomelid natural coding sequence for belonging to organism, Including SEQ ID NO：9、SEQ ID NO：11 or SEQ ID NO：12；The complementary sequence of the chrysomelid natural coding sequence for belonging to organism Row, the natural coding sequence include SEQ ID NO：9、SEQ ID NO：11 or SEQ ID NO：12；Chrysomelid category organism The segment of at least 15 contiguous nucleotides of natural coding sequence, the natural coding sequence include SEQ ID NO：9、SEQ ID NO：11 or SEQ ID NO：12；It is chrysomelid belong to organism natural coding sequence at least 15 contiguous nucleotides segment it is mutual Complementary series, the natural coding sequence include SEQ ID NO：9、SEQ ID NO：11 or SEQ ID NO：12；
SEQ ID NO：79；SEQ ID NO：79 complementary series；SEQ ID NO：The piece of 79 at least 15 contiguous nucleotides Section；SEQ ID NO：The complementary series of the segment of 79 at least 15 contiguous nucleotides；The natural coding of America stinkbug category organism Sequence, it includes SEQ ID NO：81、SEQ ID NO：82 or SEQ ID NO：83；The natural code sequence of America stinkbug category organism The complementary series of row, the natural coding sequence include SEQ ID NO：81、SEQ ID NO：82 or SEQ ID NO：83；America The segment of at least 15 contiguous nucleotides of the natural coding sequence of stinkbug category organism, the natural coding sequence include SEQ ID NO：81、SEQ ID NO：82 or SEQ ID NO：83；At least 15 of the natural coding sequence of America stinkbug category organism adjoin core The complementary series of the segment of thuja acid, the natural coding sequence include SEQ ID NO：81、SEQ ID NO：82 or SEQ ID NO：83.
2. polynucleotides according to claim 1, wherein the polynucleotides are selected from：SEQ ID NO：1；SEQ ID NO： 1 complementary series；SEQ ID NO：3；SEQ ID NO：3 complementary series；SEQ ID NO：5；SEQ ID NO：5 complementary sequence Row；SEQ ID NO：The segment of 1 at least 15 contiguous nucleotides；SEQ ID NO：The piece of 1 at least 15 contiguous nucleotides The complementary series of section；SEQ ID NO：The segment of 3 at least 15 contiguous nucleotides；SEQ ID NO：At least 15 of 3 are adjoined The complementary series of the segment of nucleotide；SEQ ID NO：The segment of 5 at least 15 contiguous nucleotides；SEQ ID NO：5 extremely The complementary series of the segment of few 15 contiguous nucleotides；The chrysomelid natural coding sequence for belonging to organism, it includes SEQ ID NO： Any one of 7-12；The complementary series of the chrysomelid natural coding sequence for belonging to organism, the natural coding sequence include SEQ ID NO：Any one of 7-12；The segment of at least 15 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism, institute It includes SEQ ID NO to state natural coding sequence：Any one of 7-12；And the chrysomelid natural coding sequence for belonging to organism is extremely The complementary series of the segment of few 15 contiguous nucleotides, the natural coding sequence include SEQ ID NO：Any in 7-12 Person.
3. polynucleotides according to claim 1, wherein the polynucleotides are selected from：SEQ ID NO：1、SEQ ID NO： 3、SEQ ID NO：5、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：9、SEQ ID NO：10、SEQ ID NO：11、 SEQ ID NO：12 and it is aforementioned in the complementary series of any one.
4. polynucleotides according to claim 3, wherein the organism is selected from：Diabroticavirgifera, Pasteur's root firefly leaf A first, ten star root firefly is chrysomelid, zea mexicana root firefly is chrysomelid, cucumber strip root firefly is chrysomelid, 11 asterophyllite first, South America of cucumber is chrysomelid and D.u.undecimpunctata Mannerheim。
5. a kind of plant conversion carrier, it includes polynucleotides described in claim 1.
6. a kind of ribonucleic acid (RNA) molecule is transcribed from polynucleotides described in claim 1.
7. a kind of double stranded ribonucleic acid molecule is expressed by polynucleotides described in claim 1 and is generated.
8. double stranded ribonucleic acid molecule according to claim 7, wherein the polynucleotide sequence and coleoptera or half wing The expression of the contact inhibition of mesh insect and the endogenous nucleotide sequence of the polynucleotides complementary specificity.
9. double stranded ribonucleic acid molecule according to claim 8, wherein the ribonucleic acid molecule and coleoptera or half The insect is killed in the contact of homopterous insect, or inhibits growth, viability and/or the feed of the insect.
10. double-stranded RNA according to claim 7, it includes the first RNA sections, the 2nd RNA sections and the 3rd RNA sections, The wherein described first RNA sections include the polynucleotides, wherein the third RNA sections are connected by the second polynucleotide sequence The first RNA sections are connected to, and the wherein described third RNA sections are substantially the reverse complemental of the first RNA sections Sequence so that the first RNA sections and the 3rd RNA sections hybridize when being transcribed into ribonucleic acid and form the double-strand RNA。
11. RNA according to claim 6, is selected from：Length is between about 15 nucleotide and about 30 nucleotide Double stranded ribonucleic acid molecule and singlestranded RNA molecule.
12. a kind of plant conversion carrier, it includes polynucleotides described in claim 1, wherein the heterologous promoter exists There is function in plant cell.
13. a kind of cell is converted with polynucleotides described in claim 1.
14. cell according to claim 13, wherein the cell is prokaryotic cell.
15. cell according to claim 13, wherein the cell is eukaryocyte.
16. cell according to claim 15, wherein the cell is plant cell.
17. a kind of plant is converted with polynucleotides described in claim 1.
18. the seed of the plant described in claim 17, wherein the seed includes the polynucleotides.
19. the commodity product(s) that a kind of plant by described in claim 17 generates, wherein the commodity product(s) includes can detected level The polynucleotides.
20. plant according to claim 17, wherein at least one polynucleotides be expressed as in the plant it is double Chain ribonucleic acid molecule.
21. cell according to claim 16, wherein the cell is maize cell.
22. plant according to claim 17, wherein the plant is corn.
23. plant according to claim 17, wherein at least one polynucleotides are expressed as core in the plant Ribosomal ribonucleic acid molecule, and when coleoptera or hemipteran take in a part for the plant, the ribonucleic acid molecule suppression The expression of system and the endogenous polynucleotide of at least one polynucleotides complementary specificity.
Also include at least one additional polynucleotides 24. polynucleotides according to claim 1, it is described additional Polynucleotide encoding inhibits the RNA molecule of endogenous insect gene expression.
25. a kind of plant conversion carrier, it includes the polynucleotides described in claim 24, wherein described one or more additional Polynucleotides respectively with have functional heterologous promoter in plant cell and be operably connected.
26. a kind of method for controlling coleoptera or Hemipteran pest group includes ribonucleic acid the method includes providing (RNA) it is played a role after the medicament of molecule, the ribonucleic acid molecule and the contacting pests to inhibit the life in the pest Object function, wherein the RNA with can specific hybrid selected from following polynucleotides：SEQ ID NO：Any in 89-101 Person；SEQ ID NO：The complementary series of any one of 89-101；SEQ ID NO：At least 15 of any one of 89-101 The segment of contiguous nucleotide；SEQ ID NO：The complementary sequence of the segment of at least 15 contiguous nucleotides of any one of 89-101 Row；SEQ ID NO：1,3, the 5, transcript of any one of 7-12,79 and 81-83；SEQ ID NO：1,3,5,7-12,79 and The complementary series of the transcript of any one of 81-83；SEQ ID NO：1,3,5, any one of 7-12,79 and 81-83 The segment of at least 15 contiguous nucleotides of transcript；And SEQ ID NO：1,3,5, any one of 7-12,79 and 81-83 Transcript at least 15 contiguous nucleotides segment complementary series.
27. according to the method for claim 26, wherein the RNA of the medicament with can be special selected from following polynucleotides Specific hybridization：SEQ ID NO：89-91；SEQ ID NO：The complementary series of 91-93；SEQ ID NO：At least 15 of 89-91 The segment of contiguous nucleotide；SEQ ID NO：The complementary series of the segment of at least 15 contiguous nucleotides of 89-91；SEQ ID NO：1,3 or 5 transcript；SEQ ID NO：1, the complementary series of 3 or 5 transcript；SEQ ID NO：1,3 or 5 transcript At least 15 contiguous nucleotides segment；And SEQ ID NO：1, at least 15 contiguous nucleotides of 3 or 5 transcript The complementary series of segment.
28. according to the method for claim 26, wherein the medicament is double stranded rna molecule.
29. a kind of method for controlling coleopteran pest group, the method includes：
The medicament for including the first polynucleotide sequence and the second polynucleotide sequence, the polynucleotide sequence and the sheath are provided It is played a role after wing mesh contacting pests to inhibit the biological function in the coleopteran pest, wherein the first polynucleotides sequence Row include and SEQ ID NO：About 15 of any one in 89-97 show about 90% to about to about 30 contiguous nucleotides The region of 100% sequence identity, and wherein described first polynucleotide sequence and second polynucleotide sequence are special Property hybridization.
30. a kind of method for controlling Hemipteran pest group, the method includes：
The medicament for including the first polynucleotide sequence and the second polynucleotide sequence, the polynucleotide sequence and described half are provided It is played a role after wing mesh contacting pests to inhibit the biological function in the Hemipteran pest, wherein the first polynucleotides sequence Row include and SEQ ID NO：About 15 of any one in 89-101 show about 90% to about to about 30 contiguous nucleotides The region of 100% sequence identity, and wherein described first polynucleotide sequence and second polynucleotide sequence are special Property hybridization.
31. a kind of method for controlling coleopteran pest group, the method includes：
The inverted plant cell for including the polynucleotides described in claim 2 is provided in the host plant of coleopteran pest, The wherein described polynucleotides are expressed to generate such ribonucleic acid molecule：The ribonucleic acid molecule and belong to the group Coleopteran pest contact after play a role to inhibit the expression of target sequence in the coleopteran pest, and cause the elytrum Mesh pest or pest population are relative to the identical pest on the plant without the polynucleotides of identical host plant species The breeding situation of species, appearance growth slows down and/or survival rate reduces.
32. according to the method for claim 31, wherein the ribonucleic acid molecule is double stranded ribonucleic acid molecule.
33. according to the method for claim 31, wherein the coleopteran pest group is relative to infecting identical host plant The identical pest species group of the host plant of the shortage inverted plant cell of species reduces.
34. according to the method for claim 32, wherein the coleopteran pest group relative to infect same species lack The coleopteran pest group of the host plant of the weary inverted plant cell reduces.
35. a kind of method of coleoptera pestinfestation in control plant, the method includes being carried in the foodstuff of coleopteran pest For ribonucleic acid (RNA), the ribonucleic acid with can specific hybrid selected from following polynucleotides：
SEQ ID NO：89-97；
SEQ ID NO：The complementary series of any one in 89-97；
SEQ ID NO：The segment of at least 15 contiguous nucleotides of any one in 89-97；
SEQ ID NO：The complementary series of the segment of at least 15 contiguous nucleotides of any one in 89-97；
SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：5 transcript；
SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：The complementary series of 5 transcript；
SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：The segment of at least 15 contiguous nucleotides of 5 transcript；With And
SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：The segment of at least 15 contiguous nucleotides of 5 transcript Complementary series.
36. according to the method for claim 35, wherein the foodstuff includes inverted to express the plant of the polynucleotides Object cell.
37. according to the method for claim 35, wherein the specifically hybridized RNA is comprised in double stranded rna molecule In.
38. a kind of method of hemipteran pest infection in control plant, the method includes making Hemipteran pest and ribonucleic acid (RNA) contact, the ribonucleic acid with can specific hybrid selected from following polynucleotides：
SEQ ID NO：98-101；
SEQ ID NO：The complementary series of any one in 98-101；
SEQ ID NO：The segment of at least 15 contiguous nucleotides of any one in 98-101；
SEQ ID NO：The complementary series of the segment of at least 15 contiguous nucleotides of any one in 98-101；
SEQ ID NO：79 transcript；
SEQ ID NO：The complementary series of 79 transcript；
SEQ ID NO：The segment of at least 15 contiguous nucleotides of 79 transcript；And
SEQ ID NO：The complementary series of the segment of at least 15 contiguous nucleotides of 79 transcript.
39. according to the method for claim 38, wherein the Hemipteran pest is made to be contacted with the RNA including with comprising institute State plant described in the composition sprayed of RNA.
40. according to the method for claim 38, wherein the specifically hybridized RNA is comprised in double stranded rna molecule In.
41. a kind of method for improving crop yield, the method includes：
Nucleic acid described in claim 1 is imported in crop plants, to generate transgenic crop plant；And
The crop plants are cultivated, to allow to express at least one polynucleotides；Wherein described at least one polynucleotides Expression inhibiting insect pest breeding or growth, and the production loss caused by being infected due to insect pest,
The wherein described crop plants are corn and soybean or cotton.
42. according to the method for claim 41, wherein the expression of at least one polynucleotides generates RNA molecule, institute It states RNA molecule and at least inhibits to have contacted the first target gene in the insect pest of a part for the crop plants.
43. according to the method for claim 41, wherein the polynucleotides are selected from：SEQ ID NO：1、SEQ ID NO：3、 SEQ ID NO：5、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：9、SEQ ID NO：10、SEQ ID NO：11、SEQ ID NO：12 and it is aforementioned in the complementary series of any one.
44. according to the method for claim 43, wherein the expression of at least one polynucleotides generates RNA molecule, institute It states RNA molecule and at least inhibits to have contacted the first target gene in the coleopteran insect pests of a part for the corn plant.
45. a kind of method for generating transgenic plant cells, the method includes：
Plant cell is converted with the carrier comprising nucleic acid described in claim 1；
Under conditions of being enough to allow the plant cell cultures development comprising multiple inverted plant cells, cultivate described through turning Change plant cell；
At least one polynucleotides have been integrated into the inverted plant cell in its genome by selection；
For the expression of ribonucleic acid (RNA) molecule by least one polynucleotide encoding, the inverted plant is screened Object cell；And
The plant cell of the RNA is expressed in selection.
46. according to the method for claim 45, wherein the carrier includes to be selected from following polynucleotides：SEQ ID NO： 1；SEQ ID NO：1 complementary series；SEQ ID NO：3；SEQ ID NO：3 complementary series；SEQ ID NO：5；SEQ ID NO：5 complementary series；SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：The piece of 5 at least 15 contiguous nucleotides Section；SEQ ID NO：1、SEQ ID NO：3 or SEQ ID NO：The complementary series of the segment of 5 at least 15 contiguous nucleotides； The chrysomelid natural coding sequence for belonging to organism, it includes SEQ ID NO：Any one of 7-12；It is chrysomelid to belong to the natural of organism The complementary series of coded sequence, the natural coding sequence include SEQ ID NO：Any one of 7-12；Chrysomelid category organism Natural coding sequence at least 15 contiguous nucleotides segment, the natural coding sequence include SEQ ID NO：In 7-12 Any one；And the complementary series of the segment of at least 15 contiguous nucleotides of the chrysomelid natural coding sequence for belonging to organism, The natural coding sequence includes SEQ ID NO：Any one of 7-12.
47. according to the method for claim 45, wherein the RNA molecule is double stranded rna molecule.
48. a kind of method for generating the genetically modified plants damaged from coleopteran pest, the method includes：
Transgenic plant cells by generating according to the method for claim 46 are provided；And
From the transgenic plant cells regenerating plants, wherein by the core of at least one polynucleotide encoding The expression of ribosomal ribonucleic acid molecule is enough to regulate and control the expression of the target gene in the coleopteran pest of the contact inverted plant.
49. a kind of method for generating transgenic plant cells, the method includes：
Plant cell is converted with comprising the carrier for providing the component that coleopteran pest protects to plant；
Under conditions of being enough to allow the plant cell cultures development comprising multiple inverted plant cells, cultivate described through turning Change plant cell；
Selection will be for providing the inverted plant that the component that coleopteran pest protects is integrated into its genome to plant Object cell；
For the expression for inhibiting component that the indispensable gene in coleopteran pest expresses, it is thin to screen the inverted plant Born of the same parents；And
The plant cell of the component for inhibiting the indispensable gene in coleopteran pest to express is expressed in selection.
50. a kind of method for generating the genetically modified plants damaged from coleopteran pest, the method includes：
The transgenic plant cells generated by the method described in claim 49 are provided；And
From the transgenic plant cells regenerating plants, wherein for inhibiting the indispensable gene in coleopteran pest to express The expression of the component be enough to regulate and control the expression of the target gene in the coleopteran pest of the contact inverted plant.
51. a kind of method for generating transgenic plant cells, the method includes：
Plant cell is converted with comprising the carrier for providing the component that Hemipteran pest protects to plant；
Under conditions of being enough to allow the plant cell cultures development comprising multiple inverted plant cells, cultivate described through turning Change plant cell；
Selection will be for providing the inverted plant that the component that Hemipteran pest protects is integrated into its genome to plant Object cell；
For the expression for inhibiting component that the indispensable gene in Hemipteran pest expresses, it is thin to screen the inverted plant Born of the same parents；And
The plant cell of the component for inhibiting the indispensable gene in Hemipteran pest to express is expressed in selection.
52. a kind of method for generating the genetically modified plants damaged from Hemipteran pest, the method includes：
The transgenic plant cells generated by the method described in claim 51 are provided；And
From the transgenic plant cells regenerating plants, wherein for inhibiting the indispensable gene in Hemipteran pest to express The expression of the component be enough to regulate and control the expression of the target gene in the Hemipteran pest of the contact inverted plant.
53. nucleic acid according to claim 1, also includes polynucleotides, the polynucleotide encoding comes from Su Yun gold buds The polypeptide or PIP-1 polypeptides of spore bacillus.
54. nucleic acid according to claim 53, wherein the polynucleotide encoding being selected from from bacillus thuringiensis The polypeptide of Cry3, Cry34 and Cry35.
55. cell according to claim 16, wherein the cell includes polynucleotides, the polynucleotide encoding comes from The polypeptide or PIP-1 polypeptides of bacillus thuringiensis.
56. cell according to claim 55, wherein the polynucleotide encoding being selected from from bacillus thuringiensis The polypeptide of Cry3, Cry34 and Cry35.
57. plant according to claim 17, wherein the plant includes polynucleotides, the polynucleotide encoding comes from The polypeptide or PIP-1 polypeptides of bacillus thuringiensis.
58. plant according to claim 57, wherein the polynucleotide encoding being selected from from bacillus thuringiensis The polypeptide of Cry3, Cry34 and Cry35.
59. according to the method for claim 45, wherein the inverted plant cell includes polynucleotides, the multinuclear glycosides Polypeptide or PIP-1 polypeptide of the acid encoding from bacillus thuringiensis.
60. method according to claim 59, wherein the polynucleotide encoding being selected from from bacillus thuringiensis The polypeptide of Cry3, Cry34 and Cry35.
CN201680059496.7A 2015-10-12 2016-10-04 Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest Pending CN108431207A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201562240227P 2015-10-12 2015-10-12
US62/240,227 2015-10-12
PCT/US2016/055300 WO2017066041A2 (en) 2015-10-12 2016-10-04 Wupa nucleic acid molecules that confer resistance to coleopteran and hemipteran pests

Publications (1)

Publication Number Publication Date
CN108431207A true CN108431207A (en) 2018-08-21

Family

ID=58498818

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201680059496.7A Pending CN108431207A (en) 2015-10-12 2016-10-04 Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest

Country Status (10)

Country Link
US (1) US10344298B2 (en)
EP (1) EP3362552A4 (en)
CN (1) CN108431207A (en)
AR (1) AR106320A1 (en)
AU (1) AU2016337355B2 (en)
BR (1) BR102016023726A2 (en)
CA (1) CA3001162A1 (en)
TW (1) TW201720838A (en)
UY (1) UY36941A (en)
WO (1) WO2017066041A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR109205A1 (en) * 2016-08-05 2018-11-07 Syngenta Participations Ag PATHOPE CONTROL OF COLEOPTERS USING RNA MOLECULES

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110154545A1 (en) * 2001-07-24 2011-06-23 Andersen Scott E Nucleic acid sequences from diabrotica virgifera virgifera leconte and uses thereof
US20120164205A1 (en) * 2004-04-09 2012-06-28 Baum James A Compositions and methods for control of insect infestations in plants
CN103403164A (en) * 2010-12-30 2013-11-20 陶氏益农公司 Nucleic acid molecules that target the rho1 small gtp-binding protein and confer resistance to coleopteran pests

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5453566A (en) 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
AU4770093A (en) 1992-07-02 1994-01-31 Hybridon, Inc. Self-stabilized oligonucleotides as therapeutic agents
DE19631919C2 (en) 1996-08-07 1998-07-16 Deutsches Krebsforsch Anti-sense RNA with secondary structure
US7109393B2 (en) 2000-08-15 2006-09-19 Mendel Biotechnology, Inc. Methods of gene silencing using inverted repeat sequences
US20020048814A1 (en) 2000-08-15 2002-04-25 Dna Plant Technology Corporation Methods of gene silencing using poly-dT sequences
US7426350B1 (en) * 2001-10-26 2008-09-16 Cisco Technology, Inc. Hybrid optical and electrical fiber optic link linearizer
EP2281876A3 (en) 2005-09-16 2012-04-11 deVGen N.V. Methods for controlling pests using RNAi
EP3508582B1 (en) 2005-09-16 2021-01-13 Monsanto Technology LLC Methods for genetic control of insect infestations in plants and compositions thereof
US20090285784A1 (en) * 2006-01-12 2009-11-19 Devgen Nv DSRNA As Insect Control Agent
US8906876B2 (en) 2006-01-12 2014-12-09 Devgen Nv Methods for controlling pests using RNAi
US8609936B2 (en) 2007-04-27 2013-12-17 Monsanto Technology Llc Hemipteran-and coleopteran active toxin proteins from Bacillus thuringiensis
US9051569B2 (en) 2009-06-05 2015-06-09 National University Corporation Nagoya University Insect pest control method
MX351822B (en) 2009-08-28 2017-10-30 Du Pont Compositions and methods to control insect pests.
KR101363554B1 (en) 2009-12-04 2014-02-18 가부시키가이샤 무라타 세이사쿠쇼 Piezoelectric micro-blower
JP2011119519A (en) 2009-12-04 2011-06-16 Showa Denko Kk Semiconductor light emitting element and semiconductor light emitting device
CN102665626B (en) 2009-12-04 2014-07-23 花王株式会社 Method and device for manufacturing absorption body
JP2013038089A (en) 2009-12-04 2013-02-21 Jsr Corp Laminated body for solar cell module
US8530440B2 (en) 2010-05-03 2013-09-10 Board Of Regents Of The University Of Nebraska dsRNA delivery composition and methods of use
CA2799453A1 (en) 2010-06-04 2011-12-08 Pioneer Hi-Bred International, Inc. Compositions and methods for insecticidal control of stinkbugs
CN103403162A (en) 2010-12-30 2013-11-20 陶氏益农公司 Nucleic acid molecules that confer resistance to coleopteran pests
AU2012245134B2 (en) * 2011-04-20 2017-01-19 Devgen Nv Down-regulating gene expression in insect pests
EP2734623B1 (en) * 2011-07-18 2018-04-04 Devgen NV Plants resistant to insect pests
AR095275A1 (en) 2013-03-13 2015-09-30 E I Dupont De Nemours & Company COMPOSITIONS AND METHODS FOR INSECTICIDE CONTROL OF BUGS
US20160230186A1 (en) * 2013-03-14 2016-08-11 Monsanto Technology Llc Compositions and methods for controlling diabrotica
US9943703B2 (en) * 2014-07-28 2018-04-17 The University Of Maryland, Baltimore System and method for irradiation therapy using voxel based functional measurements of organs at risk

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110154545A1 (en) * 2001-07-24 2011-06-23 Andersen Scott E Nucleic acid sequences from diabrotica virgifera virgifera leconte and uses thereof
US20120164205A1 (en) * 2004-04-09 2012-06-28 Baum James A Compositions and methods for control of insect infestations in plants
CN102524294A (en) * 2004-04-09 2012-07-04 孟山都技术有限公司 Compositions and methods for control of insect infestations in plants
CN103403164A (en) * 2010-12-30 2013-11-20 陶氏益农公司 Nucleic acid molecules that target the rho1 small gtp-binding protein and confer resistance to coleopteran pests

Also Published As

Publication number Publication date
AU2016337355A1 (en) 2018-04-26
US20170101651A1 (en) 2017-04-13
AU2016337355B2 (en) 2019-09-26
BR102016023726A2 (en) 2017-05-02
US10344298B2 (en) 2019-07-09
WO2017066041A2 (en) 2017-04-20
CA3001162A1 (en) 2017-04-20
EP3362552A4 (en) 2019-04-24
WO2017066041A3 (en) 2017-05-26
UY36941A (en) 2017-05-31
AR106320A1 (en) 2018-01-03
EP3362552A2 (en) 2018-08-22
TW201720838A (en) 2017-06-16

Similar Documents

Publication Publication Date Title
US20210403939A1 (en) Copi coatomer gamma subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20200224215A1 (en) Copi coatomer delta subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20200224214A1 (en) Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20180251779A1 (en) Copi coatomer beta subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CN106028796A (en) Ras opposite (rop) and related nucleic acid molecules that confer resistance to coleopteran and/or hemipteran pests
CN106471123A (en) Give the SEC23 nucleic acid molecules of coleoptera and Hemipteran pest resistance
CN107208098A (en) For controlling coleopteran pest chromatin remodeling gene parental generation RNAI to suppress
CN107278228A (en) The parental generation RNAi of HUNCHBACK genes for controlling Hemipteran pest suppresses
CN107532170A (en) Control the nucleic acid molecules of rna plymerase ii 33 of insect pest
CN106028838A (en) Rnapii-140 nucleic acid molecules that confer resistance to coleopteran pests
CN107208097A (en) For controlling coleopteran pest KRUPPEL gene parental generations RNAI to suppress
CN107532167A (en) Control the nucleic acid molecules of rna plymerase ii 215 of insect pest
CN107849580A (en) Control the PRP8 nucleic acid molecules of insect pest
CN108431207A (en) Assign the WUPA nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
CN107109412A (en) For controlling coleopteran pest HUNCHBACK gene parental generations RNAI to suppress
CN108350413A (en) Assign the RAB5 nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
CN107912048A (en) Control the SPT5 nucleic acid molecules of insect pest
CN107683088A (en) Assign the THREAD nucleic acid to the patience of Hemipteran pest
CN108884469A (en) For controlling the SHIBIRE/ dynamin nucleic acid molecules of coleopteran pest and Hemipteran pest
US20160186203A1 (en) Gho/sec24b2 and sec24b1 nucleic acid molecules to control coleopteran and hemipteran pests
CN107949639A (en) Control the SNAP25 nucleic acid molecules of insect pest
CN108366540A (en) Assign ribosomal protein L 40 (RPL40) nucleic acid molecules to the resistance of coleoptera and Hemipteran pest
US20190308702A1 (en) Ribosomal protein l40 (rpl40) nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CN107406850A (en) The parental generation RNAi of KRUPPEL genes for controlling Hemipteran pest suppresses
CN108064296A (en) Control the SPT6 nucleic acid molecules of insect pest

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180821