CN110804673A - Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method - Google Patents
Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method Download PDFInfo
- Publication number
- CN110804673A CN110804673A CN201911100398.5A CN201911100398A CN110804673A CN 110804673 A CN110804673 A CN 110804673A CN 201911100398 A CN201911100398 A CN 201911100398A CN 110804673 A CN110804673 A CN 110804673A
- Authority
- CN
- China
- Prior art keywords
- banana
- foc4
- qpcr
- arbuscular mycorrhizal
- mycorrhizal fungi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer composition for simultaneously detecting Arbuscular mycorrhizal fungi and banana vascular wilt in bananas and a qPCR method, wherein specific primers of Arbuscular Mycorrhizal (AM) fungi and Fusarium oxysporum cubeba transformation type 4 # physiological race (Fusarium oxysporum f.sp. cubense race 4, FOC4) are designed and synthesized, a fluorescent quantitative PCR (qPCR) system is established, products are amplified, and the abundance of the AM fungi and Foc4 in banana root systems is detected by using the qPCR method. The synchronous real-time detection method for mycorrhizal fungi and blight bacteria is developed and verified in banana root systems, and has important practical significance for evaluation of biocontrol capability of banana plantations and disease prevention and control.
Description
Technical Field
The invention relates to a primer combination and a qPCR method for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas.
Background
Banana vascular wilt is a destructive soil-borne disease caused by Fusarium oxysporum cubeba transformation (FOC), and is the most important disease facing the global banana industry. Once the blight germina invade in the banana garden, the light banana plants are yellowed, pseudostems are rotted from bottom to top, the heavy banana plants are withered, and the whole banana garden is in no harvest. The pathogenic bacteria of banana Foc have four physiological races, wherein the No. 4 physiological race Foc4 can infect most banana varieties and is the most harmful and most destructive one of the four physiological races.
The traditional prevention and treatment of banana vascular wilt mainly comprises a physical method, an agricultural technology, a chemical method and the like, and has various problems of incomplete sterilization of Foc pathogenic bacteria, more pesticide residues in soil, soil ecological disorder and the like. Biological control is a main technical means for controlling plant diseases at present, and is considered to be the most environment-friendly, residue-free and environment-friendly control means. Among them, Arbuscular Mycorrhizal (AM) fungi are a particularly important group of beneficial microorganisms in biological control. The AM fungi can form a reciprocal symbiotic system with most terrestrial plants, and on one hand, the AM fungi receive carbohydrates provided by host plants, on the other hand, the AM fungi provide moisture and mineral nutrition for the plants and improve the plant growth vigor of the plants; forming a mycorrhizal structure, and constructing a physical defense barrier on the surface of a host plant cell; inducing the host plant to generate acquired systemic resistance, thereby improving the disease resistance of the plant. Research proves that the AM fungus can slow down the invasion speed of Foc in banana root tissue by competing with Foc for invasion sites, so that the abundance of banana root Foc is reduced.
In agricultural production, the rapid and efficient detection of the pathogenic bacteria and the biocontrol bacteria of the bananas Foc4 is an important basis for the work of prediction, prevention, control, treatment and the like of agricultural diseases, and is an urgent problem to be solved in the banana industry. At present, molecular means for the classification identification and quantitative detection of AM fungi and Foc pathogenic bacteria in host plants have been reported by mature research methods. However, because the AM fungus has a far-reaching relationship with Foc pathogenic bacteria, a method for simultaneously and quantitatively detecting two microorganisms in the same host plant is not established.
Disclosure of Invention
The invention mainly aims to provide a primer combination and a qPCR method for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas.
The technical scheme adopted by the invention for solving the technical problem is as follows:
a primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises:
AMF Intra1 GGTGCGATTCTGTGGAGTGTGAGG
Intra2 CAAGCTTTCGGCACCAGAGCAACG
Foc4 FocSc-1 CAGGGGATGTATGAGGAGGCTAGGCTA
FocSc-2 GTGACAGCGTCGTCTAGTTCCTTGGAG
Banana BAN-F TCGTCACCTATTGGGATGC
BAN-R GCTTTAATAAGTGCTTCGGTG。
a qPCR system for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises: the total volume of the system is 25uL, and the AM fungus reaction program is 95 ℃ for 30 sec; 95 ℃ 15sec, 58 ℃ 90sec, 72 ℃ 60sec, 40 cycles; 10min at 72 ℃. The resulting product was subjected to dissolution analysis at 95 ℃ for 15sec, 60 ℃ for 30sec, and 95 ℃ for 15 sec.
Preferably, the qPCR system has a total volume of 25uL, 1uL DNA template, and 0.2uM of each primer.
A qPCR method for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises the following steps:
1) synthesizing the aforementioned primer composition; extracting DNA of a sample to be detected;
2) and (3) carrying out AM Q-PCR on the extracted sample DNA, wherein the total volume of an AM system is 25 uL: contains 12.5uL of XSYBR PremixdImierEraser, and 0.75uL of each primer with the concentration of 10uM of Intra1/Intra 2; template 2uL, ddH2O supplemented to 25 uL; AMF fungal reaction program 95 ℃ 30 sec; 95 ℃ 15sec, 58 ℃ 90sec, 72 ℃ 60sec, 40 cycles; 10min at 72 ℃;
the extracted sample DNA was subjected to Foc 4Q-PCR, wherein the total volume of Foc4 system was 25 uL: contains 2 × SYBRPremifixDimierereraser 12.5uL, FocSc-1/FocSc-2 primer concentration (10uM) each 0.75 uL; template 2uL, ddH2O supplemented to 25 uL; foc4 qPCR reaction program 95 ℃ 30 sec; 5sec at 95 ℃, 30sec at 55 ℃, 30sec at 72 ℃, 40 cycles, 10min at 72 ℃;
3) determining the amount of DNA of the arbuscular mycorrhizal fungi and Foc4 in the banana according to the result of step 2).
Compared with the background technology, the technical scheme has the following advantages:
the invention utilizes two pairs of primers to simultaneously detect the biological abundance of Gi and Foc4 in the Brazil banana root system, thereby obtaining a stable and reliable detection method. The AM fungus amplification result is obvious, and the data is accurate; the sensitivity of the primer Focsc1/Focsc2 is verified, and the lowest detection value of Foc4 is lower than 0.1pg, which shows that the Focsc1/Focsc2 primer is highly sensitive to a detected sample and has good repeatability.
The invention constructs the qPCR system and the method for simultaneously detecting the abundance of the AM fungus and the Foc4, the detection sensitivity of the established qPCR system is high, and the lowest detection value is as low as 0.1 pg; the qPCR system established by the invention has strong specificity, accurate quantification and good stability, and is not interfered by other biological information in the same system.
Drawings
The invention is further illustrated by the following figures and examples.
FIG. 1 gel electrophoresis of PCR amplification products with specific primers.
FIG. 2 shows the melting curve of the fluorescent quantitative PCR.
FIG. 3 specific fragment cloning and blue-white screening validation
(a) Recombinant plasmid map, (b) blue-white screening result, (c) AMF250And Foc4242And (5) verifying the result of the recombinant plasmid PCR. M is Marker1000, and 1 is CK; 2 is AMF250Amplifying the recombinant plasmid; 3 is Foc4242And (5) amplifying the recombinant plasmid.
FIG. 4 shows the amplification curve (a) and the standard curve (b) of the AM fungal standard recombinant plasmid.
FIG. 5Foc4242An amplification curve (a) and a standard curve (b) of a standard recombinant plasmid.
FIG. 6 shows the abundance of the root systems Gi and Foc4 of Brazil banana in example 2
Detailed Description
Testing banana seedlings: susceptible variety Brazil banana (Musa acetate. AAA group pc. Cavendish) tissue culture seedling with 5 leaf ages and consistent growth vigor is provided by Zhangzhou Weitian biotechnology limited.
Banana fusarium wilt: fusarium oxysporum, physiological race 4 (Fusarium oxysporum f.sp. cubensrace 4, Foc4), was provided by the research institute of fruit trees at the academy of agricultural sciences, guangdong.
The arbuscular mycorrhizal fungi are selected from Glomus intraradces, Gi, available from Premier technologies, Rivi fre-Du-Loup, QC, Canada. The spore suspension contained 4,000 spores per ml.
Primary reagent
Gel recovery kit, plasmid extraction kit (Shanghai Biotechnology Co., Ltd.), RNA purification kit (Tiangen Biotechnology Co., Ltd.), reverse transcription kit, Taq DNA polymerase, PCR reaction reagent, p MD-18TVector, DNA Maker, SYBR Premix Ex TaqTM (Tli RheaseH Plus) (Baojii physician technology (Beijing) Co., Ltd.), ampicillin (Amp), isopropyl- β -D-thiogalactose (IPTG), 5-bromo-4-chloro-3-indole- β -D galactose (X-gal), primer synthesis, DNA sequencing (Shanghai Biotechnology Co., Ltd.) and other reagents are all domestic analysis pure reagents.
Example 1
Establishment of 1 qPCR method
1.1 sample DNA extraction
(1) Extracting DNA of bananas: each group was collected separately and the three plants were pooled together and sampled. 200mg of extracted genomic DNA was accurately weighed. Extracting banana genome DNA according to the instruction of the kit for extracting genome DNA of the plant.
(2) Foc4 DNA extraction: foc4 preserved at 4 deg.C in refrigerator was inoculated on PDA medium and placed in a 28 deg.C incubator for inverted culture for 5 days. And transferring the activated pathogenic bacteria cake into a triangular flask filled with 100mL of PDA liquid culture medium, and culturing at 28 ℃ for 5d at 180 r/min. Using sterile gauze filter paper, 100mg of mycelium was obtained by suction filtration, and Foc4 of whole genome DNA was extracted according to the instruction for fungal genome DNA extraction.
(3) AM fungal DNA extraction: to obtain high quality AM fungal DNA, the AM fungal inoculant was aspirated under a stereoscope and 12000 sporozoites were aspirated with a 10uL pipette tip and the remaining plant debris or impurities were removed under the microscope as AM fungal DNA extract samples. After all samples were ground in liquid nitrogen, sample DNA was extracted according to the fungal genomic DNA protocol.
1.2 specific primer design and test
The banana PCR primers were designed on the rbc L gene, encoded by the plant chloroplast DNA, with high conservation of the coding region. The product is 189 bp. Specific primers for AM fungus and Foc4 are shown in Table 1.
Primers used in Table 1
DNA from banana, AM fungus and Foc4 were extracted separately and amplified by conventional PCR and the primer specificity was checked on a 3% agarose gel.
1.3 clonal transformation of the Gene of interest
The desired fragment was recovered and purified by cutting the gel, and specific fragment Foc4 was cloned using Takara pMDTM18-T cloning kit (Takara 6011)242And AMF250The plasmid was ligated to pMD-18-T Vector by preparing 5uL of insert and pMD18-T Vector mixed DNA Solution in a microcentrifuge tube, adding Solution I to react at 16 ℃ for 45min, taking 2uL of the above-mentioned ligation Solution and adding it to 50uL of E.coli DH5 α for transformation, confirming the transformants expressing Foc242 and AMF250 by blue-white screening and PCR。
1.4 construction of molecular System for fluorescent quantitative PCR detection of AM fungus
Extracting standard recombinant plasmid according to the plasmid extraction instruction, and mixing the plasmid with AMF250The plasmid concentration was measured by an Implen ultramicro spectrophotometer. Standard recombinant plasmids were diluted 10 Xgradiently in the range of 10-1、10-2、10-3、10-4、10-5、10-6、10-7copies/mL. qPCR was performed using SYBR Green. Total system volume 25 uL: 2 × SYBR Premix DimerEraser 12.5uL, 0.75uL each for the concentration of primers Intra1/Intra2 (10 uM); template 2uL, ddH2O to 25 uL; AM fungal reaction program 95 ℃ 30 sec; 95 ℃ 15sec, 58 ℃ 90sec, 72 ℃ 60sec, 40 cycles; 10min at 72 ℃. The product obtained was analyzed for dissolution at 95 ℃ for 15sec, 60 ℃ for 30sec, 95 ℃ for 15sec, with three technical repetitions for each treatment. Based on the results of the standard curve for qPCR, the amount of pathogen in the test sample was calculated.
1.5 construction of molecular System for fluorescent quantitative PCR detection Foc4
Extracting standard recombinant plasmid according to the plasmid extraction instruction, and mixing the recombinant plasmid with Foc242The plasmid concentration of the standard recombinant plasmid of (4) was measured by an Implen ultramicro spectrophotometer. Standard plasmids were diluted 10 Xgradiently in the range of 10-1-10-6copies/mL. qPCR was performed using Takara SYBR Premix Ex TaqTM. The total volume of the system was 25uL,2 XSSYBRPremifxdimereraser 12.5uL, and FocSc-1/FocSc-2 primer concentrations (10uM) were 0.75uL each; template 2uL, ddH2O was supplemented to 25 uL.
Foc4 qPCR reaction program 95 ℃ 30 sec; 95 ℃ 5sec, 55 ℃ 30sec, 72 ℃ 30sec, 40 cycles. 10min at 72 ℃. The product obtained was analyzed for dissolution at 95 ℃ for 15sec, 60 ℃ for 30sec, 95 ℃ for 15sec, with three technical repetitions for each treatment. Based on the results of the standard curve for qPCR, the abundance of AM fungus versus Foc4 in the test samples was calculated.
2 qPCR System
2.1 primer validation
The results of the qPCR amplification using DNA from banana, AM fungus and Foc4 as templates and corresponding primers on 3% gel electrophoresis are shown in FIG. 1. The result shows that each pair of primers can amplify a target band in the original species, the three lengths are about 200bp, the primer amplification bands are clear, and the method meets the amplification requirement of qPCR.
In addition, the solubility curve of qPCR shows that the specificity is strong and the quantitative result is accurate. Dissolution temperature T of amplification products of banana, AM fungus and Foc4m78.45 deg.C, 81.14 deg.C and 83.53 deg.C, respectively. The dissolution curve is single peak, no hetero-peak, no non-specific fluorescence, and is not affected by primer dimer (FIG. 2).
2.2 clonal transformation of the Gene of interest
Specific fragment Foc242And AMF250Cloning to pMD-18-T Vector, connecting, transferring to Escherichia coli DH5 α, screening with blue-white spot (FIG. 3b), culturing overnight with white spot, extracting plasmid, and confirming by PCR to construct Foc4242And AMF250The results of the standard recombinant plasmid of (3 c). The result shows that the two recombinant plasmids can amplify target bands in the specific primers, the fragment length is correct, the primer amplification bands are clear and bright, and the success of constructing the standard recombinant plasmids is proved, so that the requirements of standard products required by constructing absolute quantitative PCR programs can be met.
Standard recombinant plasmids were diluted 10 Xgradiently in the range of 10-1～10-7copies/mL. Standard curve equation for AM fungal amplification-3.14X +36, R20.999 and 108.44 percent of E. The amplification curve of the recombinant plasmid standard fragment of each concentration is smooth, the amplification presents a typical S-shaped curve, the interval of each cycle threshold is uniformly distributed, and the amplification effect is ideal (figure 4).
2.4 molecular System for detecting Foc4 Biomass by qPCR
Standard recombinant plasmids were diluted 10 Xgradiently in the range of 10-1～10-7copies/mL. Foc4 standard curve equation for amplification of-3.46X +38.49, R2-0.992 and E% 94.62. The amplification curve of the recombinant plasmid standard fragment with each concentration is smooth, the amplification curve presents a typical S shape, the cycle threshold intervals are uniformly distributed, and the amplification effect is ideal (figure 5).
The invention utilizes two pairs of primers to simultaneously detect the biological abundance of Gi and Foc4 in the Brazil banana root system, thereby obtaining a stable and reliable detection method. The AM fungus amplification result is obvious, and the data is accurate; the sensitivity of the primer Focsc1/Focsc2 is verified, and the lowest detection value of Foc4 is lower than 0.1pg, which shows that the Focsc1/Focsc2 primer is highly sensitive to a detected sample and has good repeatability.
The Neurospora Gi and the Plantain oxysporum Foc4 used in the invention are soil fungi, but have distant relativity. Successfully establishing a qPCR system for simultaneously detecting the abundance of AM fungi and Foc4 in Brazil banana, wherein the simultaneous detection in the invention refers to the detection by using the same DNA template, and the two detection machines are adopted; the dissolving temperatures of specific primer products of banana, AM fungi and Foc4 can be obviously separated, the dissolving curve is a single peak, no impurity peak and no non-specific fluorescent signal, the biological information of each primer product is not influenced by other species information in the same DNA sample, the quantitative result is accurate, and the method can provide powerful technical support for inhibiting banana fusarium wilt by the AM fungi.
Example 2
In this example, let us say two-factor treatment of inoculations Gi and Foc4, for four treatment groups: 1) CK, no inoculation with Gi and Foc 4; 2) gi group, inoculating single Brazilian banana seedling with Gi; 3) foc4 groups, the Brazilian banana seedling is singly inoculated with Foc 4; 4) gi + Foc4 group, Brazilian banana plantlet was inoculated with both Gi and Foc 4.
Cleaning the culture medium surrounding the roots of the Brazilian banana tissue culture seedlings with clear water, soaking the roots of the tissue culture seedlings in Gi and Foc4 inoculants, replacing the inoculants with clear water in CK treatment, and soaking the roots for 30min according to the volume of the inoculants calculated according to 1 mL/banana seedling. Adding 100g of mixed matrix into a square plastic basin, planting the Brazilian banana seedlings subjected to root soaking in the basin, uniformly applying the residual inoculant subjected to root soaking in the same plastic basin, filling 200g of sandy soil into the plastic basin, completely covering the roots, and thoroughly watering.
The test was carried out for a total of four treatments, each of which was repeated for 10 pots, with 1 seedling of Brazil banana planted in each pot. All potted plants were randomly arranged and cultured in a greenhouse of the horticultural line of the university of Huaqiao at an average daily/night temperature of 30/22 ℃ and a relative humidity of 80%. Spraying the Brazil banana leaves with water mist three times every day two weeks after planting; every 2 weeks, 25mL of dephosphorized Hoagland's nutrient solution was added to each pot.
And (4) collecting a sample to be tested after the Brazilian banana seedlings are planted for 60 days.
The banana root samples of different treatments were accurately weighed at 200 mg. Extracting plant genome DNA according to the instruction of the plant DNA extraction kit. 2uL was added per reaction as qPCR template.
The reaction system and the reaction procedure were the same as in example 1.
As can be seen from FIG. 6, the qPCR detection system established by the invention can simultaneously detect the abundance of Gi and Foc4 in the root system of Brazil banana. After Gi inoculation treatment, the Gi abundance of the Brazil banana root system reaches 2 multiplied by 105copies/mL; the inoculation Foc4 treatment shows that the abundance of the Brazil banana root system Foc4 reaches 1.2 multiplied by 105copies/mL; however, after Gi and Foc4 inoculation, the abundance of the Brazil banana root system Gi and Foc4 is 1.3X 105copies/mL、0.3×105copies/mL, the Gi and Foc4 abundances were reduced by 35%, 75%, respectively, but the Foc4 abundance reduction was more pronounced than with vaccination alone. The results show that Gi and Foc4 are inoculated simultaneously, and Gi has good inhibition effect on Brazil banana fusarium wilt bacteria Foc 4.
Sequence listing
<110> university of Chinese
<120> primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ggtgcgattc tgtggagtgt gagg 24
<210>2
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
caagctttcg gcaccagagc aacg 24
<210>3
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
caggggatgt atgaggaggc taggcta 27
<210>4
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gtgacagcgt cgtctagttc cttggag 27
<210>5
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tcgtcaccta ttgggatgc 19
<210>6
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gctttaataa gtgcttcggt g 21
Claims (4)
1. A primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises:
AM Intra1 ggtgcgattctgtggagtgtgagg
Intra2 caagctttcggcaccagagcaacg
Foc4 FocSc-1 caggggatgtatgaggaggctaggcta
FocSc-2 gtgacagcgtcgtctagttccttggag
Banana BAN-F tcgtcacctattgggatgc
BAN-R gctttaataagtgcttcggtg。
2. a kit for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas, comprising the primer composition of claim 1.
3. A qPCR system for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises: AM system total volume 25 uL: contains 0.75uL of each primer with a concentration of 10uM for × SYBR Premix DimerEraser 12.5uL and for Intra1/Intra 2; template 2uL, ddH2O supplemented to 25 uL; AM fungal reaction program 95 ℃ 30 sec; 95 ℃ 15sec, 58 ℃ 90sec, 72 ℃ 60sec, 40 cycles; 10min at 72 ℃;
foc4 Total volume 25 uL: contains 2 × SYBR Premix DimerEraser 12.5uL, FocSc-1/FocSc-2 primers concentration 10uM each 0.75 uL; template 2uL, ddH2O supplemented to 25 uL; foc4 qPCR reaction program 95 ℃ 30 sec; 95 ℃ 5sec, 55 ℃ 30sec, 72 ℃ 30sec, 40 cycles, 72 ℃ 10 min.
4. A qPCR method for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas comprises the following steps:
1) synthesizing the primer composition of claim 1, and extracting DNA of a sample to be tested;
2) and (3) carrying out AM Q-PCR on the extracted sample DNA, wherein the total volume of an AM system is 25 uL: contains 12.5uL of XSYBR PremixdImierEraser, and 0.75uL of each primer with the concentration of 10uM of Intra1/Intra 2; template 2uL, ddH2O supplemented to 25 uL; AMF fungal reaction program 95 ℃ 30 sec; 95 ℃ 15sec, 58 ℃ 90sec, 72 ℃ 60sec, 40 cycles; 10min at 72 ℃;
the extracted sample DNA was subjected to Foc 4Q-PCR, wherein the total volume of Foc4 system was 25 uL: contains 2 × SYBR PremixdImierEraser 12.5uL, FocSc-1/FocSc-2 primer concentration (10uM) each 0.75 uL; template 2uL, ddH2O supplemented to 25 uL; foc4 qPCR reaction program 95 ℃ 30 sec; 5sec at 95 ℃, 30sec at 55 ℃, 30sec at 72 ℃, 40 cycles, 10min at 72 ℃;
3) determining the amount of DNA of the arbuscular mycorrhizal fungi and Foc4 in the banana according to the result of step 2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911100398.5A CN110804673A (en) | 2019-11-12 | 2019-11-12 | Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911100398.5A CN110804673A (en) | 2019-11-12 | 2019-11-12 | Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110804673A true CN110804673A (en) | 2020-02-18 |
Family
ID=69502209
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911100398.5A Pending CN110804673A (en) | 2019-11-12 | 2019-11-12 | Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110804673A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111642338A (en) * | 2020-05-26 | 2020-09-11 | 广东省农业科学院果树研究所 | Method for promoting growth of banana seedlings by inoculating arbuscular mycorrhizal fungi |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101205558A (en) * | 2006-12-22 | 2008-06-25 | 福建省农业科学院植物保护研究所 | Banana wilt bacterium molecule detecting genes and detecting method thereof |
| CN103757093A (en) * | 2013-11-04 | 2014-04-30 | 中国热带农业科学院环境与植物保护研究所 | Quantitative detection method for FOC race 4 from soil |
| CN106011256A (en) * | 2016-06-27 | 2016-10-12 | 江苏省农业科学院 | Method for detecting number of arbuscular mycorrhizal fungi in wheat rhizosphere soil based on real-time fluorescence quantification PCR |
| WO2019053720A1 (en) * | 2017-09-14 | 2019-03-21 | Rahan Meristem (1998) Ltd | A method for producing banana plants with tolerance to fusarium oxysporum cubensis tr4 |
-
2019
- 2019-11-12 CN CN201911100398.5A patent/CN110804673A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101205558A (en) * | 2006-12-22 | 2008-06-25 | 福建省农业科学院植物保护研究所 | Banana wilt bacterium molecule detecting genes and detecting method thereof |
| CN103757093A (en) * | 2013-11-04 | 2014-04-30 | 中国热带农业科学院环境与植物保护研究所 | Quantitative detection method for FOC race 4 from soil |
| CN106011256A (en) * | 2016-06-27 | 2016-10-12 | 江苏省农业科学院 | Method for detecting number of arbuscular mycorrhizal fungi in wheat rhizosphere soil based on real-time fluorescence quantification PCR |
| WO2019053720A1 (en) * | 2017-09-14 | 2019-03-21 | Rahan Meristem (1998) Ltd | A method for producing banana plants with tolerance to fusarium oxysporum cubensis tr4 |
Non-Patent Citations (3)
| Title |
|---|
| JAN JANSA ET AL.: "Are there benefits of simultaneous root colonization by different arbuscular mycorrhizal fungi", 《NEW PHYTOLOGIST》 * |
| YIN-HONG LIN ET AL: "A molecular diagnosis method using real-time PCR for quantification and detection of Fusarium oxysporum f.sp.cubense race 4", 《EUROPEAN JOURNAL OF PLANT PATHOLOGY》 * |
| YUMIKO SAKAI ET AL.: "Specific Detection of Banana Residue in Processed Foods Using Polymerase Chain Reaction", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111642338A (en) * | 2020-05-26 | 2020-09-11 | 广东省农业科学院果树研究所 | Method for promoting growth of banana seedlings by inoculating arbuscular mycorrhizal fungi |
| CN111642338B (en) * | 2020-05-26 | 2022-02-18 | 广东省农业科学院果树研究所 | Method for promoting growth of banana seedlings by inoculating arbuscular mycorrhizal fungi |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sun et al. | First report of southern blight of mung bean caused by Sclerotium rolfsii in China | |
| ji Cho et al. | Development of a multiplex PCR method to detect fungal pathogens for quarantine on exported cacti | |
| CN110804673A (en) | Primer composition for simultaneously detecting arbuscular mycorrhizal fungi and banana vascular wilt in bananas and qPCR method | |
| Gianinazzi et al. | Arbuscular mycorrhizal fungi in plant production of temperate agroecosystems | |
| CN109825604B (en) | Molecular marker closely linked with peach aphid resistance character, primer, kit and method for detecting peach aphid resistance character and application of primer, kit and method | |
| CN109234447B (en) | Method for identifying soybean cyst nematode-resistant No. 4 microspecies soybean resource and special SSR primer | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN108004346B (en) | Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance | |
| CN108103042B (en) | Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof | |
| Jamali et al. | Nested-PCR for detecting Terfezia claveryi in roots of Helianthemum species in field and greenhouse conditions. | |
| CN106755541B (en) | Molecular marker, primer and probe for identifying lyophyllum decastes | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| KR20150121794A (en) | Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same | |
| CN106868145B (en) | Molecular marker, primer and probe for identifying tricholoma plumbum | |
| KR101961763B1 (en) | Composition for detecting of the green mold in mushroom and detecting method using the same | |
| JP2022029767A (en) | Method for freely controlling heavy metal transport, and plant with controlled absorption of cadmium and manganese | |
| CN113789401B (en) | Primer for detecting phytophthora nicotianae by loop-mediated isothermal amplification method and detection method thereof | |
| CN111500747A (en) | Primer and probe combination for detecting citrus semi-piercing nematodes and application thereof | |
| CN110862930A (en) | White agrocybe cylindracea and molecular marker identification method thereof | |
| CN112226371B (en) | High-yield and high-quality cordyceps guangdongensis cultivation strain and identification primer and identification method thereof | |
| CN110343155A (en) | Cranberry acetylation anthocyanin specific transporters VcMATE2 | |
| CN101328496B (en) | Detection method of three Tilletia foetida similar species on Perennial ryegrass | |
| KR101609309B1 (en) | Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof | |
| CN106702011B (en) | Molecular marker, primer and probe for identifying lepista longissima | |
| CN109439590B (en) | Cassia rhizobium WYS3R1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200218 |
|
| RJ01 | Rejection of invention patent application after publication |