CN110819581A

CN110819581A - AMH-GNIH double-expression DNA vaccine for improving animal fertility and construction method and application thereof

Info

Publication number: CN110819581A
Application number: CN201910892084.7A
Authority: CN
Inventors: 杨利国; 唐姣美; 周群莉; 滑国华
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-09-20
Filing date: 2019-09-20
Publication date: 2020-02-21
Anticipated expiration: 2039-09-20
Also published as: CN110819581B

Abstract

The invention provides an AMH-GNIH double-expression gene vaccine for improving animal fertility and a preparation method of engineering bacteria thereof. The engineering bacteria are preserved in the China center for type culture Collection in 2018, 8, 15 and the preservation number is as follows: CCTCC M2018542. The engineering bacteria can be directly used for immunizing animals or can be mixed with DNA vaccine adjuvant to immunize animals, so that the reproductive capacity of the animals can be effectively improved. The double expression gene is double expression non-resistant DNA plasmid of anti-mullerian hormone and gonadotropin releasing inhibiting hormone, and can be used for immunizing animals directly, and producing antibodies through mucosal immunization in modes of nasal spraying, oral administration, mixed feeding and the like. Because the gene does not contain resistance genes, no exogenous antibiotics are required to be introduced for screening, and no antibiotic residues are generated. Compared with other gene vaccines which need plasmid extraction and purification, the production cost is higher, intramuscular injection is troublesome, and the stress response is generated to animals, the vaccine has low production cost, convenient use and no resistance and injection stress response.

Description

AMH-GNIH double-expression DNA vaccine for improving animal fertility and construction method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an AMH-GNIH dual-expression gene vaccine for improving animal fertility, and a preparation method and application thereof.

Background

Follicular development is a cyclic process and is regulated by a combination of hormones, including those that promote follicular development, such as Gonadotropin and Gonadotropin-releasing hormone, and those that inhibit follicular development, such as Anti-mullerian hormone (AMH), follistatin (inhin, INH), and Gonadotropin-releasing hormone (GnIH).

AMH is a member of the glycoprotein transforming growth factor- β (TGF- β) superfamily involved in regulating growth and differentiation, and has inhibitory effects on follicle development, knockout of AMH can relieve its recruitment to primordial follicles, leading to an increase in the number of luminal follicles, AMH can attenuate the stimulatory effects of growth factor Kit Ligand (KL), basic fibroblast growth factor (bFGF), and Keratinocyte Growth Factor (KGF) on primordial follicle development, suggesting that AMH can reduce the conversion of primordial follicles to primary follicles, inhibiting basal and stimulatory development of primordial follicles.

GnIH is RF (arginine-phenylalanine) amide peptide (RFRP) which was first isolated and purified from quail brain by japanese scholars in 2000, and its biological action is contrary to GnRH, and mainly inhibits secretion of FSH (follicle stimulating hormone) and LH (luteinizing hormone) from anterior pituitary. Subsequently, the GnIH ortholog identified from the mammalian brain was designated rfamide (rfrp) related peptide comprising: RFRP-1, RFRP-2, RFRP-3. Among them, RFRP-3 is a major regulator of reproduction, similar to the physiological function of inhibin in vivo. GnIH and its analogs not only act on the pituitary of the hypothalamus and GnRH neurons via GPR147, but also inhibit the synthesis and release of gonadotropins and the development and maintenance of the gonads. RFRPs have been shown to be key mediators of ovarian development, potential inhibitory modulators of GnRH release, possibly exerted indirectly on follicular development by upstream modulators of GnRH, or exerted directly on a subset of GnRH neurons in different developmental stages of mammalian reproduction, including pre-pubertal, estrous, gestational, lactation, menopausal, and ovarian diseases. In addition to regulating gonadotropin secretion, GnIH further regulates reproductive behavior by altering neurosteroid biosynthesis in the brain. GnIH inhibits the release of LH and FSH from chicken and quail pituitary glands. Intravenous administration of RFRP-3 reduced peripheral blood gonadotropin levels in gonadectomized male rats, suppressed testosterone production and spermatogenesis in adult mice, pulsed amplitude of ovine LH, suppressed LH and FSH secretion. Furthermore, it has been shown that GnIH inhibits follicular development and steroidogenesis in chickens. The above studies suggest that GnIH may inhibit follicular development and ovulation, either directly or indirectly.

Disclosure of Invention

The invention aims to provide an engineering bacterium of an AMH-GNIH double-expression gene vaccine with the function of improving the reproductive capacity of animals. It is another object of the present invention to provide a non-resistance-selected co-expression plasmid for anti-Mullerian hormone and gonadotropin-releasing inhibitory hormone; the plasmid can be used as a DNA vaccine to immunize animals, improve the reproductive capacity of the animals and overcome some technical problems.

In order to achieve the purpose, the invention adopts the following technical scheme:

an engineering bacterium of AMH-GNIH dual-expression gene vaccine with the function of improving the reproductive capacity of animals, which is preserved in the China center for type culture Collection in 2018, 8, 15, the address of Wuhan, China, the preservation number is as follows: CCTCC M2018542, and is classified and named as Salmonella choleraesuis C500/PVAX-SAMH-2A-SRFRP-asd (Salmonella enterica C500/PVAX-SAMH-2A-SRFRP-asd).

AMH-GNIH double expression gene vaccine engineering bacteria prepared by the engineering strain are extracted by an SDS alkali lysis method to obtain AMH-GNIH double expression gene plasmid (PVAX-tPA-SAMH-2A-tPA-SRFRP-asd plasmid).

An AMH-GNIH double-expression gene vaccine for improving animal fecundity is characterized in that the vaccine sequentially comprises tPA-SAMH gene and tPA-SRFRP gene.

The AMH-GNIH dual-expression gene vaccine is characterized in that the gene sequence of the tPA-SRFRP is shown as SEQ ID NO.2, and the gene sequence of the tPA-SAMH is shown as SEQ ID NO. 1.

The AMH-GNIH double-expression gene vaccine is characterized in that 2A peptide is connected between the tPA-SAMH gene and the tPA-SRFRP gene, and the gene sequence of the 2A peptide is shown as SEQ ID NO. 3.

A method for preparing the AMH-GNIH double expression gene vaccine for improving animal fertility as described above, comprising the steps of:

s1, carrying out PCR amplification on plasmids PVAX-tPA-SAMH-asd and PVAX-tPA-SRFRP-asd to obtain tPA-SAMH and tPA-SRFRP amplification product fragments; the tPA-SAMH amplification product fragment contains a sequence shown as SEQ ID NO.1, and the tPA-SRFRP amplification product fragment contains a sequence shown as SEQ ID NO. 2;

s2, carrying out EcoR I and XhoI enzyme digestion on PCR amplification products of pVAX-asd and tPA-SRFRP, and connecting to obtain a plasmid PVAX-tPA-SRFRP-asd;

s3, carrying out enzyme digestion on HindIII and Kpn I on PVAX-tPA-SRFRP-asd and tPA-SAMH PCR products, and connecting to obtain a plasmid PVAX-tPA-SAMH-tPA-SRFRP-asd;

s4 and a 2A peptide splicing head are synthesized by Shanghai and cloned on a PUC57 vector; wherein, the 2A peptide contains a sequence shown as SEQID NO. 3;

s5, carrying out Kpn I and BamH I enzyme digestion on PVAX-tPA-SAMH-tPA-SRFRP-asd and PUC57-2A' -2A plasmids, and connecting to obtain the plasmid PVAX-tPA-SINH-2A-tPA-SRFRP-asd.

S6, carrying out PCR amplification on PVAX-tPA-SRFRP-asd, and introducing enzyme cutting sites BamH I and Xho I (enzyme cutting sites replacement) to obtain a tPA-SRFRP amplification product fragment; carrying out enzyme digestion of BamH I and Xho I on PVAX-tPA-SAMH-2A-tPA-SRFRP-asd and tPA-SRFRP amplification product fragments obtained in S4, and connecting to obtain a plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd.

The AMH-GNIH double-expression gene vaccine for improving animal fecundity or the application of the vaccine prepared by the preparation method in preparing the medicine for improving animal fecundity.

The animal reproductive capacity can be improved by directly immunizing an animal with the engineering bacteria containing the AMH-GNIH dual-expression gene vaccine (PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) for improving the animal reproductive capacity or immunizing the animal after mixing with a DNA vaccine adjuvant.

The invention has the beneficial effects that:

the co-expression plasmid for the non-resistance screening anti-mullerian hormone and gonadotropin releasing inhibitory hormone provided by the invention has the following advantages:

1. the dual-expression non-resistant DNA plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd of the anti-mullerian hormone and the gonadotropin releasing inhibitory hormone can express two proteins of the anti-mullerian hormone (AMH) and the gonadotropin releasing inhibitory hormone (RFRP) with strong immunogenicity, and stimulate a mouse to generate higher antibody level.

2. After an engineering bacterium C500(PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) containing the AMH-GNIH double-expression gene vaccine for improving the animal fertility is used for gastric lavage of an immunized mouse, an anti-Mullerian hormone and gonadotropin release inhibitory hormone antibody are generated, endogenous hormones are neutralized, the inhibitory effect of the two hormones on gonadotropin is weakened, and then the breeding of the mouse is promoted, the litter size (15.9 +/-1.90) of the vaccine is obviously higher than that of a PBS control group (13.6 +/-1.72) and an empty plasmid control group (13.66 +/-2.30) and also higher than that of an AMH single expression group (14.35 +/-2.43) and an RFsingle RP expression group (14.26 +/-1.37), and the reproductive promoting effect is obvious.

3. The engineering bacterium C500(PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) containing double-expression non-resistant DNA plasmids of anti-mullerian hormone and gonadotropin release inhibiting hormone can be used for directly immunizing animals and generating antibodies through mucosal immunization in modes of nasal spraying, oral administration, mixed feeding and the like. Because the gene does not contain resistance genes, no exogenous antibiotics are required to be introduced for screening, and no antibiotic residues are generated. Compared with other gene vaccines which need plasmid extraction and purification, the production cost is higher, intramuscular injection is troublesome, and the stress response is generated to animals, the vaccine has low production cost, convenient use and no resistance and injection stress response.

Drawings

FIG. 1 shows the electrophoresis of the PCR amplified product of tPA-SRFRP; m: marker DL 2000; lanes 1-9: tPA-SRFRP PCR product.

FIG. 2 is a double-enzyme-digested map of a tPA-SRFRP PCR product and a PVAX-asd vector, wherein M1: marker DL2000, lanes 1 and 2: carrying out double enzyme digestion on the PVAX-asd vector; lanes 4-6: double enzyme digestion of tPA-SRFRP PCR product; m2: and (5) Marker 3.

FIG. 3 is a diagram of a PVAX-tPA-SRFRP-asd plasmid after double digestion, wherein M: marker 3; lanes 1-5: single colony PVAX-tPA-SRFRP-asd zymogram.

FIG. 4 shows electrophoresis of tPA-SAMH PCR amplification products; wherein, M: AL5000DNA Marker; lanes 1-4: tPA-SAMH PCR product.

FIG. 5 is an enzymatic cut-out of the PVAX-tPA-SRFRP-asd plasmid and tPA-SAMH PCR product; wherein, M: AL5000DNA Marker; lanes 1-4: carrying out double enzyme digestion on PVAX-SRFRP-asd plasmid; lanes 5-7: cleavage products of tPA-SAMH PCR products.

FIG. 6 is a PVAX-tPA-SAMH-tPA-SRFRP-asd double enzyme digestion identification map; wherein, M: marker 3, lanes 1-3: carrying out double enzyme digestion on a single colony PVAX-SAMH-SRFRP-asd enzyme digestion map, and carrying out double enzyme digestion on Hind III and Xho I; lanes 4-6: the single colony PVAX-tPA-SAMH-tPA-SRFRP-asd double enzyme cutting map is subjected to double enzyme cutting by Hind III and EcoR I.

FIG. 7 shows the restriction enzyme digestion of PVAX-tPA-SAMH-tPA-SRFRP-asd and PUC57-2A' -2A plasmids; wherein the left side is PUC57-2A' -2A enzyme cleavage map, M: 50bp DNA marker, lanes 1-5: pUC57-2A' -2A plasmid map; the right side is PVAX-tPA-SAMH-tPA-SRFRP-asd zymogram, M: DS10000Marker, lanes 1-3: the plasmid of PVAX-tPA-SAMH-tPA-SRFRP-asd is subjected to zymogram.

FIG. 8 is a single colony PVAX-tPA-SAMH-2A-tPA-SRFRP-asd enzyme digestion map after transformation; wherein, M: 50bpDNA marker, lanes 1-6: after transformation, the single colony PVAX-tPA-SAMH-2A-tPA-SRFRP-asd is subjected to enzyme digestion map and 2A is subjected to enzyme digestion.

FIG. 9 shows the PCR identification of PVAX-tPA-SAMH-2A-tPA-SRFRP-asd C500; wherein, M: marker III; lanes 1-2: InvA negative; lanes 3-4: the Crp is negative; lanes 5-6: asd negative; lanes 7-8: AMH-RFRP negative; lanes 9-10: AMH-INH negative; lanes 11-12: InvA; lanes 13-14: crp; lanes 15-16: asd, respectively; lanes 17-18: an AMH-RFRP fragment; lanes 19-20: AMH-INH control.

FIG. 10 is a restriction enzyme map of purified PVAX-tPA-SAMH-2A-tPA-SRFRP-asd plasmid; wherein, M: MarkerIII; lanes 1-4: PVAX-tPA-SAMH-2A-tPA-SRFRP-asd plasmid HindIII/XhoI double enzyme digestion.

FIG. 11 is a plot of the transcriptional level of PVAX-tPA-SAMH-2A-tPA-SRFRP-asd transfected HELA cells; wherein, M: marker III; lane 1: AMH-RFRP negative; lane 2: AMH-RFRP has no treatment; lane 3: AMH-RFRP transfection is empty; lane 4: AMH-RFRP transfection double expression.

Figure 12 is the anti-AMH antibody levels at week 8 after primary immunization of mice with different vaccines.

Figure 13 is the anti-RFRP antibody levels at week 8 after primary immunization of mice with different vaccines.

Detailed Description

Existing studies indicate that GnIH may inhibit follicular development and ovulation, either directly or indirectly. The inventor of the invention discovers that the GnIH gene vaccine can stimulate follicular development and ovulation and improve the number of born and lambs by immunizing sheep and mice through a large number of experiments. AMH can reduce the conversion of primordial follicles to primary follicles, inhibit the basal and stimulated development of primordial follicles, and the ovaries of female mice knocked out of AMH can show depletion of primordial follicle stock. The inhibitory action mechanisms of AMH and GnIH on follicular development are different, the former directly inhibits the development of small follicles, and the latter inhibits the development of large follicles by inhibiting the secretion of pituitary FSH.

The inventor respectively constructs single-expression DNA vaccines PVAX-tPA-SAMH-asd and PVAX-tPA-SRFRP-asd of anti-Mullerian hormone (AMH) and gonadotropin-releasing inhibitory hormone (RFRP), and though the single-expression DNA vaccines show a better effect of improving the fertility on mice, considering that the two hormones are both related to follicular development, the effect of jointly expressing the two hormones is presumed to be better than that of single expression. The invention adopts the gene sequence of the 2A peptide as a connecting site, and the upstream and the downstream are almost expressed in equimolar way, so that the downstream gene is almost expressed in equimolar way along with single expression, and is equivalent to double single expression and simultaneous immunization, and the cost is reduced.

The following examples are intended to further illustrate the invention but should not be construed as limiting it. Modifications and substitutions may be made thereto without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art.

Example 1 construction of eukaryotic Single-expression gonadotropin-releasing inhibitory hormone PVAX-SRFRP-asd

1. PCR amplification, sequence analysis and enzyme digestion are carried out on gonadotropin releasing inhibitory hormone (gonadotropin-releasing inhibitory hormone) according to plasmid PVAX-tPA-SRFRP-asd provided by key laboratories (breeding subject groups) of the department of agricultural animal genetic breeding and reproductive education of university of Huazhong agriculture to obtain bovine (bovine) derived RFRP fusion hepatitis B surface antigen and human tissue plasmin signal peptide gene fragments, which are specifically as follows: the designed primer has two ends connected with enzyme cutting sites EcoR I and Xho I, and is inserted into a PVAX-asd vector to obtain a plasmid PVAX-tPA-SRFRP-asd capable of expressing bovine (bovine) derived RFRP fusion hepatitis B surface antigen and human tissue plasmin signal peptide, wherein the bovine (bovine) derived RFRP fusion hepatitis B surface antigen and human tissue plasmin signal peptide cDNA open reading frame is 840(bp) and 280 amino acids are coded.

Carrying out PCR amplification on PVAX-tPA-SRFRP-asd by using high-fidelity enzyme, wherein the total volume of a reaction system is 50 mu l, and the reaction system comprises:

the upstream and downstream primers of tPA-SRFRP are as follows:

SRFRPF: (SEQ ID NO.4) EcoRI site-containing:

5'CCGGAATTCGCCACCATGGATGCAATGAAGAGAGGGC 3'

tPA-SRFRPR: (SEQ ID NO.5) containing an XhoI site:

5'CCGCTCGAGTTAAATGTATACAAACCTCTGGGGC 3'

and (3) PCR reaction steps: 1. pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 40sec, annealing at 58 ℃ for 30sec, elongation at 72 ℃ for 4 for 50sec, 2-4 steps of 35 cycles, and heat preservation at 72 ℃ for 10 min.

the tPA-SRFRP PCR amplification product has a sequence shown in SEQ ID NO.2, and the electrophoresis result is shown in figure 1, wherein M: marker DL 2000; lanes 1-9: tPA-SRFRP PCR product.

Cutting the tPA-SRFRP PCR product and the PVAX-asd vector by EcoRI and Xho I to obtain a tPA-SRFRP fragment (852bp) and a PVAX-asd fragment (3741bp), wherein the total volume of the reaction system is 20 mu l, and the reaction system comprises:

reacting for 1h in a water bath at 37 ℃;

finally, the cleavage products were electrophoresed on 1% agarose gel using Marker III as a molecular weight standard, and the electrophoresis results were observed as shown in fig. 2, in which M1: marker DL2000, lanes 1 and 2: carrying out double enzyme digestion on the PVAX-asd vector; lanes 4-6: double enzyme digestion of tPA-SRFRP PCR product; m2: and (5) Marker 3.

2. Connection of

The digestion product was recovered using a Gel recovery Kit (see the instructions for use of the OMEGA Gel Extraction Kit). And (3) connecting the recovered product with a target fragment and a carrier by using Takara ligase, wherein the total volume of a connection system is 10 mu l:

16 ℃ overnight. The ligation product PVAX-tPA-SRFRP-asd is directly used for transformation or stored at-20 ℃ for later use.

3. Recombinant plasmid PVAX-tPA-SRFRP-asd transformation competent bacteria

1) Preparation of X6097 (preservation in key laboratory (breeding subject group) of department of agricultural animal genetic breeding and reproductive education) competent cell (calcium chloride method)

The frozen strain X6097 was streaked on an LB plate containing Diaminopimelic Acid (DAP) (50. mu.g/ml) using a sterile loop while streaking on an LB plate without DAP as a control, and cultured overnight at 37 ℃. Individual colonies that grew well the next day were picked up in 5ml of LB liquid medium containing DAP (50. mu.g/ml) and cultured overnight at 37 ℃ with shaking at 220 r/min. The lml activated culture was inoculated into 200ml of LB liquid medium containing DAP (50. mu.g/ml), and cultured with shaking at 37 ℃ for 2.5 to 3 hours to bring the OD600 to about 0.5. Pouring the bacterial culture into a pre-cooled sterile big centrifuge bottle under aseptic conditions, carrying out ice bath for 30min, carrying out centrifugation for 10min at the temperature of 4 ℃ and 5000rpm/min, and discarding the supernatant. Then 10ml of ice-pre-cooled 0.1M CaCl₂Gently suspend the bacterial pellet, ice-wash for 30min at 4 ℃ at 5000rpm/min, centrifuge for 10min, discard the supernatant, and finally pre-cool with 1ml ice of 0.1MCaCl₂Re-suspending the precipitate, adding sterilized glycerol with final concentration of 15%, mixing, and packaging into 100 μ l/tube to obtain competent bacterium χ 6097, which can be directly used for transformation or stored in refrigerator at-80 deg.C for use.

2) The ligation product was transformed into competent bacterium χ 6097 by heat shock method as follows:

(1) mu.l of the competent cells thawed on the ice bath was taken, 10. mu.l of recombinant DNA (PVAX-tPA-SRFRP-asd prepared in the above step) was added, gently mixed, and placed in the ice bath for 30 min.

(2) The heat in the 42 ℃ water bath was 90sec, then the tube was quickly transferred to the ice bath for 2min without shaking the centrifuge tube.

(3) 900 μ l of sterile LB medium (containing no antibiotics) was added to each tube, mixed well and incubated at 37 ℃ and 220r/min for 45min to resuscitate the bacteria.

(4) Centrifuging at 1000rpm for 5min, and sucking off the supernatant to obtain a proper amount of supernatant.

(5) The pellet was gently blown up, mixed well, transferred to LB solid medium (no antibiotics) and the cells were spread evenly. The plate was placed in a 37 ℃ incubator, inverted after 30min, and incubated overnight at 37 ℃.

4. Screening, identification and sequencing of Positive clones

Selecting positive clones (PVAX-tPA-SRFRP-asd) from the plate, inoculating the positive clones to an LB liquid culture medium for culture, extracting plasmids by using a plasmid small amount kit (refer to a plasmid extraction kit application instruction of Tiangen Biochemical technology (Beijing) Co., Ltd.), carrying out double digestion by using restriction enzymes EcoRI and Xho I, identifying the fragment tPA-SRFRP, reacting for 1h at 37 ℃, carrying out 1.0% agarose gel electrophoresis, observing the digestion result, wherein the electrophoresis band conforms to the size of 852bp of a target band, and the result is shown in figure 3, selecting one plasmid, and sequencing by using the company Limited in Biotechnology (Shanghai). Obtaining the eukaryotic expression plasmid vector PVAX-tPA-SRFRP-asd.

Example 2: construction of eukaryon double-expression inhibin and gonadotropin releasing inhibin plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd

1. Inhibin hormone PCR amplification, sequence analysis and enzyme digestion

Carrying out PCR amplification according to a plasmid PVAX-tPA-SAMH-asd (constructed by Huazhong agriculture university and the specific operation is shown in appendix 2) to obtain a gene fusion gene fragment of sheep (ovine) source AMH fusion hepatitis B surface antigen and human tissue fibrinolytic enzyme signal peptide, designing enzyme cutting sites at two ends of a primer as Hind III and Kpn I, carrying out enzyme cutting on the tPA-SAMH and the PVAX-tPA-SRFRP-asd (constructed by Huazhong agriculture university and the specific operation is shown in appendix 1), connecting, transforming, picking single bacterial colony, carrying out small extraction and enzyme cutting, selecting one of the plasmids with the electrophoresis band in accordance with the size of the target band, and sending the selected plasmid to an industrial biological engineering (Shanghai) stock Limited company for sequencing.

Obtaining a plasmid PVAX-tPA-SAMH-tPA-SRFRP-asd, carrying out Kpn I and BamH I enzyme digestion on the PVAX-tPA-SAMH-tPA-SRFRP-asd and the plasmid PUC57-2A' -2A, connecting, transforming, selecting a single colony, carrying out small extraction, carrying out enzyme digestion on a 2A fragment, and judging whether the 2A is connected or not to obtain the PVAX-tPA-SAMH-2A-tPA-SRFRP-asd.

The specific operation is as follows:

carrying out PCR amplification on PVAX-tPA-SAMH-asd by using high-fidelity enzyme, wherein the total volume of a reaction system is 50 mu l, and the reaction system comprises:

the upstream and downstream primers are:

tPA-SAMH F: (SEQ ID NO.6) contains a Hind III site:

5'CCCAAGCTTGCCACCATGGATGCAATGAAGAGAGGGC 3'

tPA-SAMH R: (SEQ ID NO.7) containing a Kpn I site:

5'CGGGGTACCTTGCTGAAAGATGAGTGTCCCG 3'

the tPA-SAMH amplification product is a restriction enzyme cutting site with Hind III and Kpn I added at two ends shown in SEQ ID NO.1, the sequence is shown in SEQ ID NO.1, electrophoresis amplification is carried out, and the result is shown in FIG. 4. Wherein, in fig. 4, M: AL5000DNA Marker; lanes 1-4: PCR amplification products of tPA-SAMH.

the tPA-SAMH PCR product and the PVAX-tPA-SRFRP-asd are cut by Hind III and Kpn I to obtain a segment tPA-SAMH (825bp without calculating enzyme cutting sites at both ends) and PVAX-tPA-SRFRP-asd (4593bp), and the total volume of the reaction system is 20 mu l, wherein the segment comprises:

reacting for 1h in a water bath at 37 ℃;

and finally, carrying out electrophoresis on the enzyme digestion product by using 1% agarose gel, observing the electrophoresis result, wherein the result is shown in figure 5, and figure 5 is a map of the tPA-SAMH PCR product and the PVAX-tPA-SRFRP-asd vector after double enzyme digestion, wherein M: AL5000 DNAMarker, lanes 1-4: PVAX-tPA-SRFRP-asd plasmid; lanes 5-7: and (3) carrying out enzyme digestion on the amplified product of the tPA-SAMH PCR.

2. Connection of

The above-mentioned digested products were recovered by using a Gel recovery Kit (see the instructions for use of the OMEGA Gel Extraction Kit). And (3) connecting the recovered product with a target fragment and a carrier by using Takara ligase, wherein the total volume of a connection system is 10 mu l:

16 ℃ overnight. The connection product PVAX-tPA-SAMH-tPA-SRFRP-asd is directly used for transformation or stored at the temperature of minus 20 ℃ for standby.

3. Recombinant plasmid PVAX-tPA-SAMH-tPA-SRFRP-asd transformation competent bacteria

1) Preparation of X6097 competent cells (calcium chloride method) from laboratory (reproduction subject group) of department of agricultural animal genetic breeding and reproduction education

The frozen strain X6097 was streaked on an LB plate containing DAP (50. mu.g/ml) with a sterile inoculating loop and, at the same time, on an LB plate without DAP as a control, and cultured overnight at 37 ℃. Individual colonies that grew well the next day were picked up in 5ml of LB liquid medium containing DAP (50. mu.g/ml) and cultured overnight at 37 ℃ with shaking at 220 r/min. The lml activated culture was inoculated into 200ml of LB liquid medium containing DAP (50. mu.g/ml), and cultured at 37 ℃ with shaking for 2.5-3H to achieve an OD600 value of about 0.5. Pouring the bacterial culture into a pre-cooled sterile big centrifuge bottle under aseptic conditions, carrying out ice bath for 30min, carrying out centrifugation for 10min at the temperature of 4 ℃ and 5000rpm/min, and discarding the supernatant. Gently suspending the bacterial pellet with 10ml ice-chilled 0.1M CaCl2, ice-cooling at 30rn in, 4 deg.C at 5000rpm/min, centrifuging for 10min, discarding the supernatant, and finally freezing with 1ml ice-chilled 0.1M CaCl₂Re-suspending the precipitate, adding sterilized glycerol with final concentration of 15%, mixing, and packaging into 100 μ l/tube to obtain competent bacterium χ 6097, which can be directly used for transformation or stored in refrigerator at-80 deg.C for use.

(1) mu.l of the competent cells thawed on ice bath was taken, 10. mu.l of recombinant DNA (PVAX-tPA-SAMH-tPA-SRFRP-asd) was added, gently mixed, and placed in ice bath for 30 min.

4. Screening, identification and sequencing of PVAX-tPA-SAMH-tPA-SRFRP-asd positive clone

Selecting positive clones (PVAX-tPA-SAMH-tPA-SRFRP-asd) from the plate in the previous step, inoculating the positive clones to an LB liquid culture medium for culture, extracting plasmids by using a plasmid minikit (refer to a plasmid extraction kit use instruction of Tiangen Biochemical technology (Beijing) Co., Ltd.), carrying out double enzyme digestion on restriction enzymes Hind III and Xho I and Hind III and EcoR I, identifying fragments tPA-SAMH-tPA-SRFRP, reacting for 1h, carrying out 1.0% agarose gel electrophoresis, observing the enzyme digestion result, observing the size of an electrophoresis strip which is consistent with the size of a target strip, selecting one plasmid, and carrying out sequencing by using engineering bioengineering (Shanghai) Co., Ltd. The eukaryotic expression plasmid vector PVAX-tPA-SAMH-tPA-SRFRP-asd was obtained (FIG. 6).

5. Insertion of 2A fragment

1) Enzyme digestion of PVAX-tPA-SAMH-tPA-SRFRP-asd and PUC57-2A' -2A

The plasmids PVAX-tPA-SAMH-tPA-SRFRP-asd and PUC57-2A' -2A were digested with Kpn I and BamH I to obtain fragment 2A (63bp, without restriction site calculation) and PVAX-tPA-SAMH-tPA-SRFRP-asd (5412bp), and the total volume of the reaction system was 20. mu.l, which contained:

reacting for 1h in a water bath at 37 ℃;

finally, the enzyme-cleaved product of PVAX-tPA-SAMH-tPA-SRFRP-asd was electrophoresed with 1% agarose gel, and the enzyme-cleaved product of PUC57-2A '-2A was electrophoresed with 12% polyacrylamide gel (PAGE) to separate 2A, and the electrophoresis results were observed using 50bp DNA Marker and DS10000Marker as molecular weight standards, and are shown in FIG. 7, in which, the left side is the enzyme-cleaved product of PUC57-2A' -2A, M: 50bp DNA marker, lanes 1-5: pUC57-2A' -2A plasmid map; the right side is PVAX-tPA-SAMH-tPA-SRFRP-asd zymogram, M: DS10000Marker, lanes 1-3: the product of the enzyme digestion of the PVAX-tPA-SAMH-tPA-SRFRP-asd plasmid.

2) Connection of

16 ℃ overnight. The connection product PVAX-tPA-SAMH-2A-tPA-SRFRP-asd is directly used for transformation or stored at the temperature of minus 20 ℃ for standby.

3) Recombinant plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd transformation competent bacteria

The ligation product was transformed into competent bacterium χ 6097 by heat shock method as follows:

(1) mu.l of competent cells thawed on ice bath was taken, 10. mu.l of recombinant DNA (the ligation product PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) was added, gently mixed, and left in ice bath for 30 min.

4) Screening, identification and sequencing of PVAX-tPA-SAMH-2A-tPA-SRFRP-asd positive clone

Selecting positive clones (PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) from the plate in the previous step, inoculating the positive clones to an LB liquid medium for culture, extracting plasmids by using a plasmid minikit (refer to a plasmid extraction kit using instructions of Tiangen Biochemical technology (Beijing) Co., Ltd.), performing double enzyme digestion by using restriction enzymes Kpn I and BamH I, identifying whether a 2A fragment is inserted, separating 2A by using 12% polyacrylamide gel electrophoresis (PAGE), observing the digestion result, wherein the electrophoresis band conforms to the size of a target band (63bp without calculating the size of a digestion site), and the result is shown in FIG. 8, wherein M: 50bp DNA marker, lanes 1-6: after transformation, a single colony PVAX-tPA-SAMH-2A-tPA-SRFRP-asd enzyme digestion product is obtained, and 2A is subjected to enzyme digestion. One of the plasmids was selected and sent to the company Biotechnology engineering (Shanghai) GmbH for sequencing. Obtaining eukaryotic expression plasmid vector PVAX-tPA-SAMH-2A-tPA-SRFRP-asd.

5) PVAX-tPA-SAMH-2A-tPA-SRFRP-asd substitution enzyme cutting site

Carrying out PCR amplification on PVAX-tPA-SRFRP-asd, introducing restriction enzyme cutting sites of BamH I and Xho I to obtain a PCR fragment, carrying out BamH I and Xho I restriction on the PVAX-tPA-SAMH-2A-tPA-SRFRP-asd constructed in the last step 4) and the amplified tPA-SRFRP PCR product, recovering a viscous carrier of the PVAX-tPA-SAMH-2A-asd and a viscous product of the tPA-SRFRP, and connecting to obtain a plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd.

Example 3: preparation of eukaryotic dual-expression plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd C500 competent engineering bacteria for resisting mullerian hormone and gonadotropin release inhibiting hormone

1. Competent preparation frozen culture C500 (supplied from the laboratory (breeding subject group) of the department of agricultural animal genetic breeding and reproductive education) was picked with an aseptic inoculating loop and streaked on an LB agar plate containing DAP (50. mu.g/ml) and, at the same time, streaked on an LB agar plate without DAP as a control, and cultured overnight at 37 ℃. Individual colonies that grew well the next day were picked in 5ml of LB liquid medium containing DAP (50. mu.g/ml) and cultured overnight with shaking at 37 ℃. 3ml of the activated culture was inoculated into 300ml of LB liquid medium containing DAP (50. mu.g/ml), and cultured with shaking at 37 ℃ for 2.5 to 3 hours to bring the OD600 to about 0.5. Pouring the bacterial culture into a pre-cooled sterile centrifuge bottle under aseptic conditions, carrying out ice bath for 30min, centrifuging at 4 ℃ and 5000rpm/min for 10min, discarding the supernatant, carrying out gentle suspension on the bacterial precipitate by using 10ml of ice-cooled 10% glycerol solution, carrying out ice bath for 10min, centrifuging at 4 ℃ and 5000rpm/min for 10min, discarding the supernatant, repeating the gentle suspension on the bacterial precipitate by using 10ml of ice-cooled 10% glycerol solution, carrying out ice bath for 10min, discarding the supernatant after centrifuging for 10min, finally carrying out heavy suspension by using 1.5ml of ice-cooled 10% glycerol, subpackaging the suspended competent cells according to 80 mu l, and immediately using the suspension for electrotransformation or storing in a refrigerator at-80 ℃ for later use.

2. Plasmid electrotransformation of C500

Add 20. mu.l of the plasmid to 80. mu.l of the above competent cells, mix and pre-cool on ice for 30 min. Setting parameters of the electrotransfer instrument: the voltage is 1.8KV, and the time is 4ms-6 ms. Adding the cooled mixture into an electric rotating cup, wiping water outside the cup, electrically shocking, immediately adding SOC culture medium, and recovering for 45min at 37 ℃ by a shaking table. 8000rpm/min, centrifuging for 1min, removing 1ml of supernatant, spreading the rest on a MacConkey solid plate preheated in an incubator, and culturing at 37 deg.C overnight.

PCR identification

Selecting a single colony from a MacConkey plate to be placed in an LB culture medium without any antibiotic, identifying and screening positive clones by adopting a PCR method, and detecting whether the colony is a target bacterium by InvA, Crp and Asd; and AMH-RFRP and AMH-INH are used for detecting whether the target bacteria are transfected with the target plasmid. 20 ul of PCR reaction system containing 1 ul of upstream and downstream primers, 10 ul of 2 XTaq PCR Mix, 2 ul of template, ddH₂O6. mu.l. The reaction procedure is as follows: pre-denaturation at 94 ℃ for 4min, followed by denaturation at 94 ℃ for 40sec, annealing at 58 ℃ for 30sec, extension at 72 ℃ for 50sec for 35 cycles, and final extension at 72 ℃ for 10 min. Wherein, the used amplification primers are shown in the following table 1, the PCR products are subjected to electrophoretic amplification, and the results are shown in FIG. 9And M: marker III; lanes 1-2: InvA negative; lanes 3-4: the Crp is negative; lanes 5-6: asd negative; lanes 7-8: AMH-RFRP negative; lanes 9-10: AMH-INH negative; lanes 11-12: InvA; lanes 13-14: crp; lanes 15-16: asd, respectively; lanes 17-18: an AMH-RFRP fragment; lanes 19-20: AMH-INH control.

TABLE 1

4. Alkaline cracking method for extracting plasmid

(1) Single colonies were picked from the McConkey plates and cultured overnight in 5ml LB medium without any antibiotics at 37 ℃ with shaking at 220 rpm/min.

(2) Transfer 2ml of the bacterial liquid into 2ml of EP tube, centrifuge lmin at 13000rpm, and discard the supernatant.

(3) The pellet was resuspended in 100. mu.l of ice-chilled Solution I and vortexed until the cells were fully suspended.

(4) Add 200. mu.l of freshly prepared Solution II, mix by inversion immediately and ice-wash for 5 min. Add 150. mu.l of ice-precooled Solution III, mix gently upside down, ice-cool for 5 min.

(5)13000rpm for 5min, the supernatant was transferred to a new EP tube.

(6) Adding equal volume of phenol, chloroform and isoamyl alcohol (according to the volume ratio of 25:24: l), and fully and uniformly mixing.

(7)13000rpm for 5min, carefully absorb the upper aqueous phase, transfer to a new PE tube, add 2 volumes of absolute ethanol, precipitate at-20 ℃ for 30 min.

(8)13000rpm for 10min, abandoning the supernatant, and washing the precipitate with 75% ethanol once.

(9) Centrifuge at 13000rpm for 5min, discard the supernatant.

(10) Standing the EP tube at room temperature for several min, adding appropriate amount of TE, resuspending the precipitate, and allowing to act at 56 deg.C for 30 min.

DNA product purification (see Tiangen instructions for operation)

(1) To adsorption column CB2, 500. mu.l of equilibration solution BL was added, centrifuged at 13,000rpm for 1min, the waste liquid in the collection tube was discarded, and adsorption column CB2 was replaced in the collection tube.

(2) The plasmid to be purified is added, and then 5 volumes of the binding solution PB is added thereto and mixed well.

(3) Adding the solution obtained in the previous step into an adsorption column CB2 (the adsorption column is placed into a collecting pipe), standing at room temperature for 2min, centrifuging at 13,000rpm for 1min, pouring off waste liquid in the collecting pipe, and placing adsorption column CB2 into the collecting pipe. Note that: the volume of the adsorption column is 800. mu.l, and if the volume of the sample is more than 800. mu.l, the sample can be added in batches.

(4) Adding 600 μ l rinsing solution PW (checking whether anhydrous ethanol is added before use) into adsorption column CB2, standing for 2-5min, centrifuging at 13,000rpm for 1min, discarding waste liquid in the collection tube, and placing adsorption column CB2 into the collection tube.

(5) And repeating the operation step 4.

(6) The adsorption column CB2 was returned to the collection tube and centrifuged at 13,000rpm for 2min to remove the rinse as much as possible. The adsorption column CB2 was left at room temperature for several min and thoroughly dried to prevent the residual rinse from affecting the next experiment.

(7) Placing the adsorption column CB2 into a clean centrifuge tube, suspending and dripping 30-50 μ l of elution buffer EB into the middle position of the adsorption film, and standing at room temperature for 2 min. The DNA solution was collected by centrifugation at 13,000rpm for 2 min.

6 digestion of the DNA product after purification

Restriction enzymes HindIII and XhoI were digested simultaneously at 37 ℃ for 1 hour, and the digestion was observed by electrophoresis on a 1.0% agarose gel, as shown in FIG. 10, wherein M: marker III; lanes 1-4: HindIII/XhoI. The results show that the bacterial solution contains the target fragment, and the plasmid is successfully transfected into C500.

The engineering strain is preserved in the China center for type culture Collection in 2018, 8, 15 and addresses: wuhan university in Wuhan city, Hubei province, the preservation number: CCTCC M2018542, the preservation date is: 8 and 15 days 2018.

Example 4: the eukaryotic dual expression Mueller-tube hormone and gonadotropin releasing inhibiting hormone plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd plasmid is expressed in vitro, and the transcription level of the plasmid PVAX-tPA-SAMH-2A-tPA-SRFRP-asd after transfection of cells is detected:

the plasmid prepared in example 3 was extracted using a plasmid extraction kit (purchased from Tiangen Biochemical technology (Beijing) Co., Ltd.) and transfected according to the instructions of Lipofectamine 3000 Lipofectamine Lipofectase kit (purchased from Invitrogen) when Hela cells (cell line of human cervical cancer cells) were grown in a monolayer of 60% to 70%. Hela cells were transfected for 48h, then trypsinized and harvested. mRNA of the cells was extracted according to Trizol (purchased from Invitrogen) using the instructions, and cDNA was obtained by reverse transcription based on the anti-Mullerian hormone, gonadotropin-releasing inhibitory hormone gene primers (see AMH-RFRP in example 3). Amplification is performed.

Amplification of the target fragment of AMH-RFRP was carried out using primers for AMH-RFRP using cDNA obtained by reverse transcription as a template. The results of 1% agarose electrophoresis detection of a fragment of about 1002bp (AMH-RFRP) are shown in FIG. 11, in which M: marker III; lane 1: amplification of the AMH-RFRP primer is negative; lane 2: AMH-RFRP has no treatment; lane 3: AMH-RFRP transfection is empty; lane 4: AMH-RFRP transfection double expression. The results indicate that the plasmid is capable of expression in eukaryotic cells.

Example 5: application of non-resistant DNA plasmid for resisting dual expression of Mueller's tube hormone and gonadotropin releasing inhibiting hormone in promoting animal reproduction

A large number of experimental studies prove that the litter size of mice can be increased by immunizing the mice with the constructed non-resistant screening vaccines (PVAX-tPA-SAMH-asd and PVAX-tPA-SRFRP-asd). Therefore, in the experiment, the nonresistant screening anti-mullerian hormone and gonadotropin releasing inhibin gene vaccine C500(PVAX-tPA-SAMH-asd and PVAX-tPA-SRFRP-asd) is used as a positive reference to compare whether the novel dual-expression anti-mullerian hormone and gonadotropin releasing inhibin gene vaccine PVAX-tPA-SAMH-2A-tPA-SRFRP-asd prepared in example 3 can achieve the effect of improving the litter size of mice or not, so as to identify the immune effect of the vaccine and try to promote the application of the novel dual-expression anti-mullerian hormone and gonadotropin releasing inhibin gene vaccine in production.

1. Materials and methods

1.1 plasmids and strains

The plasmids pVAX-tPA-SAMH-asd and pVAX-tPA-SRFRP-asd are constructed and stored in the laboratory; the strain salmonella choleraesuis C500(PVAX-tPA-SAMH-2A-tPA-SRFRP-asd) with double expression of anti-mullerian hormone and gonadotropin releasing inhibin is successfully constructed and stored at-80 ℃.

1.2 Experimental animal feeding management

The method comprises the steps of purchasing SPF (specific pathogen free) female Kunming mice of 5 weeks from the provincial center of Hubei, pre-feeding for 1 week, randomly grouping, entering a test period, feeding in a special animal room in a laboratory, controlling the feeding temperature to be about 25 ℃, and feeding with standard feed and conventional drinking water. Cage culture is carried out, 5 cages are used, sanitation and cleaning are carried out once a week, and whether normal drinking water and food intake and death due to intramuscular injection or blood sampling stress occur or not are observed every day. Mice were observed for weight gain following immunization.

1.3 vaccine immunization mouse test groups

Female Kunming mice after 1 week of pre-feeding were randomly divided into 20 mice/group. The test groups are as follows in table 2:

TABLE 2

1.4 immunization protocols for mice

Mice were immunized according to the experimental groups, water and mouse material were removed from the mice 4H prior to immunization, and 200 μ l of sodium bicarbonate (7.5%) was gavaged 30min prior to immunization, followed by 200 μ l of vaccine. The immunization was boosted once after 2 weeks in the same manner, and the mental and physical conditions of the mice were observed for one week after the immunization.

1.5 weighing of mice and blood Collection

Mice were weighed and body weight data recorded before immunization, 1W, 2W after immunization, and at the same time period. Collecting blood from tail vein of 0W or 8W, collecting blood in 1.5ml EP tube containing 20 μ l heparin sodium anticoagulant/tube, centrifuging at 3000r/min for 10min, carefully sucking upper layer plasma, and storing at-20.

1.6 statistics of litter size and litter weight of mated mice

All the dams were caged (2 per cage) 2W after vaccine boost and labeled. Healthy male mice and female mice are combined until the female mice are fully pregnant. The litter size, litter weight and litter weight of the mice were recorded.

1.7 detection of AMH/RFRP antibodies

Detecting the generation condition of the AMH/RFRP antibody in the immunized mouse by using an indirect ELISA method, which comprises the following specific steps:

(1) each well of the 96-well plate is coated with 50 ng/100. mu.l of AMH/RFRP antigen, and incubated overnight at 4 ℃.

(2) The reaction solution was discarded, and PBST was washed 3 times with 300. mu.l/well for 3min each.

(3) Add blocking solution (i.e., 1% BSA solution) 200. mu.l/well and incubate for 1h at 37 ℃.

(4) The reaction solution was discarded, and PBST was washed 3 times with 300. mu.l/well for 3min each.

(5) Diluting the plasma to be tested, setting a negative control hole, a non-specific adsorption hole (and PBST to replace the plasma) and zero regulation at 100 mu l/hole, and incubating for 90min at 37 ℃.

(6) The reaction solution was discarded, and PBST was washed 5 times with 300. mu.l/well for 3min each.

(7) Goat anti-mouse IgG-HRP (Google, 1:3000 dilution) was added to the reaction solution in an amount of 100. mu.l/air, and the reaction was carried out at 37 ℃ for 1 hour.

(8) The reaction solution was discarded, and PBST was washed 5 times with 300. mu.l/well for 3min each.

(9) Adding TMB substrate developing solution 150 μ l/well, and reacting for 15min in dark.

(10) Adding 2mol/L H₂SO₄The reaction was stopped with 50. mu.l of stop solution per well, and the OD value of each well was measured at a wavelength of 450nm within 15 min.

2 results and analysis

2.1 immune response

2.1.1 anti-AMH antibody levels following immunization of mice with different vaccines

Attenuated sand respectively containing plasmids pVAX-asd, pVAX-tPA-SAMH-asd and pVAX-tPA-SAMH-2A-tPA-SRFRP-asdBacterium solution of Meniere's bacterium C500 according to 10¹⁰CFU/ml dose immunized mice, priming immune 8W blood collection for detection of anti-AMH antibody. As can be seen from FIG. 12, the anti-AMH antibody was produced in all the experimental groups, and the difference between the experimental groups was not significant (P)>0.05)。

2.1.2 anti-RFRP antibody levels following immunization of mice with different vaccines

Attenuated salmonella C500 bacterial liquid respectively containing plasmids pVAX-asd, pVAX-tPA-SRFRP-asd and pVAX-tPA-SAMH-2A-tPA-SRFRP-asd is treated according to the proportion of 10¹⁰Mice were immunized with CFU/ml doses, and blood was collected for detection of anti-RFRP antibodies at 8 weeks of prime immunization. As can be seen from FIG. 13, anti-RFRP antibodies were produced in all experimental groups and the differences between the experimental groups were not significant (P)>0.05)。

2.2 comparison of litter size and birth weight of mice immunized with different vaccines

The number born and the birth weight of the mice immunized by different vaccines are counted, and the results are shown in table 3.

TABLE 3 litter size and litter weight comparison of different vaccine immunized mice

Note: the lower case letters marked on the data in the same column are completely different and mean significant difference (P < 0.05), whereas, mean insignificant difference (P >0.05) is indicated, and all data are mean. + -. standard deviation.

The results show that the litter size: the litter size of the PVAX-tPA-SAMH-2A-tPA-SRFRP-asd group is obviously higher than that of the PBS group and the pVAX-asd group, and is higher than that of the single expression PVAX-tPA-SAMH-asd group and the PVAX-tPA-SRFRP-asd group. Birth weight: the birth weight of each group is counted, and the result shows that the birth weight of the newborn mice is not influenced by different vaccine immunization female mice, and the difference between the groups is not significant (P > 0.05).

The results show that: the DNA vaccine of PVAX-tPA-SAMH-2A-tPA-SRFRP-asd constructed by the invention can effectively improve the reproductive capacity of animals.

Construction of appendix 1 Carrier PVAX-tPA-SRFRP-asd

1.1.1 amplification of tPA-SRFRP fragments

pIRES-tPA-SINH-tPA-SRFRP plasmid is used as a template for PCR amplification (Wenxinggang, the regulation and control of GnIH on mouse reproduction and the research of molecular mechanism and gene immunity technology, 2015), and the specific PCR system and program are 1.1.2. the upstream primer of the tPA-SRFRP has a KpnI restriction site, the downstream primer has an EcoRI restriction site, and the primer sequences are as follows:

1.1.2 ligation of tPA-SRFRP fragments to pMD19T (Simple)

Cutting Agarose Gel of tPA-SRFRP segment from the Gel under an ultraviolet lamp after electrophoresis is finished, and recovering according to the operating specification of TaKaRa miniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Kit, and the specific steps are as follows: after electrophoresis on a 1% agarose gel, single bands of the target DNA were excised from the agarose gel under an ultraviolet lamp, placed in a clean 1.5mL EP tube, 3 times the mass volume (100mg ═ 100. mu.L) of Buffer GM was added, mixed well, and the gel mass was dissolved at room temperature, during which the EP tube was flicked to completely melt the gel. Transferring the melted liquid to an adsorption column, centrifuging at 12000rpm for 1min, pouring off the waste liquid in the collection tube, adding 500 mu LBuffer WB, centrifuging at 12000rpm for 30s, and washing twice; finally, centrifuging at 12000rpm for 1min to remove trace liquid in the adsorption column. The column was transferred to a clean 1.5mLEP tube, 30. mu.L solution Buffer was added, and the tube was left at room temperature for 2min and centrifuged at 12000rpm for 1min to elute the DNA. The purity is recovered and the concentration is measured by electrophoresis detection, and the collected DNA solution is used for the next experiment or stored at-20 ℃ for later use.

Connecting the tPA-SRFRP fragment with a pMD19T-simple vector, and specifically comprising the following steps: calculating the connection volume ratio of the carrier and the target fragment according to the concentration of the recovered DNA, and connecting the pMD19T and the tPA-SRFRP fragment by using Solution I, wherein the connection system is as follows:

mix well, centrifuge briefly, connect overnight in a 16 ℃ water bath.

1.1.3 transformation of bacteria

(1) The competent cell DH5 α was thawed by removing from the ice bath at-80 deg.C, 10. mu.L of the ligation product was added, gently mixed and ice-cooled for 30 min.

(2) The tube was then transferred to 42 ℃ for 90sec and then quickly removed and placed on ice for 2min, a process that did not shake the tube.

(3) Adding 400 μ L LB liquid culture medium without antibiotic, mixing, and shaking-culturing at 37 deg.C and 200r/min for 1 h. The bacteria were revived.

(4) Centrifuge at 3000r/min for 5min, discard 400. mu.L of supernatant.

(5) The residual liquid is gently mixed, evenly coated on LB solid medium containing Amp antibiotic (50 mug/mL) by using a coater, and cultured at constant temperature of 37 ℃ for 12-14h, and whether a transformed colony grows or not is observed.

1.1.4 screening and identification of Positive clones

A single colony is picked up in LB liquid culture medium containing Amp antibiotics (50 mu g/mL), shaking culture is carried out at 37 ℃ and 200r/min for about 12h, plasmid extraction is carried out by using a Tiangen kit, and double enzyme digestion identification is carried out on pMD19T-tPA-SRFRP plasmid through KpnI and EcoRI. The enzyme digestion system is as follows:

mixing, centrifuging briefly, and reacting in water bath at 37 deg.C overnight.

Carrying out 1% agarose gel electrophoresis detection on 10 mu L of enzyme digestion products, screening out a suspected plasmid pMD19T-tPA-SIRFRP, sending the plasmid to Wuhan engine scientific creative biotechnology limited company for sequencing, carrying out amplification culture on a bacterial liquid corresponding to the plasmid with correct sequence alignment, extracting the plasmid, and storing at-20 ℃ for later use.

1.1.5 digestion and recovery of vector pVAX-asd and plasmid pMD19T-tPA-SINH

With a slight modification in reference to Thermo specifications, the specific steps are as follows: the plasmid pVAX-asd and the plasmid pMD19T-tPA-SRFRP are subjected to double digestion by restriction endonucleases KpnI and EcoRI, the cohesive ends at the two ends are exposed, and the digestion systems are respectively as follows:

mixing, centrifuging briefly, and reacting in water bath at 37 deg.C overnight.

After enzyme digestion, a target band is separated by 1 percent agarose gel electrophoresis, tPA-SRFRP and a linear pVAX-asd fragment are recovered by using a TaKaRa MiniBEST agarose gel DNA Extraction Kit Ver.4.0 Kit, the recovery purity is detected by electrophoresis after recovery, and the concentration is measured.

1.1.6 Gene ligation of interest

The method is carried out according to the operating specification of Thermo T4 ligase specification, and comprises the following specific steps: calculating the link ratio of the vector and the target fragment according to the concentration of the DNA detected after recovery, and connecting pVAX-asd and tPA-SRFRP fragments by using T4 DNA Ligase in the following connection system:

mix well, centrifuge briefly, connect overnight in a 16 ℃ water bath.

1.1.7 transformation of bacteria

(1) The competent cell X6097 was thawed by taking out of the ice bath from-80 ℃, 10. mu.L of the ligation product was added, gently mixed and ice-cooled for 30 min.

(4) Centrifuge at 3000r/min for 5min, discard 400. mu.L of supernatant.

(5) And (3) gently mixing the residual liquid, uniformly coating an LB plate without any exogenous substance by using an applicator, culturing at the constant temperature of 37 ℃ for 18-20h, and observing whether a transformed colony grows out.

1.1.8 screening and identification of Positive clones

Selecting a single colony in an LB liquid culture medium without any exogenous substance, carrying out shake culture at 37 ℃ and 200r/min for about 12h, carrying out plasmid miniextraction by using a Tiangen kit, and carrying out double enzyme digestion identification on pVAX-tPA-SRFRP-asd plasmid by KpnI and EcoRI. The enzyme digestion system is as follows:

mixing, centrifuging briefly, and reacting in water bath at 37 deg.C overnight.

Carrying out 1% agarose gel electrophoresis detection on 10 mu L of enzyme digestion products, screening out a suspected plasmid of pVAX-tPA-SRFRP-asd, sending the plasmid to Wuhan engine science and innovation biotechnology Limited company for sequencing, carrying out amplification culture on a bacterial liquid corresponding to the plasmid with correct sequence alignment, extracting the plasmid, and storing at-20 ℃ for later use.

Construction of appendix 2 vector PVAX-tPA-SAMH-asd

1.2.1 tPA-SAMH fragment Synthesis

Searching and screening the base sequence of the corresponding AMH epitope antigen coding gene obtained on NCBI, inserting the base sequence into the 5 'end of hepatitis B surface antigen, inserting tPA signal peptide into the 3' end of hepatitis B surface antigen, respectively adding two enzyme cutting sites of BamH I and EcoR I into the upstream and downstream of the whole fragment to form tPA-SAMH fragment, and sending the tPA-SAMH fragment to a production company for synthesis.

1.2.2 cleavage and recovery of vector pVAX-asd and plasmid pUC-tPA-SAMH

The specific process is referred to 1.1.5.

1.2.3 target Gene ligation

The specific steps refer to 1.1.2.

1.2.4 bacterial transformation

The specific steps refer to 1.1.7.

1.2.5 screening and identification of Positive clones

The specific process is referred to 1.1.8.

Sequence listing

<110> university of agriculture in Huazhong

<120> AMH-INH-GNIH three-expression gene vaccine for improving animal fertility, preparation method and application thereof

<160>21

<170>SIPOSequenceListing 1.0

<210>1

<211>837

<212>DNA

<213> Artificial Sequence (Artificial Sequence) (2 Ambystoma latex x Ambystomajeffersonia)

<400>1

aagcttgcca ccatggatgc aatgaagaga gggctctgct gtgtgctgct gctgtgtgga 60

gcagtcttcg tttcgcccag catggagagc acaacatcag gattcctagg acccctgctc 120

gtgttacagg cggggttttt cttgttgaca agaatcctca caataccaca gagtctagac 180

tcgtggtgga cttctctcaa ttttctaggg ggagcaccca cgtgtcctgg ccaaaattcg 240

cagtccccaa cctccaatca ctcaccaacc tcttgtcctc caatttgtcc tggctatcgc 300

tggatgtgtc tgcggcgttt tatcatattc ctcttcatcc tgctgctatg cctcatcttc 360

ttgttggttc ttctggacta ccaaggtatg ttgcccgttt gtcctctact tccaggaaca 420

tcaactacca gcacgggacc atgcaagacc tgcacgattc ctgctcaagg aacctctatg 480

tttccctctt gctgctgtac aaaaccttcg gacggaaact gcacttgtat tcccatccca 540

tcatcctggg ctttcgcaag attcctatgg gagtgggcct cagtccgttt ctcctggctc 600

agtttactag tgccatttgt tcagtggttc gtagggcttt cccccactgt ttggctttca 660

gttatatgga tgatgtggta ttgggggcca agtctgtaca acatcttgag tcccttttta 720

cctctattac caattttctt ttgtctttgg catatgaggg aagaggtctc caatacctca 780

gcctcgccca gggagcaggc cacaggcagc gggacactca tctttcagca aggtacc 837

<210>2

<211>864

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gaattcgcca ccatggatgc aatgaagaga gggctctgct gtgtgctgct gctgtgtgga 60

gcagtcttcg tttcgcccag cgtcgacatg gagagcacaa catcaggatt cctaggaccc 120

ctgctcgtgt tacaggcggg gtttttcttg ttgacaagaa tcctcacaat accacagagt 180

ctagactcgt ggtggacttc tctcaatttt ctagggggag cacccacgtg tcctggccaa 240

aattcgcagt ccccaacctc caatcactca ccaacctctt gtcctccaat ttgtcctggc 300

tatcgctgga tgtgtctgcg gcgttttatc atattcctct tcatcctgct gctatgcctc 360

atcttcttgt tggttcttct ggactaccaa ggtatgttgc ccgtttgtcc tctacttcca 420

ggaacatcaa ctaccagcac gggaccatgc aagacctgca cgattcctgc tcaaggaacc 480

tctatgtttc cctcttgctg ctgtacaaaa ccttcggacg gaaactgcac ttgtattccc 540

atcccatcat cctgggcttt cgcaagattc ctatgggagt gggcctcagt ccgtttctcc 600

tggctcagtt tactagtgcc atttgttcag tggttcgtag ggctttcccc cactgtttgg 660

ctttcagtta tatggatgat gtggtattgg gggccaagtc tgtacaacat cttgagtccc 720

tttttacctc tattaccaat tttcttttgt ctttggcata tggcgatggc ccacctgcct 780

ctgagactcg gaaaaaatag agaggacagc ctctccagat gggtcccaaa tctgccccag 840

aggtttgtat acatttaact cgag 864

<210>3

<211>75

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggtaccggca gtggagaggg cagaggaagt ctgctaacat gcggtgacgt cgaggagaat 60

cctggcccag gatcc 75

<210>4

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccggaattcg ccaccatgga tgcaatgaag agagggc 37

<210>5

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccgctcgagt taaatgtata caaacctctg gggc 34

<210>6

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccgaagcttg ccaccatgga tgcaatgaag agagggc 37

<210>7

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ccgggtacct tgctgaaaga tgagtgtccc g 31

<210>8

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccgggatccg ccaccatgga tgcaatgaag agagggc 37

<210>9

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccgctcgagt taaatgtata caaacctctg gggc 34

<210>10

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tacgcgcata caacaaaagt cgc 23

<210>11

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gccattctga cggaattaac ggg 23

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ttgctttcca actgctgagc 20

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tcctatctgc gtcgtcctac 20

<210>14

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

caggatacct atagtgctgc 20

<210>15

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cgcaccgtca aaggaaccgt 20

<210>16

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

atgagggaag aggtctccaa ta 22

<210>17

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

aatgtataca aacctctggg gca 23

<210>18

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

atgagggaag aggtctccaa ta 22

<210>19

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tcttgtctgt ggcagtcggc 20

<210>20

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

cggtaccccg atggatgcaa tgaagag 27

<210>21

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

gaattcgcgg ccgcttaaat gtatacaaac c 31

Claims

1. An engineering bacterium containing AMH-GNIH dual-expression gene vaccine for improving animal fertility, which is characterized in that the engineering bacterium is preserved in China center for type culture Collection in 2018, 8, 15 and the preservation number is as follows: CCTCC M2018542.

2. The AMH-GNIH dual-expression gene vaccine prepared by the engineering strain of claim 1.

3. The AMH-GNIH double-expression gene vaccine for improving the animal fecundity is characterized by comprising a tPA-SAMH gene and a tPA-SRFRP gene, wherein the gene sequence of the tPA-SAMH gene is shown as SEQ ID No.1, and the gene sequence of the tPA-SRFRP gene is shown as SEQ ID No. 2.

4. The dual-expression gene vaccine of claim 3, wherein a 2A peptide is connected between the tPA-SAMH gene and the tPA-SRFRP gene, the gene sequence of the 2A peptide is shown as SEQ ID No.3, and the gene sequence of the AMH-GNIH dual-expression gene vaccine is formed by sequentially connecting the sequences shown as SEQ ID No.1, SEQ ID No.3 and SEQ ID No. 2.

5. A preparation method of AMH-GNIH double-expression gene vaccine for improving animal fertility is characterized by comprising the following operation steps:

s4 and a 2A peptide splicing head are synthesized by Shanghai and cloned on a PUC57 vector; wherein, the 2A peptide contains a sequence shown as SEQ ID NO. 3;

6. The method of claim 5, wherein the primer set for PCR amplification of the plasmid PVAX-tPA-SRFRP-asd in step S1 is shown in SEQ ID NO.4 and SEQ ID NO. 5.

7. The method of claim 5, wherein the primer set for PCR amplification of the plasmid PVAX-tPA-SAMH-asd in step S1 is shown in SEQ ID NO.6 and SEQ ID NO. 7.

8. The method of claim 5, wherein the primer set for PCR amplification of the plasmid PVAX-tPA-SRFRP-asd in step S1 is shown in SEQ ID NO.8 and SEQ ID NO. 9.

9. The AMH-GNIH double-expression gene vaccine for improving animal fecundity or the application of the vaccine prepared by the preparation method in preparing the medicine for improving animal fecundity.