CN110922974B - Application of mucor circinelloides in degradation of lambda-cyhalothrin - Google Patents
Application of mucor circinelloides in degradation of lambda-cyhalothrin Download PDFInfo
- Publication number
- CN110922974B CN110922974B CN201910382930.0A CN201910382930A CN110922974B CN 110922974 B CN110922974 B CN 110922974B CN 201910382930 A CN201910382930 A CN 201910382930A CN 110922974 B CN110922974 B CN 110922974B
- Authority
- CN
- China
- Prior art keywords
- cyhalothrin
- mucor circinelloides
- culture medium
- degradation
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K17/00—Soil-conditioning materials or soil-stabilising materials
- C09K17/14—Soil-conditioning materials or soil-stabilising materials containing organic compounds only
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
- B09C1/105—Reclamation of contaminated soil microbiologically, biologically or by using enzymes using fungi or plants
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/04—Pesticides, e.g. insecticides, herbicides, fungicides or nematocides
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C2101/00—In situ
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Mycology (AREA)
- Soil Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- General Chemical & Material Sciences (AREA)
- Business, Economics & Management (AREA)
- Emergency Management (AREA)
- Botany (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Environmental & Geological Engineering (AREA)
- General Life Sciences & Earth Sciences (AREA)
- Materials Engineering (AREA)
- Organic Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an application of Mucor circinelloides in degradation of lambda-cyhalothrin, which aims at solving the technical problem that the application of Mucor circinelloides in degradation of lambda-cyhalothrin is not recorded in the prior art. The separated Mucor circinelloides (Mucor circinelloides) is selected to prepare liquid seeds, the separation culture medium is prepared by adding efficient cyhalothrin mother liquor under the aseptic condition, the culture is enlarged, the degradation fermentation temperature is 30 ℃, the rotation speed is not lower than 120rpm, and the fermentation culture is carried out for 3-5 days, so that the strain has the characteristics of high efficient cyhalothrin degradation, simple culture condition and quick propagation, the degradation rate of the efficient cyhalothrin is 79.7%, the pesticide residue is decomposed by utilizing the degradation capacity of the efficient cyhalothrin of the strain, and the strain has wide application value in the technical field of microbial strain application.
Description
Technical Field
The invention relates to the technical field of microorganisms and application thereof, in particular to the technical field of application of mucor circinelloides for degrading efficient cyhalothrin.
Background
Beta-cypermethrin is one of synthetic pyrethroid pesticides, can be accumulated in human body, and has toxicity to nervous, immune, cardiovascular and reproductive endocrine systems. Because the pesticide composition is widely applied to pest control of fruits, vegetables, tea trees, human and animal sanitation and the like, a large amount of pesticide composition is remained in vegetables, tea leaves and aquatic products, production and processing of agricultural and sideline products are seriously threatened, and sustainable development of modern agriculture in China is influenced. Such pesticides, which are currently the most promising insecticides, will be widely used in the coming decades before new alternatives have not been found, and thus, there is an urgent need to study the degradation of such pesticides.
Microbial degradation is a good method of choice for eliminating the contamination of harmful compounds. The microbial degradation pesticide is approved in bioremediation of polluted soil and water bodies due to the advantages of simple operation, thorough degradation, no secondary pollution and the like, and has good application prospect on food polluted by the pesticide. However, at present, the research on the microbial degradation of organophosphorus and organochlorine pesticides is more, and the research on pyrethroid pesticides is not much developed. As for cypermethrin degrading bacteria, only a few strains which have the effect of degrading or transforming cypermethrin, such as pseudomonas and enterobacter, are screened, the degrading rate of the strains on the cypermethrin is about 50 percent (43.75 to 56.90 percent), and the non-toxic probiotics are rarely reported.
Along with the love and demand of people on 'organic' food and nuisanceless agricultural products, the microbial degradation efficient cyhalothrin pesticide can reduce the residue of the pesticide in agricultural and sideline products and the pollution to the ecological environment of farmlands in the aspect of preventing and treating diseases and insect pests of crops in the future, and has huge market demand. Therefore, the development, industrialization, popularization and application processes of the microbial degradation of the efficient cyhalothrin pesticide are further accelerated, the pesticide residue in agricultural and sideline products and the pollution to the ecological environment of farmlands can be reduced, the important requirement of the industrialization of nuisanceless agricultural products in China is met, and great social, economic and ecological benefits are certainly generated.
Disclosure of Invention
Aiming at the technical situation that the application of Mucor circinelloides in the field of Mucor circinelloides for degrading high-efficiency cyhalothrin is not recorded in the prior art and the advantages of microbial degradation of the high-efficiency cyhalothrin are increasingly urgent, the invention aims to provide a strain with practical effect and stable fermentation performance for the technology of microbial degradation of the high-efficiency cyhalothrin and the application of the Mucor circinelloides in degradation of the high-efficiency cyhalothrin. The Mucor circinelloides is separated and screened from cotton straws, the strain is known to be common Mucor circinelloides through classification and systematic identification analysis, efficient cyhalothrin can be degraded by using the Mucor circinelloides, and the strain has wide application value in the technical field of microbial strain application by using the pesticide degradation characteristic of the strain.
The invention provides an application of Mucor circinelloides in degrading high-efficiency cyhalothrin, which selects and separates Mucor circinelloides to prepare liquid seeds, prepares a separation culture medium by adding high-efficiency cyhalothrin mother liquor under the aseptic condition, and performs amplification culture, wherein the degradation fermentation temperature is 30 ℃, and the rotation speed is not lower than 120rpm, and the fermentation culture lasts for 3-5 days.
The invention specifically provides an application of Mucor circinelloides in degradation of efficient cyhalothrin, which comprises the following specific steps:
(1) strain culture: inoculating Mucor circinelloides (Mucor circinelloides) strain in liquid PDA culture medium, culturing in a shaker at 30 deg.C and 120rpm for 3-5 days to stationary phase, wherein the thallus concentration contains 15g dry thallus per liter;
(2) preparing liquid seeds: taking the bacterial liquid cultured in the step (1), performing centrifugal separation at room temperature, discarding supernatant, precipitating, fully suspending with sterile water, centrifuging again, repeating the step for multiple times, and suspending the precipitate with sterile water to prepare liquid seeds;
(3) degrading the efficient cyhalothrin: and (3) selecting a liquid separation culture medium, inoculating the liquid seeds prepared in the step (2) under an aseptic condition, culturing for 7 days at the temperature of 30 ℃ and the rotating speed of 120rpm, and repeatedly performing the degradation step.
The invention provides a preparation method of a liquid separation culture medium, which comprises the following steps: sterilizing at 121 ℃ for 20 minutes in a basic culture medium, cooling the culture medium to 50 ℃, adding efficient cyhalothrin mother liquor to a final concentration of 500mg/L under aseptic conditions, and simultaneously adding ampicillin to a final concentration of 100mg/L to prepare a liquid separation culture medium, namely the fungus separation culture medium.
The invention provides a preparation method of efficient cyhalothrin mother liquor, which comprises the steps of dissolving Tween80 and efficient cyhalothrin according to the mass ratio of 1:1, adding deionized water to a constant volume of 1L, and enabling the concentration to reach 50mg/ml, thus obtaining the efficient cyhalothrin mother liquor.
The invention provides a basic culture medium which is (NH)4)2SO42g，MgSO4·7H2O 0.2g，NaH2PO4·H2O 0.5g，CaCl2·2H2O 0.1g，K2HPO40.5g of agar, 15g of agar, 800.2g of Twen and 0.2g of lambda-cyhalothrin, and distilled water is added to the mixture until the volume is 1.0L and the pH value is 7.0.
The PDA culture medium selected in the invention: 200g of potato, 20g of glucose, 15-20 g of agar and distilled water until the volume is 1.0L.
In the invention, the rotating speed of the shaking table is 120 rpm.
In the invention, the concentration of the efficient cyhalothrin in the separation culture medium is 500mg/L, and the concentration of the ampicillin is 100 mg/L.
Further, the Mucor circinelloides (Mucor circinelloides) CSGW1 provided by the invention is used for culturing, separating and screening strains from cotton straws to obtain a batch of bacteria, separating and screening the Mucor circinelloides (Mucor circinelloides) with the number of CSGW1, and performing 16SrDNA sequence analysis, phylogenetic analysis and microbiological characteristic analysis on the bacteria to obtain the CSGW1 strain belonging to the Mucor circinelloides (Mucor circinelloides), sequencing genes of the strain to obtain a sequence, performing comparison analysis on the sequence on an NCBI website, and finding that the homology between the 16S rRNA gene sequence of the strain CSGW1 and the Mucor circinelloides is 100.0% at most and is the same strain. As can be seen, the CSGW1 strain adopted by the invention belongs to common Mucor circinelloides, and the public can purchase and implement the invention through a well-known strain preservation unit or other public channels.
Furthermore, the application of the Mucor circinelloides in degrading the efficient cyhalothrin provided by the invention is not limited to the application of the provided CSGW1 strain, and the application of the Mucor circinelloides in degrading the efficient cyhalothrin can obtain the remarkable technical effect of degrading the efficient cyhalothrin, so that the application of the Mucor circinelloides and the research and application of degrading the efficient cyhalothrin by the Mucor circinelloides have important values.
By implementing the specific technical scheme provided by the invention, the following beneficial effects can be achieved by implementing the content of the invention:
(1) the application of the Mucor circinelloides in degrading the high-efficiency cyhalothrin, provided by the invention, has the characteristics that the adopted strain Mucor circinelloides has higher characteristics of degrading the high-efficiency cyhalothrin, and simultaneously has the characteristics of simple culture conditions and quick propagation.
(2) The application of the Mucor circinelloides in degrading the high-efficiency cyhalothrin provided by the invention has the advantages that the separated strains can be used for decomposing the high-efficiency cyhalothrin, when the culture temperature is 30 ℃, the seed culture solution is prepared after the seed culture solution is cultured in a shaking table with the rotating speed of 120rpm for 3-5 days, the degradation rate of the high-efficiency cyhalothrin is 79.7%, the degradation capacity of the high-efficiency cyhalothrin of the strain is used for degrading residual pesticides, and the application value of the strain in the technical field of microbial strain application is wide.
Drawings
FIG. 1 shows a standard curve of lambda-cyhalothrin.
FIG. 2 shows the chromatogram of the detection liquid phase of lambda-cyhalothrin.
Detailed Description
The present invention will be described below by way of examples, but the present invention is not limited to the following examples. All raw and auxiliary materials selected for use in the present invention, as well as methods for culturing the selected bacterial species, are well known and used in the art, and all percentages referred to herein are by weight unless otherwise indicated.
The following basic culture media are adopted in the embodiment of the invention: (NH)4)2SO42g，MgSO4·7H2O 0.2g，NaH2PO4·H2O 0.5g，CaCl2·2H2O 0.1g，K2HPO40.5g of agar, 15g of agar, 800.2g of Twen, 0.2g of lambda-cyhalothrin, 1.0L of distilled water and 7.0 of pH value; PDA culture medium: 200g of potato, 20g of glucose, 15-20 g of agar and distilled water until the volume is 1.0L. DNA extraction kit: beijing Ding Guoshang Biotechnology Limited liability company. Liquid chromatograph: agilent 1260HPLC, USA.
The first embodiment is as follows: isolation of Mucor circinelloides
1. Separating a culture medium:
basal medium (per liter): (NH)4)2SO42g，MgSO4·7H2O 0.2g，NaH2PO4·H2O 0.5g，CaCl2·2H2O 0.1g，K2HPO40.5g agar 15g, pH7.0
Separating a culture medium: sterilizing the basic culture medium at 121 ℃ for 20min, cooling the culture medium to about 50 ℃, adding the efficient cyhalothrin mother liquor to a final concentration of 500mg/L under aseptic conditions, and simultaneously adding ampicillin to a final concentration of 100mg/L, thereby obtaining the fungus separation culture medium.
2. The separation method comprises the following steps: collecting 5g cotton stalk pulverized to about 1cm, adding 50mL sterile water, placing on a shaker, shaking at 25 deg.C and 100rpm for 30min, filtering the mixed solution with a layer of sterile gauze under aseptic condition, discarding the residue, centrifuging the filtrate at room temperature and 4000rmp for 1min, discarding the supernatant, suspending the precipitate with 5mL sterile water, further diluting with sterile water in gradient, and diluting from 10-6、10-7、10-8200 mul of bacterial liquid in each of the three dilutions was spread on a separate template and cultured in an incubator at 30 ℃ for 5 days. Single colonies were picked from the plates and inoculated into fresh isolation plates for purificationAnd (4) transforming until a single colony grows.
Example two: and (3) separating and identifying mucor circinelloides:
1. sequencing and analysis of Mucor circinelloides (CSGW 116S rDNA):
(1) extraction of PCR template DNA
Inoculating Mucor circinelloides (Mucor circinelloides) CSGW1 in a PDA liquid culture medium, culturing at 30 ℃ for 72h to obtain thallus cells, and extracting genome DNA by adopting a novel plant genome DNA rapid extraction kit.
(2) PCR amplification
Primer:
ITS1：5'-TCCGTAGGTGAACCTGCGG-3'；
ITS4：5'-TCCTCCGCTTATTGATATGC-3'。
reaction system:
the PCR amplification conditions were: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 50s, and 35 cycles; extension 72 ℃ for 10 min.
(3) Sequence determination
And sequencing the PCR amplification product after electrophoresis detection and purification, wherein the sequence of the PCR amplification product is shown as SEQ ID NO: 1 is shown. The obtained sequence is subjected to comparison analysis on NCBI websites, and the comparison analysis shows that the homology of the 16S rRNA gene sequence of the strain CSGW1 and the Mucor circinelloides is 100.0 percent at most, and the strain CSGW1 and the Mucor circinelloides have the closest genetic relationship and are the same strain. As can be seen, the CSGW1 strain adopted by the invention belongs to common Mucor circinelloides, and the public can purchase and implement the invention through a well-known strain preservation unit or other public channels.
Example three: mucor circinelloides degradation of lambda-cyhalothrin test
1. Seed liquid preparation
(1) Strain culture: inoculating separated strain Mucor circinelloides (CSGW 1) in liquid PDA culture medium, culturing in shaking table at 30 deg.C and 120rpm for 3-5 days to stationary phase, wherein the thallus concentration is about 15g dry thallus per liter;
(2) preparing liquid seeds: taking the bacterial liquid cultured in the step (1), performing centrifugal separation at room temperature, discarding supernatant, precipitating, fully suspending with sterile water, centrifuging again, repeating the step for multiple times, and suspending the precipitate with sterile water to prepare liquid seeds;
2. degrading the efficient cyhalothrin: and (3) selecting a liquid separation culture medium, inoculating the liquid seeds prepared in the step (2) under an aseptic condition, culturing for 7 days at the temperature of 30 ℃ and the rotating speed of 120rpm, and repeatedly performing the degradation step.
The invention provides a preparation method of a liquid separation culture medium, which comprises the following steps: sterilizing at 121 ℃ for 20 minutes in a basic culture medium, cooling the culture medium to 50 ℃, adding efficient cyhalothrin mother liquor to a final concentration of 500mg/L under aseptic conditions, and simultaneously adding ampicillin to a final concentration of 100mg/L to prepare a liquid separation culture medium, namely the fungus separation culture medium.
The invention provides a preparation method of efficient cyhalothrin mother liquor, which comprises the steps of dissolving Tween80 and efficient cyhalothrin according to the mass ratio of 1:1, adding deionized water to a constant volume of 1L, and enabling the concentration to reach 50mg/ml, thus obtaining the efficient cyhalothrin mother liquor.
The basic culture medium selected by the invention is (NH)4)2SO42g，MgSO4·7H2O 0.2g，NaH2PO4·H2O 0.5g，CaCl2·2H2O 0.1g，K2HPO40.5g of agar, 15g of agar, 800.2g of Twen and 0.2g of lambda-cyhalothrin, and distilled water is added to the mixture until the volume is 1.0L and the pH value is 7.0.
The PDA culture medium selected in the invention: 200g of potato, 20g of glucose, 15-20 g of agar and distilled water until the volume is 1.0L.
In the invention, the rotating speed of the shaking table is 120 rpm.
In the invention, the concentration of the efficient cyhalothrin in the separation culture medium is 500mg/L, and the concentration of the ampicillin is 100 mg/L.
3. Determining the content of the high-efficiency cyhalothrin by liquid chromatography:
(1) preparation of a standard curve: accurately weighing 0.50g of lambda-cyhalothrin standard sample (accurate to 0.0002g), placing the standard sample in a 50mL volumetric flask, shaking and dissolving the standard sample by using 5.0mL of trichloromethane, and then diluting the standard sample to a scale by using normal hexane, wherein the concentration of the solution is 10 mg/mL. 0.1mg/mL, 0.5mg/mL, 1mg/mL, 2mg/mL and 3mg/mL of the high-efficiency cyhalothrin series standard solution is prepared by the solution respectively, and the solution is filtered by a 0.45 mu m membrane for standby.
(2) Preparation of a measurement sample:
a. preparing a fermentation liquid sample: 1mL of the fermentation liquid was weighed into a 50mL volumetric flask, and n-hexane was added to 50mL and shaken for 20 min. Centrifuging at 4000r/min for 5min, standing for 5min, collecting supernatant, filtering with 0.22 μm microporous membrane, and subjecting to liquid chromatography.
b. Preparing a fermentation thallus sample: after all the thalli in the fermentation liquor are picked out by an inoculating loop under the aseptic condition, the thalli are washed by sterile water for 2-3 times, centrifuged for 2min at 8000rpm, supernatant is sucked off, the thalli are placed in a mortar, liquid nitrogen is added and ground into powder, and the extraction and the determination of the high-efficiency cyhalothrin are carried out by the same method.
(3) Conditions of analysis
A chromatographic column: an Agilent ZORBAX SB-C18 chromatography column (4.6 x 150mm, 5 μm); a detector: VWD (ultraviolet detector); mobile phase: Acetonitrile/H2O ═ 80/20 (Acetonitrile/water) flow rate 1 mL/min; the column temperature is room temperature; the injection volume was 10. mu.L.
4. Measurement results
(1) Drawing of standard curve
Accurately transferring the reference substance stock solutions, diluting with anhydrous ethanol to obtain high-efficiency cyhalothrin standard solutions with serial concentrations, performing liquid chromatography on the standard solutions, measuring peak areas of the components, and performing line analysis according to mass concentrations corresponding to the peak areas of the standard solutionsPerforming sexual regression analysis to obtain standard curve regression equation of Area 23.126 Amt-18.128, R20.9936. The standard curve is shown in figure 1.
(2) Determination of samples
The fermentation liquid after 7 days of culture was prepared, and the fermentation liquid treatment sample and the cell treatment sample were measured under the same chromatographic conditions, and the obtained results are shown in table 1.
Table 1: degradation of lambda-cyhalothrin by mucor circinelloides
The liquid chromatogram of the high-efficiency cyhalothrin detection is shown in figure 2, after statistical analysis, the average value of the content of the high-efficiency cyhalothrin in the sample before fermentation is 2009.175 mug/mL, the average value of the content of the high-efficiency cyhalothrin in the fermentation broth cultured for 7 days is 407.639 mug/mL, and the degradation rate of the high-efficiency cyhalothrin in the fermentation broth is 79.7 percent; no high-efficiency cyhalothrin was detected in the cells.
The tests show that the Mucor circinelloides has obvious capacity of degrading the high-efficiency cyhalothrin by separating and screening a strain of Mucor circinelloides from cotton straws, the separated strains are used for degrading the high-efficiency cyhalothrin, when the culture temperature is 30 ℃, the culture liquid is cultured for 3-5 days at the rotating speed of 120rpm to prepare the seed culture liquid, the degradation rate of the high-efficiency cyhalothrin is about 79.7%, and the high-efficiency cyhalothrin degradation capacity of the strain is used for degrading pesticides, so that the strain has wide application value in the technical field of microbial strain application.
The above examples are merely illustrative for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications can be made while remaining within the scope of the present invention.
Mucor circinelloides (Mucor circinelloides) ITS sequence
aatcaataattttggcttgtccattattatctatttactgtgaaatgtattattacttgacgcttgagggatgctccactgctataaggataggcggtggggatgctaaccgagtcataatcaagcttaggcttggtatcctattattatttaccaaaagaattcagaattaatattgtaacatagacctaaaaaatctataaaacaacttttaacaacggatctcttggttctcgcatcgatgaagaacgtagcaaagtgcgataactaatgtgaattgcatattcagtgaatcatcgagtctttgaacgcaacttgcgctcattggtattccaatgagcacgcctgtttcagtatcaaaacaaaccctctatccaacattttgttgaataggaatactgagagtctcttgatctattctgatctcgaacctcttgaaatgtacaaaggcctgatcttgtttgaatgcctgaacttttttttaatataaagagaagctcttgcggtaaactgtgctggggcctcccaaataatactttttttaaatttgatctgaaatcaggcgg
Claims (3)
1. A preparation method of a composition containing Mucor circinelloidesMucor circinelloides) The application of the cyhalothrin in degradation is characterized by comprising the following specific application steps:
(1) strain culture: inoculating Mucor circinelloides (Mucor circinelloides) strain in liquid PDA culture medium, culturing in a shaker at 30 deg.C and 120rpm for 3-5 days to stationary phase, wherein the thallus concentration contains 15g dry thallus per liter, and the PDA culture medium is: 200g of potatoes, 20g of glucose, 15-20 g of agar and 1.0L of distilled water;
(2) preparing liquid seeds: taking the bacterial liquid cultured in the step (1), performing centrifugal separation at room temperature, discarding supernatant, precipitating, fully suspending with sterile water, centrifuging again, repeating the step for multiple times, and suspending the precipitate with sterile water to prepare liquid seeds;
(3) degrading the efficient cyhalothrin: selecting a liquid separation culture medium, inoculating the liquid seeds prepared in the step (2) under an aseptic condition, culturing for 7 days at the temperature of 30 ℃ and the rotating speed of 120rpm, and repeatedly performing the degradation step; wherein, the liquid separation culture medium is prepared by sterilizing a basic culture medium at 121 ℃ for 20 minutes, cooling the culture medium to 50 ℃, adding lambda-cyhalothrin mother liquor to a final concentration of 500mg/L under aseptic conditions, and simultaneously adding ampicillin to a final concentration of 100mg/L to obtain a liquid separation culture medium, namely the fungus separation culture medium; selected basic culture mediumIs (NH)4)2SO4 2g, MgSO4·7H2O 0.2g，NaH2PO4·H2O 0.5g，CaCl2·2H2O 0.1g，K2HPO40.5g of agar, 15g of agar, 800.2g of Twen and 0.2g of lambda-cyhalothrin, and distilled water is added to the mixture until the volume is 1.0L and the pH value is 7.0.
2. The method according to claim 1, wherein Mucor circinelloides is used (C)Mucor circinelloides) The application of the efficient cyhalothrin mother liquor in degradation of the efficient cyhalothrin is characterized in that the efficient cyhalothrin mother liquor is dissolved according to the mass ratio of Tween80 to the efficient cyhalothrin of 1:1, and then deionized water is added to the dissolved efficient cyhalothrin mother liquor to reach a constant volume of 1L, so that the concentration reaches 50mg/ml, and the efficient cyhalothrin mother liquor can be prepared.
3. The method according to claim 1, wherein Mucor circinelloides is used (C)Mucor circinelloides) The application of the cyhalothrin in degrading the cyhalothrin is characterized in that the concentration of the cyhalothrin in the separation culture medium is 500mg/L, and the concentration of the ampicillin is 100 mg/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910382930.0A CN110922974B (en) | 2019-05-09 | 2019-05-09 | Application of mucor circinelloides in degradation of lambda-cyhalothrin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910382930.0A CN110922974B (en) | 2019-05-09 | 2019-05-09 | Application of mucor circinelloides in degradation of lambda-cyhalothrin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110922974A CN110922974A (en) | 2020-03-27 |
| CN110922974B true CN110922974B (en) | 2021-06-08 |
Family
ID=69856512
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910382930.0A Active CN110922974B (en) | 2019-05-09 | 2019-05-09 | Application of mucor circinelloides in degradation of lambda-cyhalothrin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110922974B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114573118B (en) * | 2022-04-12 | 2022-12-13 | 盐城工学院 | Method for removing o-dichlorobenzene, m-dichlorobenzene and p-dichlorobenzene from water by using mucor circinelloides and application of method |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101139559A (en) * | 2006-09-05 | 2008-03-12 | 许雷 | Novel bacterial strain for highly effective degradation of chrysanthemum ester and organophosphorus pesticide and uses thereof |
| CN101538605B (en) * | 2008-03-19 | 2011-09-14 | 中国科学院沈阳应用生态研究所 | Method for screening degradation bacteria strains by taking high-efficiency cyhalothrin as substrate |
| CN101724576B (en) * | 2008-10-21 | 2012-01-04 | 中国科学院生态环境研究中心 | Pyrethroid insecticide degradation bacteria and method for preparing fungicide thereof |
| CN101429515B (en) * | 2008-12-17 | 2010-09-01 | 南京农业大学 | Pyrethroid insecticide hydrolytic enzyme genes |
| CN101899414B (en) * | 2010-06-21 | 2012-01-11 | 南京农业大学 | Construction and application of broad spectrum organic phosphorus pesticide degradation genetic engineering strain |
| CN101974454B (en) * | 2010-09-15 | 2013-11-06 | 华南农业大学 | Degrading bacteria for pyrethroids insecticides and bactericide thereof |
| CN102604859B (en) * | 2012-01-17 | 2013-05-01 | 华南农业大学 | Pyrethroid pesticide residue degradation bacteria as well as bacteria agent and application |
| CN103333807B (en) * | 2013-07-04 | 2014-11-05 | 福州大学 | Aspergillus fumigatus strain for degrading pyrethroid pesticide |
| CN103952323B (en) * | 2014-05-21 | 2016-01-20 | 北京市农林科学院 | For the fungal bacterial strain of degradation pyrethrin pesticide and microbial inoculum thereof and application |
| CN105483026B (en) * | 2015-12-31 | 2019-01-29 | 广东省生态环境与土壤研究所 | Roll up branch Mucor H3 and its application in degradation pyrene |
| CN107541479B (en) * | 2017-09-20 | 2020-04-14 | 华南农业大学 | Insecticide-esfenpropathrin degrading strain, microbial inoculum and degrading process thereof |
| CN108410759B (en) * | 2018-03-06 | 2021-06-22 | 中国农业大学 | Rhodococcus rhodochrous for efficiently degrading cyhalothrin and application thereof |
| CN109619382A (en) * | 2018-11-30 | 2019-04-16 | 新疆农业科学院微生物应用研究所（中国新疆-亚美尼亚生物工程研究开发中心） | A kind of application of volume branch Mucor in degradation gossypol |
-
2019
- 2019-05-09 CN CN201910382930.0A patent/CN110922974B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110922974A (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110819565B (en) | Salt-tolerant bacillus BW9 with plant pathogenic bacteria inhibiting effect and application thereof | |
| CN108570431B (en) | Paenibacillus mucilaginosus and application thereof | |
| CN110982743A (en) | Bacillus aryabhattai for promoting corn root development and application thereof | |
| CN111100805A (en) | Rice sheath blight disease bactericide prepared by using boron-resistant lysine bacillus as chassis cells | |
| CN109401981B (en) | Metarhizium anisopliae IPPMHBHC-7 and application thereof | |
| CN112342169B (en) | Bacillus altitudinis and application thereof in prevention and control of cigar fermentation mildew | |
| CN110305796B (en) | Aspergillus flavus PAF-1 incapable of producing aflatoxin and application thereof | |
| CN110157626B (en) | Aspergillus flavus PEASH-12 without producing aflatoxin and application thereof | |
| CN110129212B (en) | Aspergillus flavus PEAS-10 without producing aflatoxin and application thereof | |
| CN110922974B (en) | Application of mucor circinelloides in degradation of lambda-cyhalothrin | |
| CN111778190B (en) | Brevibacillus brevis for preventing and treating root knot nematode disease and application thereof | |
| CN111378595B (en) | Burkholderia agricultural biocontrol strain Ba1 and application thereof | |
| CN110452859B (en) | Bacillus amyloliquefaciens B4216 and application thereof | |
| CN114703069B (en) | Epicoccus nigrum fermentation product, preparation method and application thereof | |
| CN113832038B (en) | Fusarium equisetum (Fusarium equiseti) K2017-696 and application thereof | |
| CN114317290B (en) | Bacterial strain capable of degrading diuron and application thereof | |
| CN114196572B (en) | Microbial agent with aflatoxin and toxigenic bacteria prevention and control and crop yield increase promotion functions and application thereof | |
| CN111808778B (en) | Bacillus wegener for preventing and treating verticillium wilt and culture method thereof, microbial inoculum and preparation method and application thereof | |
| CN111662843B (en) | Bacillus amyloliquefaciens and separation and screening method and application thereof | |
| CN115702668A (en) | Method for mixed ensiling of cyperus esculentus stem leaves and rape straws | |
| CN113337448B (en) | Citrobacter and application thereof in preventing and treating scarab beetles | |
| CN117487706B (en) | Antagonistic bacteria for preventing and controlling root rot of radix angelicae and biological organic fertilizer | |
| CN108913633B (en) | Streptomyces for producing volatile antibacterial gas and application thereof | |
| CN113925064B (en) | Application of B-lysine-resistant bacillus in inhibition of growth of pitaya soft rot germs | |
| CN108085284B (en) | Bacillus methylotrophicus, and preparation method and application of microbial inoculum containing same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |