CN110885876A - Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus - Google Patents
Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus Download PDFInfo
- Publication number
- CN110885876A CN110885876A CN201911241665.0A CN201911241665A CN110885876A CN 110885876 A CN110885876 A CN 110885876A CN 201911241665 A CN201911241665 A CN 201911241665A CN 110885876 A CN110885876 A CN 110885876A
- Authority
- CN
- China
- Prior art keywords
- pen container
- dna
- container tree
- nucleus
- analyzing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a method for quickly extracting, analyzing and identifying DNA outside a pen container tree nucleus, which comprises the steps of extracting total DNA in a pen container tree plant sample with broken cell walls by lysate, and removing a nuclear genome by filtering through a micro-aperture filter membrane of 0.45 mu m to obtain the DNA outside the nucleus including mtDNA and cpDNA; designing specific primers of atp1 gene in mtDNA of the pen container tree, selecting plant cpDNA-trnH gene sequence primers, respectively carrying out PCR amplification on extranuclear DNA by using the two pairs of primers, and carrying out sequencing analysis on the amplified product.
Description
Technical Field
The invention relates to a method for quickly extracting, analyzing and identifying DNA outside a pen container tree nucleus.
Background
The existing methods for extracting mitochondrial DNA are classified into density gradient centrifugation, enzymatic digestion, column chromatography, cesium chloride ultracentrifugation, alkaline denaturation, DNase, Triton, and modified high-salt precipitation. The cesium chloride reagent is expensive, the requirements of an alkaline denaturation method and an enzyme digestion method on test conditions are strict, the yield of the Triton method is low, the degradation is easy, and the density gradient centrifugation method is complicated to operate. The improved high-salt precipitation method has the advantages of simplicity, convenience, economy, easy repetition and the like, is considered as a better extraction method by a plurality of literatures, and still requires higher operation environment.
The existing methods for extracting the DNA of the chloroplast of higher plants mainly comprise a DNase I method, a sucrose density gradient centrifugation method, a Percoll gradient method, an anhydrous method, a high-salt low-pH method and the like, and although the methods are applied in many plant researches, the problems of high requirements on instruments and equipment, complex steps, long time consumption and the like still exist.
The extranuclear DNA of the pen container tree mainly refers to mitochondrial DNA (mtDNA) and chloroplast DNA (cpDNA), and the rapid extraction technology of the extranuclear DNA is important for the construction of a gene bank of the pen container tree and the completion of full sequencing.
In-vitro DNA identification of plants often utilizes chloroplast or ribosomal gene sequences, such as matK, rbcL, ITS, and the like. Plant mitochondria have large variability and the design of related specific primers is laborious.
The rapid extraction and analysis of DNA outside the pen container tree nucleus is beneficial to the deep research of the scientific problems of plant system evolution, cytoplasm gene function and the like.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a method for quickly extracting, analyzing and identifying DNA outside a pen container tree nucleus, and solves the problems of complicated extraction steps and long time consumption in the background technology.
The technical scheme adopted by the invention for solving the technical problems is as follows: the method for quickly extracting, analyzing and identifying the DNA outside the core of the pen container tree comprises the following steps:
1) extraction of extranuclear DNA
Extracting total DNA in the pen container tree plant sample with the broken cell wall by lysate, and filtering by a micro-aperture filter membrane of 0.45 mu m to remove the nuclear genome to obtain extra-nuclear DNA including mtDNA and cpDNA;
2) analytical identification of extranuclear DNA
Designing a specific primer of atp1 gene in mtDNA of the pen container tree, wherein
atp1(F)：TGTAGGAAAGGCCATGCCAG(SEQ ID NO：01)；
atp1(R)：TGCCCTATGCGTTGATTGGT(SEQ ID NO：02)；
Selecting a plant trnH-psbA gene sequence primer, wherein
psbA(F)：GTTATGCATGAACGTAATGCTC(SEQ ID NO：03)；
trnH(R)：CGCGCATGGTGGATTCACAATCC(SEQ ID NO：04)；
And respectively carrying out PCR amplification on the extranuclear DNA by using the two pairs of primers and carrying out sequencing analysis on the amplified products.
In a preferred embodiment of the present invention, 1) the extraction of extranuclear DNA comprises the steps of:
a) grinding the plant sample of the penholder tree into sample powder in liquid nitrogen, and breaking cell walls; transferring sample powder to a centrifuge tube, adding a lysis solution preheated at 65 ℃, wherein the dosage ratio of the sample powder to the lysis solution is 1 g: 2 mL; water bath is carried out for 30 minutes at 65 ℃, the centrifuge tube is shaken up and down to be uniform every 5 minutes, and filtrate containing the pen container tree total DNA is obtained by filtration;
b) filtering the filtrate containing the pen container tree total DNA to a centrifuge tube by using a syringe filter through a micro-aperture filter membrane of 0.45 mu m, and freezing the filtrate in liquid nitrogen for 1 hour; then, after the filtrate is unfrozen at room temperature, the centrifugal tube is inverted from top to bottom for 2-3 times, and the centrifugal tube is centrifuged for 2 minutes at 8000g and 4 ℃; transferring the supernatant to a new centrifuge tube, adding two times of volume of-20 deg.C pre-cooled anhydrous ethanol, and centrifuging at 16800g and 4 deg.C for 5 min; discarding the supernatant, adding a washing solution, and resuspending; the suspension was centrifuged at 16800g for one minute, the supernatant was discarded and the precipitate was dissolved by adding TE buffer, and the pellet was frozen at-20 ℃ to obtain extranuclear DNA including mtDNA and cpDNA.
In a preferred embodiment of the present invention, the pencil vase tree plant sample is fresh pencil vase tree leaves.
In a preferred embodiment of the present invention, in the step 1), two layers of gauze are used for filtration, and the gauze is washed twice with the lysate.
In a preferred embodiment of the present invention, the pH of the lysis solution is 7.6, and the formulation is 350mM of mannitol, 30mM of 3-morpholine propanesulfonic acid, 1mM of EDTA-EDTA, 50. mu.M of PVPP cross-linked polyvinylpyrrolidone and 11.2. mu.M of cysteine.
In a preferred embodiment of the present invention, in step 1) b), the pH of the washing solution is 7.2, and the formulation is 300mM mannitol, 20mM MOPS and 1mM EDTA.
In a preferred embodiment of the invention, the TE buffer has a pH of 8.0 and is formulated with 10mM Tris and 1mM EDTA.
In a preferred embodiment of the present invention, in the step 2), the PCR amplification procedure is pre-denaturation at 90 ℃ for 4 minutes, followed by 35 cycles, wherein the cycle procedure comprises denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 1 minute for 35 seconds, extension at 72 ℃ for one minute, and final extension at 72 ℃ for 10 minutes.
In a preferred embodiment of the present invention, in the step 2), the amplification product of the PCR is electrophoresed on a 1% agarose gel.
In a preferred embodiment of the present invention, the A260/A280 ratio of the extranuclear DNA is 1.032-1.042, and the yield is 172 ng/g-255 ng/g.
Compared with the background technology, the technical scheme has the following advantages:
1. the invention designs a specific primer aiming at the mitochondrial ATP1 gene of the pen container tree, the gene codes ATP synthase α subunit protein ATP1, the extracted extranuclear DNA sample can be respectively subjected to the PCR amplification of mtDNA and cpDNA, and the sequencing efficiency is high;
2. compared with the existing method for extracting the DNA outside the plant nucleus, the method firstly extracts the total DNA of the pen container tree material, and then uses a syringe filter to enable the extracting solution to pass through a micro-pore diameter membrane of 0.45 mu m so as to achieve the purposes of removing the nuclear genome and reserving the DNA outside the nucleus, thereby simplifying the extraction steps and shortening the operation time;
3. compared with the existing method for extracting the DNA outside the plant nucleus, the extraction scheme of the invention does not use toxic reagents with strong irritation, such as β -mercaptoethanol and the like, and is safe and environment-friendly.
Drawings
FIG. 1 is an electrophoresis photograph of a mitochondrial atp1 target gene fragment;
FIG. 2 is a photograph of an electrophoresis of a trnH-psbA target gene fragment;
FIG. 3 is a diagram showing the sequencing peaks of the PCR amplification products.
Detailed Description
Example 1
The method for quickly extracting, analyzing and identifying DNA outside the pen container tree nucleus takes fresh pen container tree leaves as plant samples and comprises the following steps:
1) extraction of extranuclear DNA
a) Taking fresh leaves of the penholder tree, and grinding the leaves in liquid nitrogen into powder as fine as possible; adding the lysis solution into the ground plant sample powder according to the proportion of 2ml of lysis solution per gram of sample.
Wherein, the formula of the lysis solution is as follows: 350mM mannitol, 30mM 3-morpholinopropanesulfonic acid (MOPS), 1mM EDTA ethylenediaminetetraacetic acid, 50. mu.M PVPP cross-linked polyvinylpyrrolidone, 11.2. mu.M cysteine; the pH was 7.6.
Subpackaging the liquid into centrifuge tubes, carrying out water bath at 65 ℃ for 30 minutes, and shaking uniformly from time to time; the liquid was filtered with two layers of gauze into a 50ml small beaker, and the gauze was washed twice with lysis buffer to obtain the filtrate containing the total DNA of the pencil vase plant sample.
b) Filtering the filtrate containing the total DNA of the plant sample of the penholder tree obtained in the step a) into a centrifuge tube through a microporous filter membrane of 0.45 mu m by using a syringe filter; placing the centrifugal tube at the position of the fingers of the disposable glove, and fixing the centrifugal tube in a liquid nitrogen tank by using a rubber band to freeze for 1 hour; then unfreezing at room temperature, inverting for 2-3 times, and centrifuging at 8000g rotation speed and low temperature (4 ℃) for 2 minutes; transferring the supernatant into a new centrifuge tube, adding absolute ethanol with the volume twice that of the supernatant, improving the yield by utilizing the low solubility of DNA in an organic solvent, and observing the generation condition of bubbles or transparent flocculent substances in the centrifuge tube; the centrifugal tube is placed into a centrifuge after being balanced, and is centrifuged for 5 minutes at the maximum rotating speed of 16800g at low temperature; carefully discard the supernatant, add 500 μ L of eluent to each tube, and blow the pellet with a pipette to resuspend it; the suspension was centrifuged at 16800g for one minute and the supernatant carefully discarded; and (4) resuspending the precipitate by using 20 mu L of TE buffer solution to obtain extranuclear DNA of the pen container tree, wherein the extranuclear DNA comprises mtDNA and cpDNA.
Wherein, the formula of the washing liquid is as follows: 300mM mannitol, 20mM MOPS, 1mM EDTA; pH 7.2; the formulation of TE buffer solution is: 10mM Tris, 1mM EDTA; the pH was 8.0.
2) Analytical identification of extranuclear DNA
a) PCR amplification of mitochondrial mtDNA
The PCR reaction system was 25. mu.L, which included 100ng of DNA, 1. mu.L of 10. mu. mol/L of positive primer atp1(F) (primer sequence TGTAGGAAAGGCCATGCCAG), 1. mu.L of 10. mu. mol/L of negative primer atp1(R) (primer sequence TGCCCTATGCGTTGATTGGT), and 12.5. mu.L of PCR cocktail (2 XMix). The PCR amplification procedure was: pre-denaturation at 95 ℃ for 3 min; 35 cycles (denaturation at 94 ℃ for 30 seconds, annealing at 61.2 ℃ for 30 seconds, extension at 72 ℃ for one minute) and final extension at 72 ℃ for 10 minutes.
b) PCR amplification of chloroplast cpDNA
The PCR reaction system is 25. mu.L, which includes 100ng template DNA, 1. mu.L of 10. mu. mol/L positive primer psbA (F) (primer sequence GTTATGCATGAACGTAATGCTC), 1. mu.L of 10. mu. mol/L negative primer trnH (R) (primer sequence CGCGCATGGTGGATTCACAATCC), and 12.5. mu.L PCR cocktail (2 Xmix). The PCR amplification procedure was: pre-denaturation at 90 ℃ for 4 min; 35 cycles (denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 1 minute and 35 seconds, extension at 72 ℃ for one minute) and final extension at 72 ℃ for 10 minutes.
DNA purity and yield
Measuring the optical density values of the DNA outside the core of the pen container tree at 260nm and 280nm, and calculating the purity and yield of the DNA through A260 and A260/A280 respectively, wherein the ratio of A260/A280 of the obtained DNA outside the core is 1.032-1.042, and the yield is 172 ng/g-255 ng/g.
Second, electrophoretic analysis of PCR amplification product
The DNA outside the core of the pen container tree extracted by the method is used as a template to carry out the PCR amplification of the mitochondrial DNA, and the result shows that the pen container trees of 6 samples all amplify mitochondrial atp1 target gene fragments with clear bands as shown in figure 1. The same extranuclear DNA is used as a template to carry out the PCR amplification of chloroplast DNA, and the result shows that the trnH-psbA of the pen container trees of 10 samples are singly and effectively amplified, and the bands are clear, as shown in figure 2.
Third, sequencing analysis
Sequencing the amplification result products of the chloroplast DNA and the mitochondrial DNA, and a sequencing peak diagram shows that the wave crests and the wave troughs are clear, the distance between the peaks is uniform, and no interference of miscellaneous peaks exists. The sequencing results are shown to be reliable in FIG. 3. Through sequence comparison, the similarity of a sequencing result and a target gene sequence of an NCBI database reaches more than 98%.
The above description is only a preferred embodiment of the present invention, and therefore should not be taken as limiting the scope of the invention, which is defined by the appended claims and their equivalents.
Sequence listing
<110> university of Chinese
Garden plant garden
<120> method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
tgtaggaaag gccatgccag 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tgccctatgc gttgattggt 20
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gttatgcatg aacgtaatgc tc 22
<210>4
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgcgcatggt ggattcacaa tcc 23
Claims (10)
1. A method for quickly extracting, analyzing and identifying DNA outside a pen container tree nucleus is characterized by comprising the following steps:
1) extraction of extranuclear DNA
Extracting total DNA in the pen container tree plant sample with the broken cell wall by lysate, and filtering by a micro-aperture filter membrane of 0.45 mu m to remove the nuclear genome to obtain extra-nuclear DNA including mtDNA and cpDNA;
2) analytical identification of extranuclear DNA
Designing a specific primer of atp1 gene in mtDNA of the pen container tree, wherein the sequence of an upstream primer is SEQ ID NO: 01, the sequence of the downstream primer is SEQ ID NO: 02;
selecting plant trnH-psbA gene sequence primers, wherein the sequence of an upstream primer of the primers is SEQ ID NO: 03, the sequence of the downstream primer is SEQ ID NO: 04;
and respectively carrying out PCR amplification on the extranuclear DNA by using the two pairs of primers and carrying out sequencing analysis on the amplified products.
2. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1, characterized in that: 1) extraction of extranuclear DNA
a) Grinding the plant sample of the penholder tree into sample powder in liquid nitrogen, and breaking cell walls; transferring sample powder to a centrifuge tube, adding a lysis solution preheated at 65 ℃, wherein the dosage ratio of the sample powder to the lysis solution is 1 g: 2 mL; water bath is carried out for 30 minutes at 65 ℃, the centrifuge tube is shaken up and down to be uniform every 5 minutes, and filtrate containing the pen container tree total DNA is obtained by filtration;
b) filtering the filtrate containing the pen container tree total DNA to a centrifuge tube by using a syringe filter through a micro-aperture filter membrane of 0.45 mu m, and freezing the filtrate in liquid nitrogen for 1 hour; then, after the filtrate is unfrozen at room temperature, inverting the centrifugal tube for 2-3 times, and centrifuging for 2 minutes at 8000g and 4 ℃; transferring the supernatant to a new centrifuge tube, adding two times of volume of-20 deg.C pre-cooled anhydrous ethanol, and centrifuging at 16800g and 4 deg.C for 5 min; discarding the supernatant, adding a washing solution, and resuspending; the suspension was centrifuged at 16800g for one minute, the supernatant was discarded and the precipitate was dissolved by adding TE buffer, and the pellet was frozen at-20 ℃ to obtain extranuclear DNA including mtDNA and cpDNA.
3. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1 or 2, which is characterized in that: the pencil vase tree plant sample is fresh pencil vase tree leaves.
4. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 2, characterized in that: in the step 1), two layers of gauze are used for filtering during filtering, and the gauze is washed twice by using a lysate.
5. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1 or 2, which is characterized in that: the pH of the lysis solution is 7.6, and the formulation is 350mM of mannitol, 30mM of 3-morpholine propanesulfonic acid, 1mM of EDTA ethylene diamine tetraacetic acid, 50 mu M of PVPP cross-linked polyvinylpyrrolidone and 11.2 mu M of cysteine.
6. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 2, characterized in that: in step 1) b), the pH of the washing solution was 7.2, and the formulation was 300mM mannitol, 20mM MOPS and 1mM EDTA.
7. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 2, characterized in that: the TE buffer had a pH of 8.0 and was formulated with 10mM Tris and 1mM EDTA.
8. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1, characterized in that: in the step 2), the PCR amplification procedure is pre-denaturation at 90 ℃ for 4 minutes, then 35 cycles are carried out, and the cycle procedure is denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 1 minute for 35 seconds, extension at 72 ℃ for one minute, and finally extension at 72 ℃ for 10 minutes.
9. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1, characterized in that: in the step 2), the amplification product of the PCR is electrophoresed on a 1% agarose gel.
10. The method for rapidly extracting, analyzing and identifying DNA outside a pen container tree nucleus as claimed in claim 1, characterized in that: the A260/A280 ratio of the extranuclear DNA is 1.032-1.042, and the yield is 172 ng/g-255 ng/g.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911241665.0A CN110885876A (en) | 2019-12-06 | 2019-12-06 | Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911241665.0A CN110885876A (en) | 2019-12-06 | 2019-12-06 | Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110885876A true CN110885876A (en) | 2020-03-17 |
Family
ID=69750832
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911241665.0A Pending CN110885876A (en) | 2019-12-06 | 2019-12-06 | Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110885876A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN201744365U (en) * | 2010-07-16 | 2011-02-16 | 尹春光 | Filter-membrane centrifugal tube |
| WO2011156251A2 (en) * | 2010-06-07 | 2011-12-15 | 3M Innovative Properties Company | Filtration methods and devices |
| CN104263846A (en) * | 2014-10-24 | 2015-01-07 | 西北大学 | Molecular method for quickly identifying closely related species of juniperus |
| CN109554362A (en) * | 2019-01-03 | 2019-04-02 | 上海市农业科学院 | A kind of genome DNA extracting reagent kit and method |
-
2019
- 2019-12-06 CN CN201911241665.0A patent/CN110885876A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011156251A2 (en) * | 2010-06-07 | 2011-12-15 | 3M Innovative Properties Company | Filtration methods and devices |
| US20130130270A1 (en) * | 2010-06-07 | 2013-05-23 | Raj Rajagopal | Filtration methods and devices |
| CN201744365U (en) * | 2010-07-16 | 2011-02-16 | 尹春光 | Filter-membrane centrifugal tube |
| CN104263846A (en) * | 2014-10-24 | 2015-01-07 | 西北大学 | Molecular method for quickly identifying closely related species of juniperus |
| CN109554362A (en) * | 2019-01-03 | 2019-04-02 | 上海市农业科学院 | A kind of genome DNA extracting reagent kit and method |
Non-Patent Citations (1)
| Title |
|---|
| NIKLASWIKSTRÖM等: "Incongruence between primary sequence data and the distribution of a mitochondrial atp1group II intron among ferns and horsetails", 《MOLECULAR PHYLOGENETICS AND EVOLUTION》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2665252T3 (en) | Purification of nucleic acid from microorganisms from host samples | |
| CN106636072B (en) | General DNA extraction method and kit for animal traditional Chinese medicine molecular identification | |
| CN103571826A (en) | Efficient extraction method for whole blood genome DNA (deoxyribonucleic acid) | |
| CN104178480B (en) | Using the kit and method of DNA adsorption column rapid extraction DNA of plants | |
| Sah et al. | Rapid and reliable method of high-quality RNA extraction from diverse plants | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN110195055A (en) | Polysaccharide polyphenol plant tissue method for extracting total RNA | |
| George | Simple and efficient method for functional RNA extraction from tropical medicinal plants rich in secondary metabolites | |
| CN110628762A (en) | Nucleic acid extraction method based on nano magnetic beads and application | |
| CN110885876A (en) | Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus | |
| CN108841991B (en) | Poplar chloroplast whole genome PCR amplification primer and application thereof | |
| CN103509786A (en) | Extraction method and applications of inset dry specimen genome | |
| CN106987584B (en) | Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar | |
| CN102888396B (en) | Method for separating low-molecular weight ribonucleic acid (RNA) of plant | |
| CN108728579B (en) | Method for detecting various plant viruses by adopting direct RT-PCR (reverse transcription-polymerase chain reaction) of plant microtissue | |
| CN109112190B (en) | Corbicula fluminea mitochondrial genome enrichment extraction and identification method | |
| Ghosh et al. | A high throughput DNA extraction method from chemotypically heterogeneous plant species | |
| CN108866042B (en) | Extraction method of trace RNA | |
| US10422011B2 (en) | Molecular identification method for single dinoflagellate cyst | |
| CN110724633A (en) | Trace cell nucleic acid extraction and amplification system and process | |
| CN111154836A (en) | Targeted nucleic acid capture and detection methods | |
| CN112301028B (en) | SCAR marker for identifying CHO cells and construction method and application thereof | |
| CN108060160A (en) | A kind of fast preparation method of BAC-DNA for FISH probe mark | |
| EP2196537A1 (en) | Method for synthesis of single- or double-stranded dna, and kit for the synthesis | |
| KR102308548B1 (en) | Nucleic acid extraction method for analytical diagnosis of carbapenem-resistant gene in feces or rectal swab specimens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200317 |
|
| RJ01 | Rejection of invention patent application after publication |