CN104263846A - Molecular method for quickly identifying closely related species of juniperus - Google Patents

Molecular method for quickly identifying closely related species of juniperus Download PDF

Info

Publication number
CN104263846A
CN104263846A CN201410577132.0A CN201410577132A CN104263846A CN 104263846 A CN104263846 A CN 104263846A CN 201410577132 A CN201410577132 A CN 201410577132A CN 104263846 A CN104263846 A CN 104263846A
Authority
CN
China
Prior art keywords
species
centrifuge tube
chinese juniper
centrifugal
under
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410577132.0A
Other languages
Chinese (zh)
Other versions
CN104263846B (en
Inventor
李忠虎
房敏峰
岳明
刘文哲
刘占林
赵鹏
赵桂仿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shaanxi Functional Food Engineering Center Co ltd
Original Assignee
Northwest University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest University filed Critical Northwest University
Priority to CN201410577132.0A priority Critical patent/CN104263846B/en
Publication of CN104263846A publication Critical patent/CN104263846A/en
Application granted granted Critical
Publication of CN104263846B publication Critical patent/CN104263846B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a molecular method for quickly identifying closely related species of juniperus. The molecular method comprises the following steps: firstly, extracting leaf total DNA (Deoxyribose Nucleic Acid) or seed endosperm DNA from dry leaves or seeds of juniperus species; secondly, performing PCR (Polymerase Chain Reaction) amplification and sequencing on DNA samples which are qualified by detection through a karyogene Chil primer; thirdly, purifying a PCR amplified product; fourthly, performing a sequencing reaction on the purified product; fifthly, further purifying the sequencing reaction product; sixthly, performing data collection on a purified product by using a genetic analyzer, or performing the sequencing and the data acquisition on the PCR product amplified by the karyogene Chil through the genetic analyzer; seventhly, opening an original sequence peak chart obtained by sequencing through software, reading basic group data information of individuals with high sequencing quality, comparing and correcting an original sequence and identifying the sequences of sabina convallium (JM), a sabina chinensis (JS), juniperus tibetica (JT) and karyogene (Chil) as the closely related species of the juniperus; eighthly, analyzing and comparing the difference degree among the sequences and identifying the species. The molecular method has the characteristics of quickness and accuracy for identification.

Description

The molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn.
Technical field
The invention belongs to field of molecular biotechnology, be specifically related to the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn..
Background technology
The Rapid identification of species and identification are the bases of conservation biology and biodiversity research.But for a long time, people depend on obvious formalness feature between species for the qualification of plant species and identification, as the flower of plant, fruit, seed, root, stem and leaf etc.Meanwhile, practical experience and the guidance of professional classification personnel is also depended on.But, when current traditional taxonomy professional sharply reduces, based on the taxonomy authentication method of species formalness feature, be difficult to the kindred plant species monoid of formalness feature difference less (when especially there is middle transition morphological characters between species) between precise Identification and identification species.
In recent years, along with the development of Protocols in Molecular Biology, the especially made rapid progress of DNA molecular sequencing technologies, DNA molecular barcode (DNA Barcoding) technology is suggested for Rapid identification species.This method is mainly by comparing to a segment standard target DNA molecular sequences fragment thus carry out Rapid identification to relative species.As a kind of novel species identification means, DNA bar code technology has just been widely applied to the species identification aspect of a lot of Relatives since proposing, as Mammals, birds, insect and fish etc.In these animal monoids, Mitochondrial cytochrome c oxidase (COI) gene order has abundant variant sites distinctive with species, is considered to the core DNA molecular barcode mark can differentiated as animal species.But, in phyto-group, due to the evolutionary rate that chondriogen is slower, cause being difficult to the chondriogen site searched out containing abundant variation, this severely limits chondriogen and be marked at application in phyto-group species identification.Given this, international life barcode alliance (CBOL) and Chinese Plants barcode research team (China Plant BOL Group) pass through repeated screening to multiple chloroplast DNA fragments of a large amount of phyto-group and experimental study, find that the combination of the comparatively faster Chloroplast rbcL of evolutionary rate+matK genetic marker and core ITS gene fragment have abundant variant sites in angiosperm, can be used as phanerogamous core DNA barcode molecule marker.In addition, chloroplast(id) trnH-psbA gene fragment can as assistant strip code indicia, and the DNA molecular for plant species is identified.
But, for gymnosperm monoid, due to the mutation rate that chloroplast gene is slower, add gymnosperm itself longer generation cycle (ripe to again producing seed from seed development to individual plants, approximately to need the time of about 15 years) and large effective population size (quantity) result in chloroplast DNA barcode rbcL+matK+trnH-psbA marker combination and core ITS gene fragment accurately cannot distinguish the nearly edge species of gymnosperm.This especially shows above the Cupressaceae Juniperus Linn. species of generation species history of forming in the recent period, to cause between chloroplast DNA fragment between Juniperus Linn. species and core ITS gene fragment gene locus a large amount of shares, and makes to use these standard DNA barcode molecule markers to combine and is difficult to precise Identification and identifies the nearly edge species of Juniperus Linn..The present invention intends finding can have the nuclear gene primer enriching variant sites in Juniperus Linn. species and carries out distinguishing and identify the nearly edge species of Juniperus Linn..
Summary of the invention
In order to overcome above-mentioned the deficiencies in the prior art, the object of this invention is to provide the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn., Cupressaceae Juniperus Linn. species, owing to having some intermediate transition forms of formalness characteristic sum identical in a large number, generally are aiphyllium or shrub species; Monoecism or different strain; Leaf is Ci Ye or scale leaf, lanceolar or nearly bar shaped; Male cone oval or square circle, the nearly spheroidal of female cone; Cone berry shape, subsphaeroidal; Fruit scale symphysis, meat; Seed 1-6 grain, aptery, often there is resin storage tank, which results in and use traditional morphological taxonomy authentication method to be difficult to differentiate these species fast and accurately, simultaneously, formed due to species relatively near between Juniperus Linn. species and break up history and large effective population quantity, making the chloroplast DNA molecule marker utilizing monolepsis, evolutionary rate slower be difficult to differentiate these species.Research finds, all to there is a large amount of gene pleiomorphisms in Cupressaceae Juniperus Linn. species shared in the combination of core chloroplast DNA rbcL+matK+trnH-psbA bar code label and core ITS gene fragment of international life barcode alliance and Chinese Plants barcode research team recommendation, causes accurately distinguishing the nearly edge species of Juniperus Linn..In addition, species molecule identification research in the past, most species sample body one by one and identify, cause species when different place samples, share due to the gene pleiomorphism between nearly edge species or gradually ooze, the nearer species of sibship may be made to have identical gene order or variation, this brings extreme difficulties to the accurate discriminating of species, therefore, the object of the invention is to filter out one and can sample multiple individuality in the multiple nearly edge species of Juniperus Linn., utilization has amphilepsis feature, and evolutionary rate nuclear gene DNA molecular bar code label faster, carry out the method for distinguishing that reflects fast and accurately of species, utilization has amphilepsis feature and evolutionary rate nuclear gene DNA molecular bar code label faster, carries out differentiating fast and accurately of species.
For achieving the above object, the technical solution used in the present invention is: the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn., can carry out fast and the DNA molecular bar code label of accurately discriminating the nearly edge species of Juniperus Linn., the DNA sample of the nuclear gene Chi1 primer pair Juniperus Linn. sibling species Different Individual of one section of amphilepsis is mainly utilized to carry out increasing and sequencing, thus carry out the structure of sequence alignment analysis and systematic evolution tree, on variation between further comparative analysis sequence and systematic evolution tree, the cluster situation of different plant species individuality carries out the Rapid identification of species, specifically comprise the following steps:
One, to dry blade or the seed of the Juniperus Linn. species gathered, CTAB method is used to carry out the extraction of blade STb gene or seed endosperm DNA; Specific procedure is as follows:
1) get a mature seed of the Juniperus Linn. species of seasoning, break exosper; With distillation water enchroachment (invasion) bubble seed 10-24 hour, be separated haploid endosperm in seed with tweezers, be stored in the refrigerator of 4 DEG C;
2) endosperm or crushing vane is ground: for the monoploid endosperm be separated, put into the mortar of prior precooling, the endosperm of a seed puts together, and adds appropriate polyvinylpyrrolidone (PVP) powder and liquid nitrogen, grinds to form fine powder rapidly; For dry blade, direct electronic balance takes 0.02g, then together puts in the centrifuge tube of 2.0mL with stainless shot, and in centrifuge tube, add appropriate PVP powder, together be placed in tissue grinder and pulverize sample 3min with the polishing of 30Hz frequency, make it become powder as far as possible;
3) 2 × CTAB solution of 800 μ L preheating in 65 DEG C of water-baths and the beta-mercaptoethanol of 8 μ L is added in powder, flick and allow powder mix completely in 2 × CTAB solution, centrifuge tube is placed in 65 DEG C of water-bath water-bath 45min, period to turn upside down mixing every 10min;
4) take out centrifuge tube, treat that temperature drops to room temperature, at 12000rpm, centrifugal 10min under 4 DEG C of conditions; Be placed in new 2.0mL centrifuge tube with the blue rifle head Aspirate supernatant cutting head, then add 800 μ L chloroform-isoamyl alcohol solution, turn upside down mixing centrifuge tube 10min, to carry out the extracting of impurity;
5) centrifugal 10min under rotating speed 10000rpm, 4 DEG C of conditions, transfer supernatant liquid in new 2.0mL centrifuge tube, and adds 800 μ L chloroform-isoamyl alcohol solution, and turn upside down mixing centrifuge tube 10min;
6) at rotating speed 10000rpm, centrifugal 10min under 4 DEG C of conditions, the new centrifuge tube of 1.5mL is placed in pipettor Aspirate supernatant (attention tries not to draw the liquid in middle layer), add the dehydrated alcohol jog mixing of 2 times of volumes, more than 90min preserved by the refrigerator being placed in-20 DEG C;
7) at 4 DEG C after taking out, centrifugal 10min under rotating speed 12000rpm, outwells upper strata waste liquid, then precipitates 2 times with 70% ethanol rinse, and then each 2-4min is placed on natural air drying on Bechtop;
8) in centrifuge tube, add 60 μ L distilled water dissolving DNAs precipitations, detect the purity of DNA and output with the agarose gel electrophoresis that concentration is 1%, save backup in the refrigerator being placed in 4 DEG C;
Two, to detecting qualified DNA sample, nuclear gene Chi1 primer is utilized to carry out pcr amplification and order-checking;
Concrete PCR amplification system is 25 μ L: comprise 2.5 μ L10 × PCR buffer, 0.5 μ L25mmol/LMgCl 2, 5 μm of each 1.2 μ L of ol/L forward and reverse nuclear gene Chi1 primer, 0.5 μ L10mmol/LdNTP, 0.25 μ L5U/ μ Lr-Tag archaeal dna polymerase, the template DNA of 10 ~ 50ng, fully after mixing, at the enterprising performing PCR amplified reaction of regular-PCR amplification instrument;
Amplification program is: first denaturation 4 minutes under 94 DEG C of conditions, then 36 circulations are carried out, to be included under 94 DEG C of conditions sex change 45 seconds, anneal 45 seconds under 55 DEG C of conditions, 72 DEG C of condition downward-extensions 2 points 30 seconds, extend 10 minutes eventually under last 72 DEG C of conditions, amplified production is kept in the refrigerator of 4 DEG C, detects purity and the output of PCR primer with the agarose gel electrophoresis that concentration is 1%;
Three, the purifying of pcr amplification product
Purification kit CASpure PCR Purification Kit is used to carry out purifying to pcr amplification product:
1) in solution II, add the dehydrated alcohol of 4 times of volumes;
2) reaction product moved in clean 1.5mL centrifuge tube from PCR reaction tubes, the solution I adding 5 times of volumes mixes, and obtains mixed solution;
3) transferred to by mixed solution in an adsorption column being inserted in 2.0mL centrifuge tube, room temperature places 2min, the centrifugal 1min when rotating speed 10000rpm;
4) repeating step 3) once;
5) outwell the waste liquid in 2.0mL centrifuge tube, adsorption column is put into same 2.0mL centrifuge tube, the centrifugal 2min of void column under the condition of rotating speed 10000rpm;
6) adsorption column is put into a clean 1.5mL centrifuge tube, in 37 DEG C time, place 8-12min to guarantee that ethanol volatilizees totally completely;
7) distilled water that the central authorities of adsorption film add 30 μ L sterilizings in adsorption column carries out wash-out, distilled water 65 DEG C of preheatings, and the water-bath of room temperature or 37 DEG C leaves standstill more than 1min;
8) centrifugal 1min under the condition of rotating speed 10000rpm, the liquid in this 1.5mL centrifuge tube is the DNA fragmentation of recovery, detects purity and the output of purified product, save backup under 4 DEG C of conditions with the agarose gel electrophoresis that concentration is 1%;
Four, sequencing reaction is carried out to purified product
Product after purifying, sequencing reaction is carried out with the primer identical with during pcr amplification, regular-PCR amplification instrument carries out, the reaction system of 10 μ L comprises: Big Dye Terminator (ABI) 2.5 μ L, nuclear gene Chi1 primer 5pmol forward or backwards, template product 25-50ng after purifying, the condition of sequencing reaction is as follows:
First denaturation 8 seconds under 95 DEG C of conditions, then carries out 25 circulations, to comprise under 95 DEG C of conditions sex change 15 seconds, anneal 15 seconds under 50 DEG C of conditions, 60 DEG C of condition downward-extensions 90 seconds, extend 90 seconds eventually under last 60 DEG C of conditions, the product of sequencing reaction is kept in the refrigerator of 4 DEG C;
Five, being further purified of sequencing reaction product
The product of sequencing reaction carries out purifying as follows:
1) add the sodium-acetate of 25 μ L, lucifuge room temperature places 30min, at 25 DEG C, centrifugal 30min under the condition of rotating speed 4000rpm;
2) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
3) 75% ethanol of 35 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
4) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
5) 75% ethanol of 40 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
6) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
7) more than oven for drying half an hour of 37 DEG C;
8) 10 μ L methane amides are added after taking out;
9) machine in sex change: sex change 5min under 95 DEG C of conditions, is put in freezing 10min on ice fast after taking-up;
10) purified product is stored in the refrigerator of 4 DEG C, treats that data collected by machine;
Six, purified product utilizes ABI 3130xl Genetic Analyser genetic analyzer to carry out data gathering; Or for the PCR primer of Chi1 gene amplification, utilize ABI 3730xl Genetic Analyser genetic analyzer to carry out the collection of order-checking and data;
Seven, the original series peak figure Chromas software obtained that checks order is opened, and the individuality high to sequencing quality reads base data message; Then MEGA ver.6.0 software is utilized to carry out sequence alignment and correction; Identify the sequence of Juniperus Linn. nearly edge species boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT) Chi1 gene:
Boy Chinese juniper #292-1-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA
Boy Chinese juniper #292-2-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA
Square bar Chinese juniper #270-1-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCATGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA
Square bar Chinese juniper #061-4-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTAGCCTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA
Tibet Chinese juniper #183-1-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA
Tibet Chinese juniper #222-2-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Eight, analyze the difference degree between aligned sequences, carry out the species identification of Juniperus Linn. boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT);
As can be seen from sequence alignment and analysis, obvious hereditary difference is there is in the nearly edge species of Juniperus Linn. three in Chi1 gene order, can distinguish each other, two individual 270-1-JS and 061-4-JS of square bar Chinese juniper (JS) also exist distinctive genovariation site in Nucleotide 110bp, 290bp and 476bp position; Two individual 292-1-JM and 292-2-JM of boy Chinese juniper (JM) also exist distinctive variant sites in 28bp, 120bp, 189bp and 449bp position; And two individual 183-1-JT and 222-2-JT of Tibet Chinese juniper (JT) exist distinctive genovariation at 165bp, 281bp, 197bp and 281bp place, these distinctive genovariation sites make can accurately distinguish between three Juniperus Linn. species;
MEGA ver.6.0 software is utilized to carry out the structure of systematic evolution tree based on distance method, set can be learnt by Phylogenetic, the individuality of each Juniperus Linn. species can gather separately one independently in hereditary branch, corresponding to these species itself, makes can accurately distinguish between these species.
Described 2 × CTAB solution is cetyl trimethylammonium bromide solution, and its composition is: 100mmol/LTris-HCl PH 8.0,1.4mol/LNaCl, 20mmol/L disodium ethylene diamine tetraacetate and 2%CTAB.
The volume ratio of described chloroform-isoamyl alcohol solution is 24:1.
Described dehydrated alcohol needs in advance-20 DEG C of refrigerator precoolings more than 2 hours.
The PH of described distilled water is greater than 7.0.
The sequence of described nuclear gene Chi1 primer is, forward: GGCGGCGGAGATTACTGTA, oppositely: TAGAAGACGCGCATTTGAGAA.
Beneficial effect of the present invention:
DNA molecular bar code label Chi1 gene order provided by the invention can be differentiated fast and accurately to the nearly edge species of Juniperus Linn., can be species taxonomy and the Molecular Phylogeny research evaluation of foundation of Juniperus Linn. species.By the individuality of three species boy Chinese junipers to Juniperus Linn., square bar Chinese juniper and Tibet Chinese juniper, carry out pcr amplification and the order-checking of Chi1 gene, and sequence is compared and hierarchial-cluster analysis, what find that two each and every one bodies of each species can be independent gathers one independently in hereditary branch, and obtains the supporting rate of moderate to height level.Two individual 270-1-JS and 061-4-JS supporting rate of gathering in a hereditary branch of such as square bar Chinese juniper (JS) is 99; The supporting rate that two individual 183-1-JT and 222-2-JT of Tibet Chinese juniper (JT) get together is 68, and two individual 292-1-JM with 292-2-JM of boy Chinese juniper (JM) gather together with supporting rate be 100, illustrate and use this nuclear gene Chi1 gene order can carry out accurately these species and taxonomic history fast.
Simultaneously, DNA molecular barcode authentication method provided by the invention, be not only and the strong of traditional Juniperus Linn. species identification is supplemented, and make this platymiscium Specimen identification process implementation automatization and stdn, breach depending on unduly professional classification personnel experience, the application system being formed and be easy to utilize can be set up within a short period of time.This technology will greatly promote that the mankind monitor, understand and utilize the ability of Cupressaceae Juniperus Linn. species species diversity, is with a wide range of applications in the conservation biology of this species and biodiversity research field.
Accompanying drawing explanation
Fig. 1 is the 1% agarose gel electrophoresis result figure extracting DNA.
Fig. 2 is 1% agarose gel electrophoresis result figure of amplified production.
Fig. 3 is 1% agarose gel electrophoresis result figure of purified product.
Fig. 4 is the partial sequence peak figure of Juniperus Linn. species Chi1 gene.
Fig. 5 is three Juniperus Linn. nearly edge species Chi1 gene order variation situation maps; Wherein Fig. 5 (a) is the sequence variations situation map of Chi1 gene 1-300bp, Fig. 5 (b) is the sequence variations figure of Chi1 gene 301-400bp, Fig. 5 (c) is the sequence variations figure of Chi1 gene 401-500bp, Fig. 5 (d) for the sequence variations figure of Chi1 gene 501-600bp, Fig. 5 (e) be the sequence variations figure of Chi1 gene 601-679bp.
Fig. 6 is the Phylogenetic figures of three Juniperus Linn. species based on Chi1 gene.
Fig. 7 is five Juniperus Linn. nearly edge species Chi1 gene order variation figure; Wherein Fig. 7 (a) is the sequence variations figure of Chi1 gene 1-100bp, Fig. 7 (b) is the sequence variations figure of Chi1 gene 101-200bp, Fig. 7 (c) is the sequence variations figure of Chi1 gene 201-300bp, Fig. 7 (d) is the sequence variations figure of Chi1 gene 301-400bp, Fig. 7 (e) is the sequence variations figure of Chi1 gene 401-500bp, Fig. 7 (f) for the sequence variations figure of Chi1 gene 501-600bp, Fig. 7 (g) be the sequence variations figure of Chi1 gene 601-687bp.
Fig. 8 is the Phylogenetic figures of five Juniperus Linn. species based on Chi1 gene.
Embodiment
Below in conjunction with specific embodiments and the drawings, the present invention is described in further detail.
Embodiment 1
A molecular method for the nearly edge species of quick discriminating Juniperus Linn., comprises the following steps:
One, to dry blade or the seed of the Juniperus Linn. species gathered, CTAB method is used to carry out the extraction of blade STb gene or seed endosperm DNA; Specific procedure is as follows:
1) get a mature seed of the Juniperus Linn. species of seasoning, break exosper; With distillation water enchroachment (invasion) bubble seed 10-24 hour, be separated haploid endosperm in seed with tweezers, be stored in the refrigerator of 4 DEG C;
2) endosperm or crushing vane is ground: for the monoploid endosperm be separated, put into the mortar of prior precooling, the endosperm of a seed puts together, and adds appropriate polyvinylpyrrolidone (PVP) powder and liquid nitrogen, grinds to form fine powder rapidly; For dry blade, direct electronic balance takes 0.02g, then together puts in the centrifuge tube of 2.0mL with stainless shot, and in centrifuge tube, add appropriate PVP powder, together be placed in tissue grinder and pulverize sample 3min with the polishing of 30Hz frequency, make it become powder as far as possible;
3) 2 × CTAB solution of 800 μ L preheating in 65 DEG C of water-baths and the beta-mercaptoethanol of 8 μ L is added in powder, flick and allow powder mix completely in 2 × CTAB solution, centrifuge tube is placed in 65 DEG C of water-bath water-bath 45min, period to turn upside down mixing every 10min;
4) take out centrifuge tube, treat that temperature drops to room temperature, at 12000rpm, centrifugal 10min under 4 DEG C of conditions; Be placed in new 2.0mL centrifuge tube with the blue rifle head Aspirate supernatant cutting head, then add 800 μ L chloroform-isoamyl alcohol solution, the mixing centrifuge tube 10min that turns upside down gently, to carry out the extracting of impurity;
5) centrifugal 10min under rotating speed 10000rpm, 4 DEG C of conditions, transfer supernatant liquid in new 2.0mL centrifuge tube, and adds 800 μ L chloroform-isoamyl alcohol solution, and turn upside down mixing centrifuge tube 10min;
6) at rotating speed 10000rpm, centrifugal 10min under 4 DEG C of conditions, the new centrifuge tube of 1.5mL is placed in pipettor Aspirate supernatant (attention tries not to draw the liquid in middle layer), add the dehydrated alcohol jog mixing of 2 times of volumes, more than 90min preserved by the refrigerator being placed in-20 DEG C;
7) at 4 DEG C after taking out, centrifugal 10min under rotating speed 12000rpm, outwells upper strata waste liquid, then precipitates 2 times with 70% ethanol rinse, and then each 2-4min is placed on natural air drying on Bechtop;
8) in centrifuge tube, add 60 μ L distilled water dissolving DNAs precipitations, detect the purity of DNA and output (as Fig. 1) with the agarose gel electrophoresis that concentration is 1%, save backup in the refrigerator being placed in 4 DEG C;
Two, to detecting qualified DNA sample (as shown in Figure 1), nuclear gene Chi1 primer is utilized to carry out pcr amplification and order-checking, forward: GGCGGCGGAGATTACTGTA, oppositely: TAGAAGACGCGCATTTGAGAA;
Concrete PCR amplification system is 25 μ L: comprise 2.5 μ L10 × PCR buffer, 0.5 μ L25mmol/LMgCl 2, 5 μm of each 1.2 μ L of ol/L forward and reverse nuclear gene Chi1 primer, 0.5 μ L10mmol/LdNTP, 0.25 μ L5U/ μ Lr-Tag archaeal dna polymerase, the template DNA of 10 ~ 50ng, fully after mixing, at the enterprising performing PCR amplified reaction of regular-PCR amplification instrument;
Amplification program is: first denaturation 4 minutes under 94 DEG C of conditions, then 36 circulations are carried out, to be included under 94 DEG C of conditions sex change 45 seconds, anneal 45 seconds under 55 DEG C of conditions, 72 DEG C of condition downward-extensions 2 points 30 seconds, extend 10 minutes eventually under last 72 DEG C of conditions, amplified production is kept in the refrigerator of 4 DEG C, detects purity and the output (as shown in Figure 2) of PCR primer with the agarose gel electrophoresis that concentration is 1%;
Three, the purifying of pcr amplification product
Purification kit CASpure PCR Purification Kit is used to carry out purifying to pcr amplification product:
1) in solution II, add the dehydrated alcohol of 4 times of volumes;
2) reaction product moved in clean 1.5mL centrifuge tube from PCR reaction tubes, the solution I adding 5 times of volumes mixes, and obtains mixed solution;
3) transferred to by mixed solution in an adsorption column being inserted in 2.0mL centrifuge tube, room temperature places 2min, the centrifugal 1min when rotating speed 10000rpm;
4) repeating step 3) once;
5) outwell the waste liquid in 2.0mL centrifuge tube, adsorption column is put into same 2.0mL centrifuge tube, the centrifugal 2min of void column under the condition of rotating speed 10000rpm;
6) adsorption column is put into a clean 1.5mL centrifuge tube, in 37 DEG C time, place 8-12min to guarantee that ethanol volatilizees totally completely;
7) distilled water that the central authorities of adsorption film add 30 μ L sterilizings in adsorption column carries out wash-out, distilled water 65 DEG C of preheatings, and the water-bath of room temperature or 37 DEG C leaves standstill more than 1min;
8) centrifugal 1min under the condition of rotating speed 10000rpm, liquid in this 1.5mL centrifuge tube is the DNA fragmentation of recovery, detect purity and the output (as Fig. 3) of purified product with the agarose gel electrophoresis that concentration is 1%, save backup under 4 DEG C of conditions.
Four, sequencing reaction is carried out to purified product
Product after purifying, sequencing reaction is carried out with the primer identical with during pcr amplification, regular-PCR amplification instrument carries out, the reaction system of 10 μ L comprises: Big Dye Terminator (ABI) 2.5 μ L, nuclear gene Chi1 primer 5pmol forward or backwards, template product 25-50ng after purifying, the condition of sequencing reaction is as follows:
First denaturation 8 seconds under 95 DEG C of conditions, then carries out 25 circulations, to comprise under 95 DEG C of conditions sex change 15 seconds, anneal 15 seconds under 50 DEG C of conditions, 60 DEG C of condition downward-extensions 90 seconds, extend 90 seconds eventually under last 60 DEG C of conditions, the product of sequencing reaction is kept in the refrigerator of 4 DEG C;
Five, being further purified of sequencing reaction product
The product of sequencing reaction carries out purifying as follows:
1) add the sodium-acetate of 25 μ L, lucifuge room temperature places 30min, at 25 DEG C, centrifugal 30min under the condition of rotating speed 4000rpm;
2) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
3) 75% ethanol of 35 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
4) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
5) 75% ethanol of 40 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
6) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
7) more than oven for drying half an hour of 37 DEG C;
8) 10 μ L methane amides are added after taking out;
9) machine in sex change: sex change 5min under 95 DEG C of conditions, is put in freezing 10min on ice fast after taking-up;
10) purified product is stored in the refrigerator of 4 DEG C, treats that data collected by machine;
Six, purified product utilizes ABI 3130xl Genetic Analyser genetic analyzer to carry out data gathering; Or for the PCR primer of Chi1 gene amplification, utilize ABI 3730xl Genetic Analyser genetic analyzer to carry out the collection of order-checking and data;
Seven, the original series peak figure Chromas software obtained that checks order is opened, and the individuality (as shown in Figure 4, peak figure neat, not assorted peak interference) high to sequencing quality reads base data message; Then MEGAver.6.0 software is utilized to carry out sequence alignment and correction; Identify the sequence of Juniperus Linn. nearly edge species boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT) Chi1 gene:
#292-1-JM (boy Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
#292-2-JM (boy Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
#270-1-JS (square bar Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCATGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
#061-4-JS (square bar Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTAGCCTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
#183-1-JT (Tibet Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
#222-2-JT (Tibet Chinese juniper)
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Eight, analyze the difference degree (see Fig. 5) between aligned sequences, carry out the species identification of Juniperus Linn. boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT);
As can be seen from sequence alignment and analysis, obvious hereditary difference is there is in the nearly edge species of Juniperus Linn. three in Chi1 gene order, can distinguish each other, two individual 270-1-JS and 061-4-JS of such as square bar Chinese juniper (JS) also exist distinctive genovariation site in Nucleotide 110bp, 290bp and 476bp position; Two individual 292-1-JM and 292-2-JM of boy Chinese juniper (JM) also exist distinctive variant sites in 28bp, 120bp, 189bp and 449bp position; And two individual 183-1-JT and 222-2-JT of Tibet Chinese juniper (JT) exist distinctive genovariation at 165bp, 281bp, 197bp and 281bp place, these distinctive genovariation sites make can accurately distinguish between three Juniperus Linn. species;
Simultaneously, (Bootstrap value is set to 1000 to utilize MEGA ver.6.0 software to carry out systematic evolution tree based on distance method, other Selecting parameter default values) structure, (see Fig. 6) is set as can be seen from Phylogenetic, the individuality of each Juniperus Linn. species can gather separately one independently in hereditary branch, corresponding to these species itself, make can accurately distinguish between these species.
Embodiment 2
Application the present invention carries out Molecular Identification fast to Juniperus Linn. nearly edge species: to blade or the seed of the Juniperus Linn. nearly edge species Sabina przewalskii gathered, close branch Chinese juniper, boy Chinese juniper, square bar Chinese juniper and Tibet Chinese juniper, carry out the extraction of DNA, and utilize nuclear gene primer Chi1 provided by the invention to carry out pcr amplification and the order-checking of DNA sample, comparison and analyze institute check order arrange with sequence of the present invention between difference, and carry out structure and the cluster analysis of all sequences systematic evolution tree, thus carry out the Molecular Identification of Juniperus Linn. species;
A molecular method for the nearly edge species of quick discriminating Juniperus Linn., comprises the following steps:
One, the DNA of Juniperus Linn. nearly edge species Sabina przewalskii, close branch Chinese juniper, boy Chinese juniper, square bar Chinese juniper and Tibet Chinese juniper Different Individual is extracted;
Step one ~ step 6 is identical with the step one ~ step 6 of embodiment one;
Seven, the original series peak figure Chromas software obtained that checks order is opened, and the individuality high to sequencing quality reads base data message; Then MEGA ver.6.0 software is utilized to carry out sequence alignment and correction; Identify the sequence of Chi1 gene:
Boy Chinese juniper #292-1-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Boy Chinese juniper #292-2-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Boy Chinese juniper #132-1-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Close branch Chinese juniper #190-1-JC
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGACGTCTCATGAATTTGCATGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Close branch Chinese juniper #190-2-JC
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCATGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Close branch Chinese juniper #013-1-JC
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Close branch Chinese juniper #013-3-JC
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Close branch Chinese juniper #013-6-JC
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Sabina przewalskii #151-9-JP
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAACTCTGCTCAGGCCGGAAATCTGATGTTTGTATTGGTTGCTTTTCCACTTTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTGTGCTTGAACTATAATTACATTGCGGCTGGGAAGGCTATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTATAAGAGGTATTGTGATATACTGGGGGTGAGCTATGGCCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCGCAATTCATCCAGACCGTGGTGTGAACGGCGTTAATGTGAGTGTCAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Sabina przewalskii #06-1-JP
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAACTCTGCTCAGGCCGGAAATCTGATGTTTGTATTGGTTGCTTTTCCACTTTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTGTGCAGGAACTATAATTACATTGCGGCTGGGAAGGCTATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGTGATATACTGGGGGTGAGCTATGGCCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCGCTATTCATCCAGACCGTGGTGTGAACGGCGTTGATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Sabina przewalskii #06-9-JP
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAACTCTGCTCAGGCCGGAAATCTGATGTTTGTATTGGTTGCTTTTCCACTTTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTGTGCAGGAACTATAATTACATTGCGGCTGGGAAGGCTATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGTGATATACTGGGGGTGAGCTATGGCCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCGCTATTCATCCAGACCGTGGTGTGAACGGCGTTGATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Sabina przewalskii #06-14-JP
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAACTCTGCTCAGGCCGGAAATCTGATGTTTGTATTGGTTGCTTTTCCACTTTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTGTGCAGGAACTATAATTACATTGCGGCTGGGAAGGCTATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGTGATATACTGGGGGTGAGCTATGGCCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCGCTATTCATCCAGACCGTGGTGTGAACGGCGTTGATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Sabina przewalskii #dlh-11-JP
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAACTCTGCTCAGGCCGGAAATCTGATGTTTGTATTGGTTGCGTTTCCACTTTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTGTGCAGGAACTATAATTACATTGCGGCTGGGAAGGCTATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATTGTGATATATTGGGGGTGAGCTATGGCCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAACGGCGTTGATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Square bar Chinese juniper #270-1-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCATGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Square bar Chinese juniper #270-2-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCATGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Square bar Chinese juniper #061-4-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTAGCCTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Square bar Chinese juniper #061-5-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTAGCCTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #183-1-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #222-2-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #157-1-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCATGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #157-9-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #303-4-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCATGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAAACAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTCTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #327-3-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCTCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Tibet Chinese juniper #293-1-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATTTGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACGTTACTACACTGTGACGTCTCATGAATTTGCATGTGTTTGGTATTATGCAGGAACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACGTCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATTGCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAGGCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCAATA；
Eight, analyze the difference degree between aligned sequences, carry out species identification, find through sequence alignment and analysis, three individual 292-1-JM of boy Chinese juniper (JM), 292-2-JM and 132-1-JM is at 28bp, 197bp and 409bp place also exists three distinctive genovariation sites, 5 individual 151-9-JP of Sabina przewalskii, 06-1-JP, 06-9-JP, 06-14-JP and dlh-11-JP is at 40bp, 58bp, 65bp, 77bp, 87bp, 157bp, 184bp, 199bp, 475bp, 499bp, 579bp and 583bp place also exists 12 distinctive alternative (variation) sites, there is a distinctive insertion/deletion Mutation at 45-52bp place simultaneously, 4 individual 270-1-JS of square bar Chinese juniper, 270-2-JS, 061-4-JS and 061-5-JS also exists a distinctive variant sites at 484bp place, these distinctive genovariation sites make tentatively to distinguish and differentiate (see Fig. 7) between the nearly edge species of Juniperus Linn.,
Meanwhile, utilize molecular evolution software MEGA Ver.6.0 to carry out the structure of systematic evolution tree (Bootstrap value is set to 1000, other Selecting parameter default values) based on distance method, carry out the Molecular Identification of the nearly edge species of Juniperus Linn. further.Analytical system evolutionary tree (see Fig. 8) can be found out, from the individuality of different populations, (front two of individual title or three characters represent population number to each Juniperus Linn. species, a middle character represents the individuality numbering in population, 2 last letters represent species) can gather separately in a hereditary branch corresponding to these species itself, make can distinguish accurately and differentiate between these species.Such as, Sabina przewalskii (JP) three population (151, 06 and dlh) 5 individual 151-9-JP, 06-1-JP, 06-9-JP, 06-14-JP and dlh-11-JP has gathered in a large hereditary branch, obtains the supporting rate of 100, three individual 292-1-JM of boy Chinese juniper (JM) two population (292 and 132), 292-2-JM and 132-1-JM has also gathered in a hereditary branch, supporting rate up to 99,4 individual 270-1-JS of square bar Chinese juniper (JS) two population (270 and 061), 270-2-JS, 061-4-JS and the 061-5-JS supporting rate of gathering in a branch is 96, and 5 individual 190-1-JC of close branch Chinese juniper (JC) two population (190 and 013), 190-2-JC, 013-1-JC, 013-3-JC and 013-6-JC also gathers in a large hereditary branch, corresponding to these species itself, although supporting rate lower (34), in addition, and Tibet Chinese juniper (JT) 6 different populations (183, 222, 157, 303, 327 and 293) 7 individual 183-1-JT, 222-2-JT, 157-1-JT, 157-9-JT, 303-4-JT, 327-3-JT and 293-1-JT to be also in systematic evolution tree in a large hereditary branch, corresponding to these species itself.These results demonstrate the species identification ability that nuclear gene Chi1 sequence fragment has height, can be used successfully to the Molecular Identification of the nearly edge species of Juniperus Linn..

Claims (6)

1. differentiate a molecular method for the nearly edge species of Juniperus Linn. fast, it is characterized in that, comprise the following steps:
One, to dry blade or the seed of the Juniperus Linn. species gathered, CTAB method is used to carry out the extraction of blade STb gene or seed endosperm DNA; Specific procedure is as follows:
1) get a mature seed of the Juniperus Linn. species of seasoning, break exosper; With distillation water enchroachment (invasion) bubble seed 10-24 hour, be separated haploid endosperm in seed with tweezers, be stored in the refrigerator of 4 DEG C;
2) endosperm or crushing vane is ground: for the monoploid endosperm be separated, put into the mortar of prior precooling, the endosperm of a seed puts together, and adds appropriate polyvinylpyrrolidone (PVP) powder and liquid nitrogen, grinds to form fine powder rapidly; For dry blade, direct electronic balance takes 0.02g, then together puts in the centrifuge tube of 2.0mL with stainless shot, and in centrifuge tube, add appropriate PVP powder, together be placed in tissue grinder and pulverize sample 3min with the polishing of 30Hz frequency, make it become powder as far as possible;
3) 2 × CTAB solution of 800 μ L preheating in 65 DEG C of water-baths and the beta-mercaptoethanol of 8 μ L is added in powder, flick and allow powder mix completely in 2 × CTAB solution, centrifuge tube is placed in 65 DEG C of water-bath water-bath 45min, period to turn upside down mixing every 10min;
4) take out centrifuge tube, treat that temperature drops to room temperature, at 12000rpm, centrifugal 10min under 4 DEG C of conditions; Be placed in new 2.0mL centrifuge tube with the blue rifle head Aspirate supernatant cutting head, then add 800 μ L chloroform-isoamyl alcohol solution, turn upside down mixing centrifuge tube 10min, to carry out the extracting of impurity;
5) centrifugal 10min under rotating speed 10000rpm, 4 DEG C of conditions, transfer supernatant liquid in new 2.0mL centrifuge tube, and adds 800 μ L chloroform-isoamyl alcohol solution, and turn upside down mixing centrifuge tube 10min;
6) at rotating speed 10000rpm, centrifugal 10min under 4 DEG C of conditions, is placed in the new centrifuge tube of 1.5mL with pipettor Aspirate supernatant, and add the dehydrated alcohol jog mixing of 2 times of volumes, more than 90min preserved by the refrigerator being placed in-20 DEG C;
7) at 4 DEG C after taking out, centrifugal 10min under rotating speed 12000rpm, outwells upper strata waste liquid, then precipitates 2 times with 70% ethanol rinse, and then each 2-4min is placed on natural air drying on Bechtop;
8) in centrifuge tube, add 60 μ L distilled water dissolving DNAs precipitations, detect the purity of DNA and output with the agarose gel electrophoresis that concentration is 1%, save backup in the refrigerator being placed in 4 DEG C;
Two, to detecting qualified DNA sample, nuclear gene Chi1 primer is utilized to carry out pcr amplification and order-checking,
Concrete PCR amplification system is 25 μ L: comprise 2.5 μ L10 × PCR buffer, 0.5 μ L25mmol/L MgCl 2, 5 μm of each 1.2 μ L of ol/L forward and reverse nuclear gene Chi1 primer, 0.5 μ L10mmol/LdNTP, 0.25 μ L5U/ μ Lr-Tag archaeal dna polymerase, the template DNA of 10 ~ 50ng, fully after mixing, at the enterprising performing PCR amplified reaction of regular-PCR amplification instrument;
Amplification program is: first denaturation 4 minutes under 94 DEG C of conditions, then 36 circulations are carried out, to be included under 94 DEG C of conditions sex change 45 seconds, anneal 45 seconds under 55 DEG C of conditions, 72 DEG C of condition downward-extensions 2 points 30 seconds, extend 10 minutes eventually under last 72 DEG C of conditions, amplified production is kept in the refrigerator of 4 DEG C, detects purity and the output of PCR primer with the agarose gel electrophoresis that concentration is 1%;
Three, the purifying of pcr amplification product
Purification kit CASpure PCR Purification Kit is used to carry out purifying to pcr amplification product:
1) in solution II, add the dehydrated alcohol of 4 times of volumes;
2) reaction product moved in clean 1.5mL centrifuge tube from PCR reaction tubes, the solution I adding 5 times of volumes mixes, and obtains mixed solution;
3) transferred to by mixed solution in an adsorption column being inserted in 2.0mL centrifuge tube, room temperature places 2min, the centrifugal 1min when rotating speed 10000rpm;
4) repeating step 3) once;
5) outwell the waste liquid in 2.0mL centrifuge tube, adsorption column is put into same 2.0mL centrifuge tube, the centrifugal 2min of void column under the condition of rotating speed 10000rpm;
6) adsorption column is put into a clean 1.5mL centrifuge tube, in 37 DEG C time, place 8-12min to guarantee that ethanol volatilizees totally completely;
7) distilled water that the central authorities of adsorption film add 30 μ L sterilizings in adsorption column carries out wash-out, distilled water 65 DEG C of preheatings, and the water-bath of room temperature or 37 DEG C leaves standstill more than 1min;
8) centrifugal 1min under the condition of rotating speed 10000rpm, the liquid in this 1.5mL centrifuge tube is the DNA fragmentation of recovery, detects purity and the output of purified product, save backup under 4 DEG C of conditions with the agarose gel electrophoresis that concentration is 1%;
Four, sequencing reaction is carried out to purified product
Product after purifying, sequencing reaction is carried out with the primer identical with during pcr amplification, regular-PCR amplification instrument carries out, the reaction system of 10 μ L comprises: Big Dye Terminator (ABI) 2.5 μ L, nuclear gene Chi1 primer 5pmol forward or backwards, template product 25-50ng after purifying, the condition of sequencing reaction is as follows:
First denaturation 8 seconds under 95 DEG C of conditions, then carries out 25 circulations, to comprise under 95 DEG C of conditions sex change 15 seconds, anneal 15 seconds under 50 DEG C of conditions, 60 DEG C of condition downward-extensions 90 seconds, extend 90 seconds eventually under last 60 DEG C of conditions, the product of sequencing reaction is kept in the refrigerator of 4 DEG C;
Five, being further purified of sequencing reaction product
The product of sequencing reaction carries out purifying as follows:
1) add the sodium-acetate of 25 μ L, lucifuge room temperature places 30min, at 25 DEG C, centrifugal 30min under the condition of rotating speed 4000rpm;
2) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
3) 75% ethanol of 35 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
4) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
5) 75% ethanol of 40 μ L is added, immediately at 25 DEG C, centrifugal 15min under the condition of rotating speed 4000rpm;
6) after centrifugal end, back-off is centrifugal immediately, and rotating speed is no more than 500rpm;
7) more than oven for drying half an hour of 37 DEG C;
8) 10 μ L methane amides are added after taking out;
9) machine in sex change: sex change 5min under 95 DEG C of conditions, is put in freezing 10min on ice fast after taking-up;
10) purified product is stored in the refrigerator of 4 DEG C, treats that data collected by machine;
Six, purified product utilizes genetic analyzer to carry out data gathering; Or for the PCR primer of Chi1 gene amplification, utilize genetic analyzer to carry out the collection of order-checking and data;
Seven, the original series peak figure Chromas software obtained that checks order is opened, and the individuality high to sequencing quality reads base data message; Then MEGA ver.6.0 software is utilized to carry out sequence alignment and correction; Identify the sequence of Juniperus Linn. nearly edge species boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT) Chi1 gene:
Boy Chinese juniper #292-1-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTT
GATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACG
TTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGA
ACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACG
ATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTG
GTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGA
CGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGC
GGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGA
AAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATT
GCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAG
GCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTG
AAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTT
TTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTC
AATA
Boy Chinese juniper #292-2-JM
CAATATTACGGCCGAGGGCCCATCCAGTTGTCATGGTAAGTCTGGGAAATTT
GATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAACG
TTACTACACTGTGACGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGGA
ACTATAATTACATAGCGGCTGGGAAGACGATTGGCTTCGACGGGTTGAACG
ATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCTG
GTTCTGGATGACGGCGCAGTCTCCGAAACCGTCGTGCCACGACGTCATGA
CGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGC
GGGGTACGGAGTGACGACCAATATAATAAACGGAGGACTTGAATGCGGGA
AAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGTTTCTACAAGAGGTATT
GCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAG
GCCCTTTGGTTTTGCCCTTGAAAATCCCCAATTCATCCAGACCGTGGTGTG
AAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTT
TTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTC
AATA
Square bar Chinese juniper #270-1-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATT
TGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAAC
GTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGG
AACTATAATTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGTTGAAC
GATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCT
GGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCATGCCACGACGTCATGA
CGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGC
GGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGA
AAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATT
GCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAG
ACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTG
AAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTT
TTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTC
AATA
Square bar Chinese juniper #061-4-JS
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATT
TGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAAC
GTTACCACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGG
AACTATAATTAGCCTACATAGCGGCTGGGAAGGCGATTGGCTTCGACGGGT
TGAACGATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGG
CGATCTGGTTCTGGATGACGGCGCAGTCTCCCAAACCGTCGTGCCACGACG
TCATGACGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGA
AGTGCGGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATG
CGGGAAAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGA
GGTATTGCGATATATTAGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAAC
CAGAGACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTG
GTGTGAAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTG
GTGTTTTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAA
ATTTCAATA
Tibet Chinese juniper #183-1-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATT
TGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAAC
GTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGG
AACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAAC
GATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCT
GGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGA
CGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGC
GGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGA
AAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATT
GCGATATACTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAG
GCCCTTTGGTTTTGCCCTTGAAAATCCCCCATTCATCCAGACCGTGGTGTGA
AAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTTT
TCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTCA
ATA
Tibet Chinese juniper #222-2-JT
CAATATTACGGCCGAGGGCCCATCCAGCTGTCATGGTAAGTCTGGGAAATT
TGATGGTTGTATTGGTTGTTTTTCCACTGTTAAATCATATACAAATACGCAAC
GTTACTACACTGTGAAGTCTCATGAATTTGCACGTGTTTGGTATTATGCAGG
AACTATAACTACATAGCGGCTGGGAAGGCGATTGGGTTCGACGGGTTGAAC
GATCCGGATATTGTTGCTCGAGATGCCACGGTCTCGTTTAAGACGGCGATCT
GGTTCTGGATGACGGCTCAGTCTCCGAAACCGTCGTGCCACGACGTCATGA
CGGGTAAATGGCAGCCGTCGGGCAGCGACAGCGCTGCGGGCAGAAGTGC
GGGGTACGGAGTGACGACCAATATAATAAACGGAGGGCTTGAATGCGGGA
AAGGGTCGGATTCGAGGGTGCAGGATCGCATTGGATTCTACAAGAGGTATT
GCGATATATTGGGGGTGAGCTATGGTCCTAATCTCGACTGCTTTAACCAGAG
ACCCTTTGGTTTTGCCCTAGAAAATCCCCAATTCATCCAGACCGTGGTGTG
AAAGGCCTTAATGTGAGTGTTAATAATGTTTGTTTGTGTGAGTTTTGGTGTT
TTCTATACGTATATATACATATGAGATATGCTAATAATATTATGTAGTAAATTTC
AATA；
Eight, analyze the difference degree between aligned sequences, carry out the species identification of Juniperus Linn. boy Chinese juniper (JM), square bar Chinese juniper (JS) and Tibet Chinese juniper (JT);
As can be seen from sequence alignment and analysis, obvious hereditary difference is there is in the nearly edge species of Juniperus Linn. three in Chi1 gene order, can distinguish each other, two individual 270-1-JS and 061-4-JS of square bar Chinese juniper (JS) also exist distinctive genovariation site in Nucleotide 110bp, 290bp and 476bp position; Two individual 292-1-JM and 292-2-JM of boy Chinese juniper (JM) also exist distinctive variant sites in 28bp, 120bp, 189bp and 449bp position; And two individual 183-1-JT and 222-2-JT of Tibet Chinese juniper (JT) exist distinctive genovariation at 165bp, 281bp, 197bp and 281bp place, these distinctive genovariation sites make can accurately distinguish between three Juniperus Linn. species;
MEGA ver.6.0 software is utilized to carry out the structure of systematic evolution tree based on distance method, set can be learnt by Phylogenetic, the individuality of each Juniperus Linn. species can gather separately one independently in hereditary branch, corresponding to these species itself, makes can accurately distinguish between these species.
2. the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn. according to claim 1, it is characterized in that, described 2 × CTAB solution is cetyl trimethylammonium bromide solution, its composition is: 100mmol/L Tris-HCl PH8.0,1.4mol/LNaCl, 20mmol/L disodium ethylene diamine tetraacetate and 2%CTAB.
3. the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn. according to claim 1, is characterized in that, the volume ratio of described chloroform-isoamyl alcohol solution is 24:1.
4. the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn. according to claim 1, is characterized in that, described dehydrated alcohol needs in advance-20 DEG C of refrigerator precoolings more than 2 hours.
5. the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn. according to claim 1, it is characterized in that, the PH of described distilled water is greater than 7.0.
6. the molecular method of the nearly edge species of a kind of quick discriminating Juniperus Linn. according to claim 1, is characterized in that, the sequence of described nuclear gene Chi1 primer is, forward: GGCGGCGGAGATTACTGTA, oppositely: TAGAAGACGCGCATTTGAGAA.
CN201410577132.0A 2014-10-24 2014-10-24 Molecular method for quickly identifying closely related species of juniperus Active CN104263846B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410577132.0A CN104263846B (en) 2014-10-24 2014-10-24 Molecular method for quickly identifying closely related species of juniperus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410577132.0A CN104263846B (en) 2014-10-24 2014-10-24 Molecular method for quickly identifying closely related species of juniperus

Publications (2)

Publication Number Publication Date
CN104263846A true CN104263846A (en) 2015-01-07
CN104263846B CN104263846B (en) 2017-02-22

Family

ID=52155420

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410577132.0A Active CN104263846B (en) 2014-10-24 2014-10-24 Molecular method for quickly identifying closely related species of juniperus

Country Status (1)

Country Link
CN (1) CN104263846B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106226137A (en) * 2016-08-10 2016-12-14 浙江大学 A kind of method of quick detection Brassica genus hexaploid new germ plasm ploidy
CN107488658A (en) * 2017-09-26 2017-12-19 三亚市南繁科学技术研究院 A kind of extracting method of the muskmelon seedses complete genome DNA without plumule
CN110885876A (en) * 2019-12-06 2020-03-17 华侨大学 Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus
CN111926106A (en) * 2020-09-15 2020-11-13 内蒙古农业大学 Oriental juniper SSR molecular marker and application thereof
CN117866826A (en) * 2024-01-09 2024-04-12 大连海洋大学 Marine heterotrophic nitrification-aerobic denitrification bacterium with high dissolved oxygen characteristic and denitrification application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ZHANG Q: "Phylogeography of the Qinghai-Tibetan Plateau endemic Juniperus przewalskii（Cupressaceae）inferred from chloroplast DNA sequence variation", 《MOL ECOL》 *
ZHONGHU LI: "Population genetic evidence for complex evolutionary histories of four high altitide juniper species in the Qinghai-Tibetan Plateau", 《EVOLUTION》 *
李忠虎: "西藏圆柏复合体的群体遗传学及物种形成研究", 《中国博士学位论文全文数据库 农业科技辑》 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106226137A (en) * 2016-08-10 2016-12-14 浙江大学 A kind of method of quick detection Brassica genus hexaploid new germ plasm ploidy
CN106226137B (en) * 2016-08-10 2019-04-23 浙江大学 A kind of method of quick detection Brassica genus hexaploid new germ plasm ploidy
CN107488658A (en) * 2017-09-26 2017-12-19 三亚市南繁科学技术研究院 A kind of extracting method of the muskmelon seedses complete genome DNA without plumule
CN107488658B (en) * 2017-09-26 2021-03-30 三亚市南繁科学技术研究院 Method for extracting whole genome DNA of muskmelon seeds without germs
CN110885876A (en) * 2019-12-06 2020-03-17 华侨大学 Method for quickly extracting, analyzing and identifying DNA outside pen container tree nucleus
CN111926106A (en) * 2020-09-15 2020-11-13 内蒙古农业大学 Oriental juniper SSR molecular marker and application thereof
CN111926106B (en) * 2020-09-15 2022-06-21 内蒙古农业大学 Oriental juniper SSR molecular marker and application thereof
CN117866826A (en) * 2024-01-09 2024-04-12 大连海洋大学 Marine heterotrophic nitrification-aerobic denitrification bacterium with high dissolved oxygen characteristic and denitrification application thereof

Also Published As

Publication number Publication date
CN104263846B (en) 2017-02-22

Similar Documents

Publication Publication Date Title
CN104263846B (en) Molecular method for quickly identifying closely related species of juniperus
CN101130815B (en) PCR-RFLP identification method for seven crassostrea oyster on south China coast
US20210207226A1 (en) Dna barcoding-based method for rapid identification of lycium chinensis
CN112080557A (en) DNA barcode-based method for identifying producing area of cordyceps sinensis
CN106048038B (en) Chinese giant salamander population division method based on mitochondrial DNA sequence
CN105112557B (en) The method of Rapid identification epidendrum
CN108384885B (en) Cinnamomum camphora SSR primer combination and variety identification method thereof
CN103509869B (en) Method for identifying juglans plant by using UBE3 gene-based nucleotide formula
CN104988240A (en) Method for identifying swarm royal jelly high yield character with SNP mark rs16287910
CN106399474B (en) A kind of dry medicinal material method for identifying molecules of dendrobium candidum and its application
CN114703314A (en) Molecular marker SSR primer for identifying variety genetic relationship and variety of rehmannia glutinosa, kit and application
CN113718050A (en) Molecular characteristic SSR primer and method for identifying Chinese torreya polyploid varieties
CN111733273A (en) DNA barcode sequence and method for identifying lycium species by using same
CN111733272A (en) DNA bar code from Chinese wolfberry chloroplast and method for identifying Chinese wolfberry species by using same
Faida et al. Genetic diversity and structure of natural populations of'Arbutus unedo'across altitude, bioclimate and geographical origin as revealed by ISSR markers
CN108504762B (en) Molecular marker primer and method for identifying big almond, Siberian apricot and fresh apricot
CN113684308B (en) Sakura SSR molecular marker primer and application thereof in 20 sakura variety identification
CN114277172B (en) SSR multiple detection primer, kit and method for identifying pithecaria verrucosa varieties
CN110283930B (en) SSR fingerprint of 6 Huaiyuan pomegranate excellent varieties and construction method and application thereof
CN103667487B (en) Based on the method for EST-SSR Marker Identification Loquat Cultivars
CN110283931B (en) SSR fingerprint of 6 good varieties of pomegranate in Anhui, Huaihei and China, and construction method and application thereof
CN114634991B (en) InDel marker for identifying high-variety coconuts and application thereof
CN112831593B (en) SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof
CN109943659B (en) Primer for identifying purity of Jinyankuai green No. 1 pakchoi seeds and application of primer
CN113981124B (en) Sakura SSR molecular marker primer and application thereof in identification of 42 sakura varieties

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20200722

Address after: Room 304, science and education building, 151 Jiandong street, Beilin District, Xi'an City, Shaanxi Province

Patentee after: SHAANXI FUNCTIONAL FOOD ENGINEERING CENTER Co.,Ltd.

Address before: Taibai Road Shaanxi Beilin District 710069 city of Xi'an province No. 229

Patentee before: NORTHWESTERN University