CN110862987A

CN110862987A - Lotus bean 12GmNCED1 gene salt-induced promoter and application thereof

Info

Publication number: CN110862987A
Application number: CN201911235474.3A
Authority: CN
Inventors: 向凤宁; 王禄利; 李朔; 刘振华; 郑晓健
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2019-12-05
Filing date: 2019-12-05
Publication date: 2020-03-06

Abstract

The invention discloses a salt-induced promoter of a soybean lotus 12GmNCED1 gene, wherein the nucleotide sequence of the promoter is shown as SEQ ID NO. 1 or has more than 90% homology with the nucleotide sequence shown as SEQ ID NO. 1, and has DNA sequences with the same functions. The invention also discloses application of the gene promoter in improving the expression of a reporter gene in arabidopsis thaliana under salt stress. Experiments prove that under the salt induction, the promoter can up-regulate the expression of a driving reporter gene in transgenic arabidopsis, so that the research on a salt tolerance regulation mechanism of the GmNCED1 gene is realized, a sequence material is provided for obtaining a universal salt-induced promoter, and a foundation is provided for the application of the promoter in cultivating salt-resistant crop varieties.

Description

Lotus bean 12GmNCED1 gene salt-induced promoter and application thereof

Technical Field

The invention relates to a promoter, in particular to a salt-induced promoter of a soybean lotus 12GmNCED1 gene and application thereof.

Background

Soybean (Glycine max.) contains rich vegetable protein, fat and various active substances beneficial to human body, is an important source of active substances of important protein, oil and health care products, is a high-quality raw material for various processing industries such as food, feed and the like, and is in an important position in national economy. Soybean, Leguminosae (Fabaceae), Glycine (Glycine), belongs to the light earth plant, has poor salt tolerance, and the high saline-alkali content of the land limits the development of soybean planting (Wangzhen et al, 1993).

The transcription factor is interacted with cis-acting on the downstream gene promoter to regulate the expression mode of the gene and participate in various physiological activities of the organism, and the research of cis-acting elements has great significance in mastering the whole regulation and control network of the organism. 9-cis-epoxycarotenoid dioxygenase, NCED, belongs to the family member of carotenoid dioxygenase (CCDs) and is considered as the most key rate-limiting enzyme (Bao-Cai) in the ABA synthetic pathway in plants

Etc., 2003; schwartz et al, 2003). In recent years, in researches on crops such as wheat, arabidopsis thaliana and rice, drought stress can induce the up-regulation of NCED gene expression and the accumulation of endogenous ABA, and further induce the response of plants to the drought stress (Likang et al, 2010; Lijiayi et al, 2012; Xuzhong et al, 2018).

The expression of the stress-resistant gene in transgenic plants driven by the stress-inducible promoter is an effective method for cultivating new stress-resistant crop varieties. At present, few inducible promoters which can be applied to transgenic research are available, and the discovery of new stress-resistance-related promoters, cloning, cis-acting element analysis and research of transcription factors interacting with cis-elements are still important directions for future research. The current research is more intensive: abscisic acid-responsive element (ABRE), ethylene-responsive element (ERE), jasmonate-responsive element (JRE), low-temperature-responsive element (LTRE), and drought-responsive element (DRE) (Zhuilman, Zhuzhuang, etc.. plant stress-related promoter and function. Genesis.2010, 32(3):229- & 234). The NCED related gene is often responsive to various adversity stresses, and the main reason is that the gene promoter contains various adversity stress related cis-acting elements, such as: methyl jasmonate response element, anaerobic stress related element, ABA response element, etc. The promoter induced by various stresses can be obtained by researching the stress-related NCED gene promoter, and has important significance for constructing an effective stress-inducible promoter.

By comparing the gene expression profile changes of soybean materials under salt and non-salt conditions, the obvious change of the expression quantity of the GmNCED1 gene under salt treatment is found, and the overexpression vector of the gene is transferred into a model organism Arabidopsis thaliana, so that the transgenic Arabidopsis thaliana obtains the capability of expressing a GUS reporter gene. However, the regulatory gene and the involved signal pathway of the NCED gene are not clear, the research on the salt-induced promoter of the NCED gene can help to better explain the function of the NCED gene, and meanwhile, the research on the salt-induced characteristic of GmNCED1 can provide an important reference for obtaining a universal salt-induced promoter and can be used for cultivating transgenic salt-tolerant crops in the future.

Disclosure of Invention

The invention aims to provide a salt-induced promoter of a soybean lotus 12GmNCED1 gene and application thereof.

The salt-induced promoter of the lotus bean 12GmNCED1 gene is characterized in that: the nucleotide sequence of the promoter is one of the following nucleotide sequences:

a) the nucleotide sequence shown as SEQ ID No. 1 in the sequence table;

b) DNA sequence with more than 90% homology with the nucleotide sequence shown in SEQ ID No. 1 in the sequence table and the same function.

The invention also discloses a reporter gene GUS expression vector pGmNCED1 of the salt-induced promoter of the lotus bean 12GmNCED1 gene, pBGWFS7.

The application of the salt-induced promoter of the soybean lotus bean 12GmNCED1 gene disclosed by the invention in efficiently starting the expression of a target gene under the induction of salt stress.

The application of the lotus bean 12GmNCED1 gene salt-induced promoter in the cultivation of salt-tolerant transgenic plants.

Wherein: the plant is preferably Arabidopsis thaliana or soybean.

The invention discloses a salt-induced promoter of a lotus bean 12GmNCED1 gene, which is obtained by cloning in a lotus bean 12GmNCED1 plant. The applicant utilizes the Gateway system to connect the promoter of the 12GmNCED1 gene to a GUS reporter gene expression vector pBGWFS7 (see figure 2) through BP and LR reaction; pGmNCED 1-pBGWFS 7 vector was transferred into Agrobacterium strain GV3101, and transferred into model plant Arabidopsis thaliana through the transformed Agrobacterium strain to verify the function of the promoter of the GmNCED1 gene. And (3) confirming that: under the induction of salt, the promoter can up-regulate the expression of a driving reporter gene in transgenic arabidopsis thaliana.

The invention has the beneficial effects that: the invention obtains a 12GmNCED1 gene promoter of the soybean lotus bean by cloning, and drives a GUS reporter gene to express in arabidopsis thaliana, so that the transgenic arabidopsis thaliana has the capability of expressing the GUS gene and has stronger expression capability under the condition of salt induction. Through the transfection of arabidopsis thaliana, comparative analysis proves that the transgenic arabidopsis thaliana can express the reporter gene more efficiently under the salt induction than under the non-salt condition. The GmNCED1 gene promoter can be widely used for cultivating salt-tolerant transgenic plant varieties.

Drawings

FIG. 1 electrophoretic map of GmNCED1 gene promoter clone

Wherein: m is Marker, and

lanes

1 and 2 are promoter DNA.

Figure 2 is a schematic of the pbgwfs7.0 vector.

FIG. 3 shows pGmNCED1 the GUS transgenic Arabidopsis thaliana GUS staining results

Wherein: the taken picture is the result of staining of the whole transgenic arabidopsis thaliana plant, and it can be observed that the expression tissue part is mainly positioned in the root of arabidopsis thaliana, and the GUS signal expression is stronger after the treatment for 12 hours under the external application of 50mmol NaCl concentration than that without salt treatment. Wherein A is the dyeing condition without salt treatment, and B is the dyeing condition with salt treatment.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

In the following examples, the experimental methods used, which are not specifically described, are conventional methods, and reference is made, for example, to the molecular cloning laboratory Manual (Sambrook and Russell, 2001).

In the following examples, materials, reagents and the like used in the examples are commercially available unless otherwise specified.

Example 1 obtaining of the promoter of the Soybean GmNCED1 Gene

According to 1776bp sequence at the upstream of ATG of transcription initiation site of GmNCED1 gene found on NCBI website, promoter primer (F: 5 'CCTTTTCAACCACTAAACATCCTT 3', R: 5'GGTGAATGGTTTTTGTTTCTAATTT3') is designed. The genomic DNA of soybean 12 was extracted by CTAB method, and the extracted genomic DNA was diluted to 100ug/ul and used as an amplification promoter template. The GmNCED1 gene promoter was amplified using the high fidelity enzyme PrimerSTAR (Takara).

1.1 extraction of genomic DNA from Glycine max Nees 12

(1) Preheating CTAB extracting solution to 65 ℃ in water bath;

(2) putting the lotus 12 plant material into a mortar, and grinding the lotus 12 plant material into powder by using liquid nitrogen;

(3) after liquid nitrogen is volatilized, immediately transferring 100-200mg of plant powder into a 1.5ml centrifuge tube, then quickly adding 1ml of preheated CTAB extracting solution, gently reversing and uniformly mixing, and carrying out water bath at 65 ℃ for 30 min;

(3) centrifuging at 12,000rpm for 10min, transferring 0.6ml of supernatant into a new 1.5ml centrifuge tube, cooling the extractive solution to room temperature, adding 0.36ml of phenol/chloroform/isoamyl alcohol (24:23:1), gently mixing for 5min, standing at room temperature for 10min to allow the liquid to separate;

(4) centrifuging at 12,000rpm for 10min, transferring 0.4ml of supernatant into a new 1.5ml centrifuge tube, adding 0.4ml of isopropanol, gently turning over for 15 times, mixing the solution, and standing at room temperature for 15 mm;

(5) centrifuging at 12,000rpm for 10min, discarding supernatant, adding 1ml 75% ethanol, washing precipitate, bouncing precipitate, centrifuging at 12,000rpm for 5min, and repeating twice;

(6) discarding the supernatant, uncovering the cover to dry the DNA for about 10min, adding 50 μ l of sterilized water, and fully dissolving the RNA for 10min at 60 ℃;

(7) the OD value and concentration of the RNA sample are measured by ultraviolet spectrophotometry, A260/A280 reaches 1.7-2.0, A230/A260 reaches 2.0-2.2, extracted DNA is extracted, 10 mu l of the concentration is diluted to 100 mu g/mu l to be used as a PCR template, and the rest is placed at-20 ℃ for standby.

1.2 cloning of the GmNCED1 Gene promoter

The reaction system for high fidelity PrimerSTAR amplification was as follows (50. mu.l system):

the amplification conditions were as follows:

after the reaction, the reaction solution was subjected to 0.8% TAE agarose gel electrophoresis. The electrophoresis results are shown in FIG. 1.

1.3 purification and recovery of cloned Gene fragment (Tiangen kit)

1) Putting the gel with the cut target fragment into a 1.5ml centrifuge tube, weighing the gel, adding sol solution with 3 times volume, and carrying out sol for 10min at 60 ℃, wherein the sol is continuously turned over during sol;

2) after the gel is completely melted, completely absorbing the gel into a recovery column, and placing for a moment;

3) centrifuging at 12000rpm for 30Sec at room temperature, and discarding the solution;

4) adding 700 μ l of rinsing solution into the column, centrifuging at 12000rpm for 1min, and discarding the rinsing solution;

5) adding 500 μ l of rinsing solution into the column, centrifuging at 12000rpm for 1min, and discarding the rinsing solution;

6) empty column, 12000rpm, centrifugation for 2 min;

7) opening the recovery column, air drying for 1-2min, placing into a new clean 1.5ml centrifuge tube, adding 40 μ l of sterilized water or EB buffer solution preheated at 60 deg.C, and standing for 2 min;

8) centrifuging at 12000rpm for 1min to obtain solution as recovered fragment.

1.4.1PCR amplification of the promoter fragment of GmNCED1 Gene containing attb linker

(1) High fidelity enzyme PrimerSTAR for the first round of amplification of Gateway system (20. mu.l system):

the amplification conditions were as follows:

1.4.2 purification and recovery of cloned Gene fragment (Tiangen kit) (same as 1.3)

1.5 ligation of GmNCED1 promoter with pdnor221 vector

Using the gateway (thermo scientific) system, the reaction system was as follows (20. mu.l system):

ligation was performed overnight at 25 ℃.

1.6 plasmid transformation of E.coli (sterile procedure)

(1) Adding 1-5 μ l plasmid DNA or ligation product into 50 μ l competent cell, flicking the centrifuge tube, mixing, and ice-cooling for 30 min;

(2) heating in warm water bath at 42 deg.C for 90sec, and immediately cooling in ice bath for 2-3 min;

(3) adding 1ml LB culture medium, culturing at 37 deg.C for 40-50 min;

(4) centrifuging at room temperature and 4000rpm for 3min, and collecting thallus;

(5) the bacteria were spread on culture plates containing the corresponding antibiotics and cultured overnight at 37 ℃ in an inverted state.

1.7 Escherichia coli PCR verification

The reaction system was as follows (20. mu.l system):

the amplification conditions were as follows:

after the reaction, the reaction solution was subjected to 0.8% TAE agarose gel electrophoresis.

1.8 Positive cloning shake bacteria quality-improving granule

Positive single colonies containing the recombinant plasmid were picked up in a 1.5ml EP tube and shaken overnight with liquid LB containing kan (50mg/L), then inoculated into 200ul of 100ml conical flask containing 20ml LB (containing 50mg/Lkan) and shaken overnight, and then 4ml of the bacterial solution was aspirated to extract the plasmid.

1.9 extraction of E.coli plasmid DNA pGmNCED1:: pdnor221 plasmid (Tiangen kit)

(1) Centrifuging at 12000rpm for 1min at room temperature, and collecting thallus;

(2) discarding the supernatant, adding 250 μ l of P1 precooled at low temperature, and oscillating the suspended bacteria;

(3) adding 250 solution P2, slightly reversing, mixing, and standing for 5 min;

(4) adding 350 μ l of solution P3 after the solution is clarified, gently mixing uniformly, and standing for 5 min;

(5) centrifuging at 12000rpm for 12min, adding 600 μ l BL balance solution into the filter column, standing at room temperature for 2min, centrifuging at 12000rpm for 1min, and pouring out the liquid in the collecting tube;

(6) transferring the upper water phase in the plasmid extraction tube into a filter column, centrifuging at 12000rpm for 1min at room temperature for 2min, and pouring out the liquid in the collection tube;

(7) adding 600 μ l of rinsing solution PW into the filter column, centrifuging at room temperature for 2min and 12000rpm for 1min, pouring out the liquid in the collecting tube, and repeating the steps once;

(8) placing adsorption column CP3 into collection tube, centrifuging at 12000rpm for 5 min;

(9) placing adsorption column CP3 in a clean centrifuge tube, adding 55 μ l sterilized water preheated to 55 deg.C dropwise to the middle part of the adsorption column, standing at room temperature for 2min, centrifuging at 12000rpm for 2min, collecting plasmid solution in the centrifuge tube, and storing at-20 deg.C for use.

1.10 linking the GmNCED1 promoter with PBGWFS7

1.11 plasmid transformation of E.coli (sterile procedure)

The transformation method is the same as that in 1.6

1.12 Escherichia coli PCR verification (same 1.7)

1.13 extraction of plasmid DNA from Escherichia coli

Positive single colonies containing the recombinant plasmid were picked up in a 1.5ml EP tube and shaken overnight with liquid LB containing spectinomycin (100mg/L), then inoculated into 200ul of 100ml conical flask containing 20ml LB (containing 100mg/L spectinomycin) and shaken overnight, and then 4ml of the bacterial solution was aspirated to extract the plasmid.

1.14 Positive clone sequencing

200ul of bacterial liquid in a 1.5MLEP tube corresponding to the identified positive clone is sucked, sent to Huada company for sequencing, and simultaneously sequenced by using a self gene specific primer and an M13 primer.

1.15 plasmid transformation of Agrobacterium (sterile procedure)

(1) Add 10. mu.l plasmid DNA into 50. mu.l competent cell, flick the centrifuge tube and mix, ice-bath for 30 min;

(2) quickly freezing for 1min by using liquid nitrogen; then carrying out water bath at 37 ℃ for 5min, and immediately carrying out ice bath for 2-3 min;

(3) adding 1ml YEP culture medium, and culturing at 28 deg.C for 2-4 hr;

(5) the bacteria were spread on YEP plates containing the corresponding antibiotics and cultured for 48h at 28 ℃ in an inverted manner.

1.16 PCR validation of transformed Agrobacterium

The reaction system was as follows (20. mu.l system):

the amplification conditions were as follows:

1.17 functional verification of the Nelumbo 12GmNCED1 Gene promoter in Arabidopsis thaliana

1.17.1 transformation of Arabidopsis thaliana by flower infection method

(1) When Arabidopsis (Col-0 wild type) grows to bolting for 1cm, the apical end is subtracted to induce the production of lateral inflorescences;

(2) one day before transformation, 1ml of activated Agrobacterium GV3101 containing the expression vector plasmid was added to 40ml of YEP medium containing the corresponding antibiotic and 50. mu.g/ml rifampicin, and shake-cultured at 28 ℃ to OD₆₀₀About 1.0 to about 1.2;

(3) centrifugation was carried out at 4200rpm for 10min at room temperature, and the cells were collected and resuspended in a staining solution (5% sucrose, 0.05% Silwet L-77) to OD₆₀₀About 0.8;

(4) dripping agrobacterium onto inflorescence by using a liquid transfer device for dip dyeing, and after all inflorescences are infected, putting arabidopsis into a vacuum drier for vacuumizing for 1 min;

(5) covering the inflorescence with a freshness protection bag, culturing at 20-22 deg.C in the dark for one day, cutting off the top to expose the inflorescence, culturing for another day, removing the freshness protection bag, and culturing until the seeds are mature.

1.17.2 surface disinfection of Arabidopsis seeds

Placing a proper amount of arabidopsis thaliana neutrons to be sterilized into a 1.5ml centrifuge tube, adding 1ml of 75% ethanol (containing 0.03% by volume of Triton X-100), shaking for sterilization for 1min, then shaking for sterilization for 1min (twice) with 70% ethanol, finally sucking the seeds onto sterile filter paper by using a suction head for blow-drying, and then dropping the seeds into a culture medium by using a sterile toothpick.

1.17.3 screening of transgenic plants

The GUS vector was transferred into Arabidopsis thaliana by Agrobacterium with the help of a flower infection method as described in pGmNCED 1. Sowing harvested seeds of T1 generation in a soil matrix, performing vernalization at 4 ℃ for 3 days, placing the seeds in an incubator for 3-4d of germination, spraying herbicide (basta) diluted by 10% bastasolution mother liquor at a concentration of 1:1000 (v/v), selecting plants with better growth vigor, transferring the plants to a new soil medium, and allowing the plants to continue growing. When seedlings quickly sprout and bolt, a small amount of leaf crude extraction genome DNA is taken, a PCR method is adopted to verify a transgenic plant, and a primer is att B1/2. And (4) obtaining T1 generation seeds after the positive plants are matured. Seeds of T1 generation are subjected to resistance screening by using 1/2MS solid culture medium, and resistance is selected: and (4) inserting single copy of the plant line with the non-resistance ratio of 3:1, planting positive plants, and harvesting seeds of T2 generation after the plants are mature. And (4) carrying out resistance screening on T2 generation seeds to obtain a transgenic homozygous line.

1.18 transgenic Arabidopsis analysis of the GmNCED1 promoter

Transgenic arabidopsis T3 generation plant seeds are planted on a 1/2MS culture medium, arabidopsis at a seedling stage and a flowering stage is taken for GUS staining, and the tissue specific expression of the arabidopsis is observed, and the result is shown in figure 3, which indicates that GUS signals driven by a GmNCED1 promoter are mainly expressed in roots.

T3 generation pure line Arabidopsis seeds are planted on 1/2MS culture medium, and grow under long-day (16h light, 22 ℃/8h dark, 20 ℃) after vernalization. Transgenic Arabidopsis seedlings grown for 7 days were placed in 1/2MS liquid medium for 12h as a control and in 50mM NaCl-containing MS liquid medium for 12h of salt treatment. The results are shown in FIG. 3, which indicates that the GmNCED1 promoter can be induced by salt stress.

2. Analysis of the sequence of the soybean lotus 12GmNCED1 gene promoter

Utilizing PLACE (http:// www.dna.affrc.go.jp/PLACE /) and

the possible cis-acting elements present in the promoter sequence of the soybean 12GmNCED1 gene were analyzed by the online PlantCARE (http:// bioinformatics. psb. element. be/western tools/plantaCARE/html /).

The stress-related cis-acting elements contained in the GmNCED1 gene promoter are shown in the following table, which indicates that the promoter contains abundant stress-related cis-acting elements, can be regulated by various transcription factors and participate in the response of plants to various biotic and abiotic stresses.

Sequence listing

<110> Shandong university

<120> soybean lotus bean 12GmNCED1 gene salt-induced promoter and application thereof

<141>2019-11-23

<160>1

<210>1

<211>1776

<212>DNA

<213> Glycine genus Soybean (Glycine max.)

<221> salt-induced promoter of soybean lotus 12GmNCED1 gene

<222>（1）…（1776）

<400>1

ccttttcaac cactaaacat cctttataac ttccactatt ttaatatcca tattctaaaa 60

tatgatataa tcaacaagta atatggtgtt atatatacat gtagatagat aattcgagag 120

ggagcatata aagaatattt tgaaatatat taattttcat tcaaaaaagg acaatgaata 180

attagcttta ctttttttag aagaacgaat aattagctaa ctaaaattca agataagttt 240

aattttttaa atactgttaa tataaaaagt tttatactat tacttaaata aaattttatt 300

gataaatttt tgaaaataat ttatataaca atcaacatat ttattttaaa caagtataac 360

tatttataat taaatgataa tataaaatat tttacacaat aaatatgttg aacattgaat 420

ttaataatca taaactaaca atataaaata gatatatcct atcatataat cataaatcaa 480

agttgaatat ttgtaattaa agacaataca gaattatttt atattattta tgttaacatg 540

tacaaatatt tatttttgtg tagaatactc cttccgttct catatataaa aaataatttt 600

gaaaataatt ctctttttta taagatgtga tctcacttat cttatatact aattattttt 660

tatttgaata tttcgaatta tctttttctt ttttcttatg gaaattagag tataattata 720

gataaattta atactaataa ttaaattaat taactttttt aataagcata aattaataaa 780

taaaaaaaat catgtaatta gggacggatg atgaaatatt ttctaacgac aaaacaaact 840

tgtgaagtga agttcaagtt agacttggta atccataaac gtgcaagaga tgaaagaaaa 900

acgaaagaag aaggaaggtt tagaatggaa gggggggggg caagcgtgtg gggcaatggg 960

atgtgacgtg accaaagatt ggaaggagaa gaagagagaa ttggccacgt gtagggggga 1020

gtcacactct cattgaggga gcaacgcggg gttcgacgtg tgcaaaataa caaatgcctt 1080

ccccactcaa aggcaaggca attaggcaaa gccatgaatc aaaagcccat tacatattcc 1140

tccctcccta aactaatggg ccaatagaga acaaccatcc tcaaaacact attctctgct 1200

ttcttttttt gcctttgcct ttgcctttgc cgctttaatt ctctctctct ctctctctct 1260

accgtctttc ttgtcatcaa ttgtcatgtg tgattgctct caatttaagg aactttcccc 1320

catattttat tcataggcgc atattataag cactctctct atactagagg gagaaaatga 1380

aagaaggggg tcgtggcata gtttcacgta gctatgtccc accttgtacc attcacttat 1440

tggcaatcct accttttatg agtcccctcc ctccattttc ttaatcctac acgtggtctc 1500

ctcctcctac atgtctcact tcaacctcca tcccttcctc cctcctcccc ccactatata 1560

tactcccata tctcactccc cactctcccc aactcactcc cttacataca ccacctcctc 1620

tcctacaatt ttcaaaatca aaacactcat acacacctct caattcaaac caatttctac 1680

tacttccttc aacatctctc catcacaagc ttacacaact acttacttca acctcaacga 1740

cctctctttc aaaattagaa acaaaaacca ttcacc 1776

Claims

1. A salt-induced promoter of a soybean lotus 12GmNCED1 gene is characterized in that: the nucleotide sequence of the promoter is one of the following nucleotide sequences:

a) the nucleotide sequence shown as SEQ ID No. 1 in the sequence table;

2. A reporter gene GUS expression vector pGmnced1 containing the salt-inducible promoter of the soybean 12GmNCED1 gene of claim 1, pBGWFS7.

3. The application of the salt-induced promoter of the soybean 12GmNCED1 gene of claim 1 to efficiently promote the expression of a target gene under the induction of salt stress.

4. The application of the salt-induced promoter of the soybean 12GmNCED1 gene of claim 1 in cultivating salt-tolerant transgenic plants.

5. Use according to claim 4, characterized in that: the plant is Arabidopsis thaliana or soybean.