CN106987584B - Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar - Google Patents
Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar Download PDFInfo
- Publication number
- CN106987584B CN106987584B CN201710152159.9A CN201710152159A CN106987584B CN 106987584 B CN106987584 B CN 106987584B CN 201710152159 A CN201710152159 A CN 201710152159A CN 106987584 B CN106987584 B CN 106987584B
- Authority
- CN
- China
- Prior art keywords
- primer
- sugarcane
- sugar
- dna
- white sugar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
Abstract
The invention relates to an enrichment method of transgenic sugarcane white sugar DNA and an identification method of transgenic sugarcane white sugar. The method realizes the process of simply dissolving in water, extracting by chloroform and precipitating by isopropanol for 2-3 times, realizes the enrichment of residual DNA, simultaneously achieves the aim of completely removing sugar, further purifies by a DNA purification or extraction kit and removes short-fragment DNA fragments, has simple operation and low cost, and can stably extract a high-quality DNA template from sugar cane sugar for RT-PCR detection. Meanwhile, aiming at the characteristics of serious degradation and short fragment of residual DNA in the white sugar, a series of primers for amplifying endogenous and exogenous genes of the short fragment are designed, specific primers with excellent amplification effect are screened for detection, and the transgenic sugarcane white sugar and non-transgenic sugarcane white sugar can be stably and sensitively distinguished.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an enrichment method of transgenic sugarcane white sugar DNA and an identification method of transgenic sugarcane white sugar.
Background
Sugarcane is the most important sugar crop in the world and is highly produced in tropical and subtropical regions. Meanwhile, sugarcane is a biological energy crop, the yield of Brazilian sugarcane reaches 5.6 hundred million tons from 4 months to 3 months in 2012, more than half of the sugarcane is used for producing ethanol, and the sugarcane is the second major ethanol producing country in the world, and nearly half of automobiles in the country use ethanol gasoline. Along with the increasing shortage of petroleum, biological energy sources are further valued, the high light efficiency of sugarcane is high, the biological energy source crop with high biomass is also promoted, and the genetic improvement of sugarcane varieties is also valued. However, due to the complex genetic background factors of sugarcane and flowering characteristics thereof, the sugarcane is difficult to genetically improve compared with other crops through a traditional breeding mode. The gene engineering transgenic technology becomes an important approach for the genetic improvement of sugarcane varieties.
At present, many cases exist for successfully carrying out genetic improvement on sugarcane varieties through genetic engineering transgenic technology at home and abroad, and new varieties which can improve sugar content, stress resistance and plant type are obtained. However, these new varieties are not approved for open production and therefore transgenic sugarcane is not allowed for sucrose production and entry into the food market. However, with the continuous understanding of transgenic crops, especially the increasing proportion of sugarcane used for producing ethanol, new varieties of transgenic sugarcane with good quality will soon be allowed for field production. Then once transgenic sugarcane is allowed for field production, there is an ongoing concern about food safety. White sugar is mainly derived from sugar cane, so when transgenic sugar cane is allowed for field production, a technique must be available to identify whether white sugar is derived from transgenic sugar cane. Therefore, a stable and sensitive technical method is required to be established to distinguish whether the white sugar is the transgenic sugarcane white sugar.
The sugar cane sugar is produced by cutting and crushing sugar cane, squeezing juice and filtering, high temperature distillation, crystallization and separation. Particularly, the high-temperature distillation and the crystallization separation cause the sugar cane sugar to have extremely low content of nucleic acid and serious degradation. Therefore, the extraction efficiency and quality of sugar cane sugar DNA must be improved, and a DNA detection technology with higher sensitivity is adopted.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a stable and effective method for extracting and detecting sugar DNA of transgenic sugarcane.
The first aspect of the invention provides a method for enriching sugar cane sugar DNA, which is characterized by comprising the following steps:
s1, taking white sugar;
s2, adding ddH2O, dissolving;
s3, adding a chloroform/isoamylol mixed solution with the volume ratio of 24:1, shaking uniformly, centrifuging, and taking supernatant;
s4, adding 3M NaAc with the volume of 0.05-0.2;
s5, adding 0.8-1.2 volume of isopropanol, precipitating at-15 deg.C for 30-60min, centrifuging, and collecting precipitate;
s6, repeating the steps S2-S5 for 2-3 times;
and S7, washing the precipitate with 65-85% ethanol, and drying to obtain the product.
Preferably, ddH2The volume ratio of the mixed solution of O and chloroform/isoamylol is 1: 0.8-1.2.
The second aspect of the invention provides a method for identifying transgenic sugarcane white sugar, which comprises the following steps:
(1) taking sugar cane sugar to be tested, enriching sugar cane sugar DNA according to the method of the first aspect of the invention,
(2) purifying the DNA obtained in the step (1) to remove short fragments;
(3) designing an endogenous gene primer group and an exogenous gene primer group, and carrying out RT-PCR detection.
Wherein, the purification method in the step (2) can be completed by a purification kit such as PCR reaction, enzymatic reaction, sequencing reaction and the like, and can also be completed by a plant DNA small-amount extraction kit. The specific method can be referred to the instructions of various DNA purification kits.
Preferably, the endogenous gene primer group is a primer pair for amplifying the sugarcane endogenous gene ShSAP1, and the sequence of a forward primer of the primer pair is shown as SEQ ID NO: 1, the sequence of the reverse primer is shown as SEQIDNO: 2, respectively.
Preferably, the exogenous gene primer group is a primer pair for amplifying the sugarcane exogenous gene CP4-EPSPS, and/or a primer pair for amplifying the sugarcane exogenous gene Cry1Ab, and/or a primer pair for amplifying the sugarcane exogenous gene Vip3 Aa.
Further preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane exogenous gene CP4-EPSPS is as shown in SEQ ID NO: 3, the sequence of the reverse primer is shown as SEQIDNO: 4, respectively.
Further preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane foreign gene Cry1Ab is shown as SEQ ID NO: 5, the sequence of the reverse primer is shown as SEQ ID NO: and 6.
Further preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane foreign gene Vip3Aa is as shown in SEQ ID NO: 7, the sequence of the reverse primer is shown as SEQ ID NO: shown in fig. 8.
Preferably, the RT-PCR assay is: judging whether DNA for RT-PCR detection is extracted from white sugar or not according to Ct value, amplification curve and dissolution curve of endogenous gene primer group amplification; then judging whether the sugar is transgenic sugarcane white sugar or not according to the size of an amplification curve Ct of the exogenous gene primer group and whether a dissolution curve is consistent with a positive control or not; wherein, positive control and negative control are required to be arranged in the detection process.
Preferably, the annealing temperature of the primer is 58-62 ℃, and the amplified fragment is 80-120 bp.
The third aspect of the invention provides a primer composition for identifying sugar cane sugar, which comprises an exogenous gene primer group and an endogenous gene primer group, wherein the endogenous gene primer group is a primer pair for amplifying the sugarcane endogenous gene ShSAP1, and the exogenous gene primer group is a primer pair for amplifying the sugarcane exogenous gene CP4-EPSPS, and/or a primer pair for amplifying the sugarcane exogenous gene Cry1Ab, and/or a primer pair for amplifying the sugarcane exogenous gene Vip3 Aa.
Preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane endogenous gene ShSAP1 is shown as SEQ ID NO: 1, the sequence of the reverse primer is shown as SEQIDNO: 2, respectively.
Preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane exogenous gene CP4-EPSPS is as shown in SEQ ID NO: 3, the sequence of the reverse primer is shown as SEQIDNO: 4, respectively.
Preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane foreign gene Cry1Ab is shown as SEQ ID NO: 5, the sequence of the reverse primer is shown as SEQ ID NO: and 6.
Preferably, the sequence of the forward primer of the primer pair for amplifying the sugarcane foreign gene Vip3Aa is shown as SEQ ID NO: 7, the sequence of the reverse primer is shown as SEQ ID NO: shown in fig. 8.
In a fourth aspect, the invention provides a kit for identifying transgenic sugarcane white sugar, which contains the primer composition of the third aspect.
The invention has the following beneficial effects:
the method realizes the process of simply dissolving in water, extracting by chloroform and precipitating by isopropanol for 2-3 times, realizes the enrichment of residual DNA, simultaneously achieves the aim of completely removing sugar, further purifies by a DNA purification or extraction kit and removes short-fragment DNA fragments, has simple operation and low cost, and can stably extract a high-quality DNA template from sugar cane sugar for RT-PCR detection. Meanwhile, aiming at the characteristics of serious degradation and short fragment of residual DNA in the white sugar, a series of primers for amplifying endogenous and exogenous genes of the short fragment are designed, specific primers with excellent amplification effect are screened for detection, and the transgenic sugarcane white sugar and non-transgenic sugarcane white sugar can be stably and sensitively distinguished.
Drawings
FIG. 1 is a photograph of transgenic white sugar.
FIG. 2 shows the result of RT-PCR detection of endogenous gene in sugarcane leaf tissue DNA.
FIG. 3 is the RT-PCR detection amplification curve of transgenic sugarcane sugar endogenous gene ShSAP 1.
FIG. 4 is a RT-PCR detection dissolution curve of transgenic sugarcane sugar endogenous gene ShSAP 1.
FIG. 5 is an RT-PCR detection amplification curve of a transgenic sugarcane white sugar exogenous gene Cry1 Ab.
FIG. 6 is a RT-PCR detection dissolution curve of a transgenic sugarcane white sugar exogenous gene Cry1 Ab.
FIG. 7 is the RT-PCR detection amplification curve of transgenic sugarcane sugar exogenous gene EPSPS.
FIG. 8 is RT-PCR detection dissolution curve of transgenic sugarcane sugar exogenous gene EPSPS.
FIG. 9 is an RT-PCR detection amplification curve of a transgenic sugarcane white sugar exogenous gene Vip3 Aa.
FIG. 10 is a RT-PCR detection dissolution curve of a transgenic sugarcane white sugar exogenous gene Vip3 Aa.
Detailed Description
The invention will be better understood from the following further description of embodiments thereof, with reference to the accompanying drawings.
Firstly, experimental materials:
transgenic sugarcane white sugar (figure 1), wherein the raw material sugarcane is derived from transgenic sugarcane obtained in early-stage research of a research laboratory, and is processed into white sugar in small batches by a sugar factory white sugar production process simulated by Yunnan Kangyuan sugarcane research institute, and the raw material sugarcane contains exogenous genes: the herbicide-resistant gene EPSPS, the borer-resistant gene Cry1Ab and the borer-resistant gene Vip3Aa are selected from ROC 22.
Second, primer screening
1. Fluorescent quantitative PCR detection primer screening for ShSAP1 endogenous gene
Aiming at the endogenous gene ShSAP1 gene of sugarcane, a plurality of pairs of primers of which the amplified fragments are about 100bp are designed. Genomic DNA of transgenic sugarcane leaf was extracted according to the conventional CTAB method at an initial concentration of 0.2. mu.g/. mu.l and subjected to 50-fold, 100-fold, and 200-fold gradient dilution, and then each ShSAP1 primer was added to each dilution for amplification. After amplification, analyzing an amplification curve and a dissolution curve, and screening a primer pair for fluorescent quantitative PCR detection of the ShSAP1 endogenous gene with the best amplification effect, wherein the primers are as follows:
ShSAP-F:TTCGACTATCGGACTGCTGC
ShSAP-R:TGAGCCAACCGTAGGAAACC
in the same way, primer pairs with the best amplification effect of other exogenous genes Cry1Ab, EPSPS and Vip3Aa are obtained, and are respectively as follows:
exogenous gene Cry1 Ab:
Cry1Ab-F:ATCACCATCTACACCGACGC
Cry1Ab-R:CGTACAGGGGGAAGGTGAAC
exogenous gene EPSPS:
EPSPS-F:GGATCACAGGATCGCCATGT
EPSPS-R:GGTCCATGAACTCGGGGAAG
exogenous gene Vip3 Aa:
Vip3Aa-F:GATCGGCTTCGAGATCAGCA
Vip3Aa-R:ATCACCTCGCTCAAGCTGTC
thirdly, extracting transgenic sugar cane sugar DNA
Weighing 10g of transgenic sugarcane white sugar, adding 20ml of ddH into a 50ml centrifuge tube2And O, performing warm bath to fully dissolve the white sugar, adding 20ml of chloroform/isoamyl alcohol (24:1), shaking and shaking uniformly, and centrifuging at 12000rpm for 10 min. Collecting supernatant, adding 1/10 volume of 3M NaAc solution, adding equal volume of precooled isopropanol, precipitating at-20 deg.C for 30-60min, and centrifuging at 12000rpm for 10 min. The supernatant was decanted off, the three tubes were combined and dissolved together in 20ml ddH2And O, carrying out warm bath to fully dissolve the precipitate, adding 1/10 volumes of 3M NaAc solution, adding equal volume of precooled isopropanol, precipitating at the temperature of minus 20 ℃ for 30-60min, and centrifuging at 12000rpm for 10 min. Washing the precipitate with 75% ethanol, drying, dissolving in 100ul ddH2O or TE, namely the transgenic sugarcane sugar DNA.
Fourth, transgenic sugar cane sugar DNA purification
Following the procedures of AxyPrep PCR clean kit (recovery fragment >75bp) provided by AxyGen Biotechnology (Hangzhou) Ltd:
adding Buffer PCR-A with the volume of 3 times that of the reaction solution into the white sugar DNA dissolving solution extracted in the previous step, uniformly mixing, transferring the mixture into A preparation tube, placing the preparation tube into A 2ml centrifuge tube, centrifuging, and removing the filtrate.
The preparation tube was placed back into a 2ml centrifuge tube, 700ul Buffer W2 was added, and the tube was washed twice. Finally, centrifuge once without BufferW 2.
Air drying the prepared tube, placing in a 1.5ml centrifuge tube, adding 30-50ul deionized H in the center of the prepared tube2And O, standing at room temperature for 1min, and centrifugally eluting the DNA.
The obtained eluent is the purified transgenic sugar cane sugar DNA.
Five, transgenic sugarcane sugar endogenous gene detection
Taking sugarcane leaf tissue DNA (concentration gradient of 100ng/ul, 10ng/ul, 1ng/ul, 0.1ng/ul and 0.01ng/ul) as a positive control, taking transgenic sugarcane white sugar DNA to be detected as a template, and adding sugarcane endogenous gene primers
ShSAP-2F:TTCGACTATCGGACTGCTGC；
ShSAP-2R:TGAGCCAACCGTAGGAAACC，
RT-PCR detection is carried out. Each reaction was repeated 2-3 times, and the amplification system was as follows:
| substance(s) | Volume of | Final concentration |
| DNA template | 3.0ul | On demand |
| Forward primer (10uM) | 0.2ul | 0.2uM |
| Reverse primer (10uM) | 0.2ul | 0.2uM |
| qPCR Mix | 5.0ul | 1* |
| Inert reference dyes | 0.2ul | 1* |
| ddH2O | 1.4ul | - |
| Total volume | 10ul | - |
And finally, separating.
And judging whether the DNA for RT-PCR detection is extracted from the white sugar or not according to the white sugar DNA amplified by the endogenous gene primer and the Ct value, the amplification curve and the dissolution curve of the positive control.
The detection result of the endogenous gene of the sugarcane leaf tissue DNA is shown in figure 2, and the concentration of the sugarcane leaf tissue DNA is as follows: the mean values of Ct values detected by RT-PCR are respectively 100ng/ul, 10ng/ul, 1ng/ul, 0.1ng/ul and 0.01 ng/ul: 21.55, 23.93, 27.57, 31.59 and 35.43.
The detection results of the sugar DNA endogenous gene of the transgenic sugarcane are shown in FIG. 3 (amplification curve) and FIG. 4 (dissolution curve). The mean value of Ct values detected by RT-PCR of the transgenic sugarcane white sugar is 32.65, and is consistent with the dissolution curve of a positive control. Shows that DNA which can be used for RT-PCR detection is successfully extracted from transgenic sugarcane white sugar. Compared with the amplified Ct of the sugarcane leaf tissue DNA with different concentration gradients, the extracted white sugar template amount of the transgenic sugarcane is between 0.1ng/ul and 0.01ng/ul, and the method can be continuously used for detecting exogenous genes.
Sixth, detection of transgenic sugarcane white sugar exogenous gene Cry1Ab
Adding primers of an exogenous gene Cry1Ab into the DNA of the extracted transgenic sugarcane white sugar serving as a detection template (GM-white sugar), the DNA of transgenic sugarcane leaf tissue serving as a positive control (CK +), the DNA of non-transgenic sugarcane white sugar serving as a negative control (CK-):
Cry1Ab-F:ATCACCATCTACACCGACGC；
Cry1Ab-R:CGTACAGGGGGAAGGTGAAC，
RT-PCR detection is carried out. The results are shown in FIG. 5 (amplification curve) and FIG. 6 (dissolution curve), the mean value of Ct value is 32.47, the dissolution curve is the same as that of the positive control, and CK-has no Ct value, which indicates that the exogenous gene Cry1Ab is detected from sugar cane sugar by RT-PCR.
Seventhly, detecting transgenic sugarcane white sugar exogenous gene EPSPS
Adding primers of exogenous gene EPSPS into the DNA of the extracted transgenic sugarcane white sugar as a detection template (GM-white sugar), the DNA of transgenic sugarcane leaf tissue as a positive control (CK +), the DNA of non-transgenic sugarcane white sugar as a negative control (CK-):
EPSPS-F:GGATCACAGGATCGCCATGT；
EPSPS-R:GGTCCATGAACTCGGGGAAG，
RT-PCR detection is carried out. The results are shown in FIG. 7 (amplification curve) and FIG. 8 (dissolution curve), the mean value of Ct value is 30.31, the dissolution curve is the same as that of the positive control, and CK-has no Ct value, which indicates that the exogenous gene EPSPS is detected from sugar cane sugar by RT-PCR.
Eighthly, detecting transgenic sugarcane white sugar exogenous gene Vip3Aa
Adding primers of an exogenous gene Vip3Aa into the DNA of the extracted transgenic sugarcane white sugar serving as a detection template (GM-white sugar), the DNA of transgenic sugarcane leaf tissue serving as a positive control (CK +), the DNA of non-transgenic sugarcane white sugar serving as a negative control (CK-):
Vip3Aa-F:GATCGGCTTCGAGATCAGCA；
Vip3Aa-R:ATCACCTCGCTCAAGCTGTC，
RT-PCR detection is carried out. The results are shown in FIG. 9 (amplification curve) and FIG. 10 (dissolution curve), with a mean Ct value of 32.50, the same dissolution curve as the positive control, and CK-no Ct value, indicating that the foreign gene Vip3Aa was detected from sugar cane sugar by RT-PCR.
The experimental results prove that: by the method for extracting, collecting and purifying the white sugar DNA, DNA which can be used for RT-PCR detection can be effectively extracted from the white sugar. The foreign gene residual in the transgenic sugarcane white sugar can be accurately detected by combining an SYBR Green I real-time fluorescent quantitative PCR method with the foreign gene primer, so that an effective and sensitive method is provided for detecting whether the sugarcane white sugar is derived from the transgenic sugarcane.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> research institute of tropical biotechnology of Chinese tropical academy of agricultural sciences
<120> enrichment method of transgenic sugarcane white sugar DNA and identification method of transgenic sugarcane white sugar
<130>123456
<160>8
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213>Artificial
<220>
<223>ShSAP-F
<400>1
ttcgactatc ggactgctgc 20
<210>2
<211>20
<212>DNA
<213>Artificial
<220>
<223>ShSAP-R
<400>2
<210>3
<211>20
<212>DNA
<213>Artificial
<220>
<223>Cry1Ab-F
<400>3
<210>4
<211>20
<212>DNA
<213>Artificial
<220>
<223>Cry1Ab-R
<400>4
<210>5
<211>20
<212>DNA
<213>Artificial
<220>
<223>EPSPS-F
<400>5
<210>6
<211>20
<212>DNA
<213>Artificial
<220>
<223>EPSPS-R
<400>6
<210>7
<211>20
<212>DNA
<213>Artificial
<220>
<223>Vip3Aa-F
<400>7
gatcggcttc gagatcagca 20
<210>8
<211>20
<212>DNA
<213>Artificial
<220>
<223>Vip3Aa-R
<400>8
atcacctcgc tcaagctgtc 20
Claims (4)
1. The method for enriching sugar cane sugar DNA is characterized by comprising the following steps:
s1, taking white sugar;
s2, adding ddH2O, dissolving;
s3, adding chloroform/isoamyl alcohol mixed solution with volume ratio of 24:1, shaking, centrifuging, collecting supernatant, and adding ddH2The volume ratio of the mixed solution of O and chloroform/isoamylol is 1: 0.8-1.2;
s4, adding 3M NaAc with the volume of 0.05-0.2;
s5, adding 0.8-1.2 volume of isopropanol, precipitating at-15 deg.C for 30-60min, centrifuging, and collecting precipitate;
s6, repeating the steps S2-S5 for 2-3 times;
and S7, washing the precipitate with 65-85% ethanol, and drying to obtain the product.
2. The identification method of transgenic sugarcane white sugar is characterized by comprising the following steps:
(1) collecting sugar cane sugar to be tested, enriching sugar cane sugar DNA according to the method of claim 1,
(2) purifying the DNA obtained in the step (1) to remove short fragments;
(3) designing an endogenous gene primer group and an exogenous gene primer group, carrying out RT-PCR detection,
wherein the endogenous gene primer group is a primer pair for amplifying sugarcane endogenous gene ShSAP1, and the sequence of a forward primer of the primer pair is shown as SEQ ID NO: 1, the sequence of the reverse primer is shown as SEQIDNO: 2 is shown in the specification; the exogenous gene primer group is a primer pair for amplifying a sugarcane exogenous gene CP4-EPSPS, and/or a primer pair for amplifying a sugarcane exogenous gene Cry1Ab, and/or a primer pair for amplifying a sugarcane exogenous gene Vip3Aa, wherein,
the sequence of the forward primer of the primer pair for amplifying the sugarcane exogenous gene CP4-EPSPS is shown as SEQ ID NO: 3, the sequence of the reverse primer is shown as SEQIDNO: 4 is shown in the specification;
the sequence of a forward primer of a primer pair for amplifying the sugarcane exogenous gene Cry1Ab is shown as SEQ ID NO: 5, the sequence of the reverse primer is shown as SEQ ID NO: 6 is shown in the specification;
the sequence of a forward primer of a primer pair for amplifying the sugarcane exogenous gene Vip3Aa is shown as SEQ ID NO: 7, the sequence of the reverse primer is shown as SEQ ID NO: shown in fig. 8.
3. The method of claim 2, wherein the RT-PCR assay is: judging whether DNA for RT-PCR detection is extracted from white sugar or not according to Ct value, amplification curve and dissolution curve of endogenous gene primer group amplification; then judging whether the sugar is transgenic sugarcane white sugar or not according to the size of an amplification curve Ct of the exogenous gene primer group and whether a dissolution curve is consistent with a positive control or not; wherein, positive control and negative control are required to be arranged in the detection process.
4. The method of claim 2, wherein the primer anneals at 58-62 ℃ and the amplified fragment is 80-120 bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710152159.9A CN106987584B (en) | 2017-03-15 | 2017-03-15 | Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710152159.9A CN106987584B (en) | 2017-03-15 | 2017-03-15 | Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106987584A CN106987584A (en) | 2017-07-28 |
| CN106987584B true CN106987584B (en) | 2020-04-07 |
Family
ID=59411685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710152159.9A Active CN106987584B (en) | 2017-03-15 | 2017-03-15 | Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106987584B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112391490B (en) * | 2020-11-19 | 2024-06-28 | 中国热带农业科学院热带生物技术研究所 | Exogenous insert fragment flanking sequence of transgenic sugarcane event SCAG5 and strain specificity detection method thereof |
| CN112375838B (en) * | 2020-11-19 | 2024-06-28 | 中国热带农业科学院热带生物技术研究所 | T-DNA flanking sequence of transgenic sugarcane SCAG2 and transformation event specificity identification method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586428A (en) * | 2016-03-10 | 2016-05-18 | 中国热带农业科学院热带生物技术研究所 | Primer composition and kit for identifying transgenic sugarcane brown sugar and detection method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450678A (en) * | 2014-11-04 | 2015-03-25 | 青岛康大分析检测有限公司 | Method for extracting DNA of genetically modified organism soya bean oil |
-
2017
- 2017-03-15 CN CN201710152159.9A patent/CN106987584B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586428A (en) * | 2016-03-10 | 2016-05-18 | 中国热带农业科学院热带生物技术研究所 | Primer composition and kit for identifying transgenic sugarcane brown sugar and detection method |
Non-Patent Citations (2)
| Title |
|---|
| GenBank 登录号：HM991960.1;Li,X. 等;《NCBI》;20100830;参见序列部分 * |
| 白砂糖DNA提取方法的比较;齐玲倩 等;《食品与发酵工业》;20161231;第42卷(第11期);第244-248页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106987584A (en) | 2017-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sah et al. | Rapid and reliable method of high-quality RNA extraction from diverse plants | |
| CN106987584B (en) | Method for enriching transgenic sugarcane white sugar DNA and method for identifying transgenic sugarcane white sugar | |
| CN111206106A (en) | RPA primer, kit and detection method for detecting sweet potato rot stem nematode | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| CN113637804B (en) | Kit for detecting RB-N1 genotype citrus tristeza virus based on RT-PCR technology and detection method thereof | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| JP6466725B2 (en) | Assisting identification of eel species | |
| WO2023087783A1 (en) | Dna barcode for screening floccularia luteovirens having high total fat content | |
| CN113862394B (en) | RPA detection method for tomato infertility virus | |
| CN109112190B (en) | Corbicula fluminea mitochondrial genome enrichment extraction and identification method | |
| CN109112194B (en) | Application of cynoglossus semilaevis sex label piR-mmu-72274 | |
| CN117363783B (en) | LMTIA detection method of corn component in food by using sweet protein-like gene as target sequence and application of LMTIA detection method | |
| CN112342317A (en) | Nucleic acid sequence combination, kit and detection method for LAMP-CRISPR (loop-mediated isothermal amplification-CRISPR) isothermal detection of IHHNV (infectious bronchitis Virus) | |
| CN110616270A (en) | COI gene sequence-based molecular identification method of beta and beta | |
| CN117965810B (en) | ToBRFV RT-qPCR specific detection primer, RT-qPCR detection method and application | |
| CN114958989B (en) | Treatment fluid, amplification system and kit for rapid and direct double PCR amplification | |
| CN110578018B (en) | LAMP (loop-mediated isothermal amplification) method for rapidly detecting nuclear polyhedrosis virus | |
| CN114561479B (en) | Primer for identifying iron-shell shrimp individuals in macrobrachium rosenbergii and application of primer | |
| CN110592074B (en) | Rapid algae DNA extraction method | |
| CN116103369B (en) | Potato total RNA rapid extraction method and potato virus RT-PCR detection method | |
| CN110656186B (en) | Kit and method for rapidly identifying walnut black spot aphids | |
| CN115976275A (en) | Multi-RT-PCR primer group for simultaneously detecting 4 CTV genotypes, kit and application | |
| CN112538527B (en) | Primer and probe combination and kit for detecting human leukocyte antigen B site 1502 gene | |
| TWI480376B (en) | Method for identification of thrips |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |