KR101609309B1 - Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof - Google Patents

Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof Download PDF

Info

Publication number
KR101609309B1
KR101609309B1 KR1020140051314A KR20140051314A KR101609309B1 KR 101609309 B1 KR101609309 B1 KR 101609309B1 KR 1020140051314 A KR1020140051314 A KR 1020140051314A KR 20140051314 A KR20140051314 A KR 20140051314A KR 101609309 B1 KR101609309 B1 KR 101609309B1
Authority
KR
South Korea
Prior art keywords
cabbage
high temperature
primer
primer set
varieties
Prior art date
Application number
KR1020140051314A
Other languages
Korean (ko)
Other versions
KR20150124615A (en
Inventor
조혜선
박현지
정원용
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020140051314A priority Critical patent/KR101609309B1/en
Publication of KR20150124615A publication Critical patent/KR20150124615A/en
Application granted granted Critical
Publication of KR101609309B1 publication Critical patent/KR101609309B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 서열번호 7 및 9의 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트, 상기 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 키트 및 상기 프라이머 세트를 이용한 내서성 양배추 품종을 선별하는 방법을 제공한다.The present invention relates to an oligonucleotide primer set for selecting an endosperm cabbage cultivar comprising the primer set of SEQ ID NOS: 7 and 9, a kit for selecting an endosperm cabbage variety including the primer set, Provides a method of screening cabbage varieties.

Description

내서성 양배추 품종의 선별을 위한 특이 프라이머 및 이의 용도{Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof}Specific primers and their uses for screening of endosperm cabbage varieties. Specific primers for selecting heat-tolerant Brassica oleracea cultivar and uses thereof.

본 발명은 내서성 양배추 품종의 선별을 위한 특이 프라이머 및 이의 용도에 관한 것으로, 더욱 상세하게는 서열번호 7 및 9로 표시된 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트, 상기 프라이머 세트를 포함하는 내서성 양배추 품종 선별용 키트 및 상기 프라이머 세트를 이용한 내서성 양배추 품종을 선별하는 방법에 관한 것이다.More particularly, the present invention relates to an oligonucleotide primer set for screening an endosperm cabbage cultivar containing a primer set represented by SEQ ID NOS: 7 and 9, A primer set, and a method for selecting an endosperm cabbage cultivar using the primer set.

천연 및 농업 조건 하에서, 식물은 끊임없이 스트레스를 견뎌내야 한다. 어떤 환경 인자(예를 들면 고온 또는 저온)는 매우 단시간 내에 많은 스트레스를 줄 수 있고, 또 다른 스트레스(예를 들면, 토양수 함유량 또는 미네랄 영양분)는 식물에 스트레스를 주는데 장시간이 소요될 수 있다. 일반적으로, 식물에 영향을 주는 환경 스트레스는 기후 관련 스트레스, 공기오염 스트레스, 화학적 스트레스 및 영양적 스트레스의 형태가 있을 수 있다.Under natural and agricultural conditions, plants must constantly endure stress. Some environmental factors (eg, high or low temperatures) can be very stressful in a very short time, and other stresses (eg, soil water content or mineral nutrients) can take a long time to stress plants. In general, environmental stresses affecting plants can be in the form of climate-related stress, air pollution stress, chemical stress, and nutritional stress.

기후 관련 스트레스의 예로는 가뭄, 홍수, 서리, 저온, 고온, 과도한 빛 및 불충분한 빛을 들 수 있다. 공기오염 스트레스는 이산화탄소, 일산화탄소, 이산화황, NOx, 탄화수소, 오존, 자외선 및 산성비의 형태일 수 있다. 화학적 스트레스는 살충제, 살균제, 제초제 및 중금속의 살포로부터 초래될 수 있다. 영양적 스트레스는 비료, 미량 영양소(micronutrient) 및 다량 영양소(macromutrient)에 의하여 초래될 수 있다.Examples of climate-related stresses include droughts, floods, frosts, low temperatures, high temperatures, excessive light, and insufficient light. Air pollution stress can be in the form of carbon dioxide, carbon monoxide, sulfur dioxide, NOx, hydrocarbons, ozone, ultraviolet and acid rain. Chemical stresses can result from the application of insecticides, fungicides, herbicides and heavy metals. Nutritional stress can be caused by fertilizers, micronutrients and macromutrients.

정상적으로 성장하기에는 너무 낮고 얼 정도까지는 낮지 않은 온도에서 감수성 종들은 냉해(冷害)를 입는다. 이러한 손상은 통상적으로 열대지방 또는 아열대지방 기원의 종들에게서 발생한다. 냉각되는 경우, 잎에서 탈색 현상 또는 병반 현상이 나타나게 되고, 이는 이들 잎에 수침지(water-soaked) 외관을 부여한다. 뿌리가 냉각되면, 식물이 시들 수 있다. 반면, 동결 온도 및 이에 수반되는 식물체 내에서의 얼음 결정의 형성은 얼음 결정이 원형질체로 확장되거나 장시간 동안 유지되는 경우 치명적일 수 있다.Susceptible species are cold-weathered at temperatures that are too low to grow normally and not low enough to grow normally. Such damage usually occurs in species of tropical or subtropical origin. When cooled, the leaves show discoloration or lesions, which give the leaves a water-soaked appearance. Once the roots have cooled down, the plants can die. On the other hand, the freezing temperature and concomitant formation of ice crystals in the plant may be fatal if the ice crystals are extended to protoplasts or maintained for a long time.

스트레스는 또한 그 이외의 과도한 온도에 의해서도 초래될 수 있으며, 거의 모든 식물은 고온에서 생존할 수 없다. 고등 식물의 세포 또는 조직이 탈수되거나 성장하지 않은 경우, 이들 세포는 수화 세포, 영양 세포 및 성장 중의 세포들보다는 고온에서 잘 생존할 수 있다. 활발하게 성장하고 있는 조직은 45℃를 넘는 온도에서는 거의 생존이 불가능하다.Stress can also be caused by other excessive temperatures, and almost all plants can not survive at high temperatures. If the cells or tissues of the higher plant are not dehydrated or grown, these cells can survive at higher temperatures than the cells in hydration, nutrition and growth. Actively growing tissues can hardly survive at temperatures above 45 ° C.

한편, 양배추는 십자화과에 속하는 식물로 잎부분을 채취하여 식용으로 사용하고 있으며, 열량이 적고 비타민 C와 칼륨, 칼슘 등의 무기질 및 식이섬유가 풍부한 식재료로, 특히 서양에서는 요구르트, 올리브와 함께 3대 장수식품이라 일컬어지고 있다. 양배추에는 다량의 유황과 염소 및 비타민 U, 비타민 K가 포함되어 위장의 점막을 강화시키고 궤양을 완화할 뿐 아니라 위암을 예방하는 효과가 있는 것으로 알려져 있다. 따라서, 위의 건강을 위하여 꾸준히 섭취하는 것이 권장되고 있다.On the other hand, cabbage is a plant belonging to the cruciferous family. It is used for food by picking leaf parts. It is a food material with low calorie content and rich in minerals and dietary fiber such as vitamin C, potassium and calcium. Especially in the western part, It is called longevity food. Cabbage contains a large amount of sulfur, chlorine, vitamins U and vitamin K to strengthen the mucous membranes of the stomach, as well as alleviating ulcers and is known to have the effect of preventing stomach cancer. Therefore, it is recommended to continue to eat for the above health.

이러한 이유로 양배추는 전세계적으로 가장 많이 재배되고 있는 채소 작물 중 하나이지만 근래에는 세계적인 기상이상(한파, 일조시간 부족, 저온, 고온 및 잦은 강우) 및 환경의 변화로 인해 양배추 재배의 피해가 심각해졌다. 이러한 수확 감소 요인은 앞으로 더욱 발생할 확률이 높기 때문에 이에 대한 대책으로 스트레스(고온) 저항성 품종의 안정적인 확보가 시급해졌다.For this reason, cabbage is one of the most cultivated vegetable crops in the world, but recently the damage of cabbage cultivation has become serious due to global weather conditions (shortage of sunshine, lack of sunshine time, low temperature, high temperature and frequent rainfall) Since these factors are more likely to occur in the future, it is imperative to secure a stable (high temperature) resistant variety as a countermeasure.

한국공개특허 제2014-0043591호에서는 감자 유래 고온 스트레스 저항성 유전자 및 이를 이용하여 제조한 고온 스트레스 저항성 형질전환체가 개시되어 있고, 한국공개특허 제2014-0028277호에서는 고온 스트레스 내성을 증가시키는 고구마 IbOrange 유전자 및 이의 용도가 개시되어 있으나, 본 발명과 같이 내서성 양배추 품종의 선별을 위한 특이 프라이머 및 이의 용도에 관해 기재된 바는 전혀 없다.Korean Patent Laid-Open Publication No. 2014-0043591 discloses a potato-derived high-temperature stress-resistance gene and a high-temperature stress-resistant transformant prepared therefrom. Korean Patent Laid-Open Publication No. 2014-0028277 discloses a sweet potato IbOrange gene Although the use thereof has been disclosed, the specific primers for selecting the endosperm cabbage cultivars and the use thereof have never been described in the present invention.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자는 양배추 식물체에 고온 스트레스를 처리한 후 표현형 관찰을 통해 내서성 품종과 고온 민감성 품종을 구분하였으며, 고온(42℃) 스트레스 처리 후 내서성 양배추와 고온 민감성 양배추의 여러 가지 유전자 발현을 분석한 결과 내서성 양배추 품종에서 특이적으로 발현이 증가한 유전자 마커 BoHSP70를 발굴하였다. 상기 유전자 마커는 양배추의 heat shock protein 70 (BoHsp70) 유전자로 고온 스트레스 처리시 내서성 품종에서 고온 민감성 품종에 비해 유전자 발현이 4배 정도 증가함을 확인하였다. 또한 게놈 DNA 상에서 해당 유전자 마커의 프로모터 부분의 염기서열 분석을 수행한 결과, 내서성 품종과 고온 민감성 품종의 염기서열 차이를 확인하였다. 내서성/고온 민감성 품종에서 차이를 나타내는 염기서열을 바탕으로 내서성 양배추 품종 구별용 프라이머를 제작하였으며, 6개 양배추 품종을 대상으로 프라이머의 활용성을 입증함으로써, 본 발명을 완성하였다.The present inventors have found that the cabbage plants were treated with high temperature stress and then phenotypic observations were made to distinguish between internal and external temperature sensitive cultivars. After the high temperature (42 캜) stress treatment, Analysis of various gene expressions of cabbage and high temperature susceptible cabbage revealed that BoHSP70, a gene marker that specifically increased expression in endosperm cabbage cultivars. The gene markers were heat shock protein 70 (BoHsp70) gene of cabbage, and it was confirmed that gene expression was increased about 4 times as compared with that of high temperature susceptible varieties at high temperature stress treatment. Sequence analysis of the promoter region of the corresponding gene marker on the genomic DNA revealed the difference in the nucleotide sequence between the resistant strain and the susceptible strain. Based on the nucleotide sequence that shows difference between the inner and outer temperature sensitive varieties, primers for distinguishing the inner seedling cabbage were prepared and the present invention was completed by proving the applicability of the primers to six cabbage cultivars.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트를 제공한다.In order to accomplish the object of the present invention, the present invention provides a set of oligonucleotide primers for screening an endosperm cabbage variety comprising oligonucleotide primer sets of SEQ ID NOS: 7 and 9.

또한, 본 발명은 상기 프라이머 세트를 포함하는 내서성 양배추 품종 선별용 키트를 제공한다.In addition, the present invention provides a kit for screening an endosperm cabbage variety comprising the above primer set.

또한, 본 발명은 상기 프라이머 세트를 이용한 내서성 양배추 품종을 선별하는 방법을 제공한다.In addition, the present invention provides a method for selecting an endosperm cabbage cultivar using the primer set.

본 발명에 따라 양배추 내서성/고온 민감성 품종의 실험실 내 조건에서 고온 스트레스 처리에 의한 표현형 분석 방법을 확립하였다. 또한, 6개 양배추 품종에 대해 내서성/고온 민감성 품종의 고온 스트레스 관련 유전자 발현을 비교 분석을 통해 마커 유전자로서 BoHsp70을 선정하였으며 해당 유전자의 프로모터 염기서열 분석을 통해 게놈 DNA 상에서 내서성/고온 민감성 품종을 구별할 수 있는 프라이머를 제작하였다. 따라서 본 발명을 통해서 간단한 게놈 DNA PCR법을 통해서 양배추의 내서성 관련 형질을 양배추 육종 현장에서 어린 시기에 구별할 수 있는 효과를 기대할 수 있다.According to the present invention, a phenotypic analysis method by high temperature stress treatment was established in the laboratory conditions of the cabbage western / high temperature sensitive varieties. In addition, BoHsp70 was selected as a marker gene by comparing and analyzing the high temperature stress related gene expression of the internal / high temperature sensitive cultivars of six cabbage cultivars. Through the nucleotide sequence analysis of the promoter of the corresponding gene, internal / Primers were prepared. Therefore, through the present invention, a simple genomic DNA PCR method can be expected to distinguish the endogenous trait of cabbage from the young stage in cabbage breeding site.

도 1은 양배추 내서성 품종 및 고온 민감성 품종의 고온 스트레스 후 표현형을 관찰한 도면이다. 어린 유식물 상태에서 총 6개 양배추 품종의 고온 스트레스 처리(42℃, 5시간) 후 표현형 사진. NS; Non stress, 스트레스를 처리하지 않은 정상 조건(24℃)에서 자란 식물체, HS; Heat stress, 고온 스트레스 처리 후 식물체.
도 2는 내서성 품종과 고온 민감성 품종에서 BoHsp70 유전자 발현을 나타내는 결과이다. 정상 조건에서 2주 간 자란 후, 고온 스트레스를 처리(42℃, 5시간)한 식물체와 고온 스트레스를 처리하지 않은 식물체로부터 RNA를 추출하여 qPCR로 BoHsp70 유전자의 발현을 나타낸 그래프이다. 유전자 발현 값은 BoActin1 유전자 발현 값으로 정량화하였다.
도 3은 총 6개 양배추 품종의 BoHsp70 유전자 프로모터 부위의 염기서열을 분석(sequence alignment)한 결과이다. A) 양배추 게놈 DNA 상에서 BoHsp70 유전자 프로모터 부위의 간단한 도식. UP_1kb; BoHsp70 유전자 cds (coding sequence) 시작 부위의 상위 1kb. B) BoHsp70 유전자 프로모터 부위 염기서열 정렬 결과 및 내서성 품종과 고온 민감성 품종에서 차이를 보이는 염기서열의 위치를 보여주는 그림이다. Forward3; 내서성 품종 특이적 정방향 프라이머3, Forwad4; 고온 민감성 품종 특이적 정방향 프라이머4, Reverse1; 내서성/고온 민감성 특이적 역방향 프라이머.
도 4는 내서성 품종 HO와 고온 민감성 품종 EB의 BoHsp70 유전자 프로모터 부의 염기 서열을 나타낸다.
도 5는 양배추 내서성/고온 민감성 특이적 프라이머를 이용한 PCR 결과이다. 내서성 품종 HO, RK 및 401과 고온 민감성 품종 EB, JK 및 NB에서 게놈 DNA를 추출하여 내서성 품종 특이적 정방향 프라이머(Bo01g139130(pro)-F3_서열번호 7)와 역방향 프라이머(Bo01g139130(pro)-R_서열번호 9)로 PCR 수행한 결과(상단 겔 사진) 및 고온 민감성 품종 특이적 정방향 프라이머(Bo01g139130(pro)-F4_서열번호 8)와 역방향 프라이머(Bo01g139130(pro)-R_서열번호 9)로 PCR 수행한 결과(하단 겔 사진)이다.
FIG. 1 is a diagram showing the phenotype after high-temperature stress of cabbage western varieties and high temperature susceptible varieties. Phenotypic photographs of 6 cabbage cultivars after high temperature stress treatment (42 ℃, 5 hours) in infant plants. NS; Non stress, plants grown under normal conditions without stress (24 ℃), HS; Heat stress, plants after high temperature stress treatment.
Fig. 2 shows the expression of BoHsp70 gene in endemic and high temperature susceptible varieties. This is a graph showing the expression of BoHsp70 gene in qPCR by extracting RNA from plants treated with high temperature stress (42 ° C., 5 hours) and plants not subjected to high temperature stress after two weeks of growing under normal conditions. Gene expression values were quantified as BoActin1 gene expression values.
FIG. 3 shows the result of sequence alignment of the BoHsp70 gene promoter region of a total of six cabbage cultivars. A) A simple schematic of the BoHsp70 gene promoter region on the cabbage genomic DNA. UP_1kb; BoHsp70 gene 1 kb upstream of coding sequence start site. B) Sequence alignment of BoHsp70 gene promoter region and location of nucleotide sequences showing differences in endogenous and high temperature susceptible varieties. Forward3; Myxogenic variety specific forward primer 3, Forwad4; High temperature sensitive varieties specific forward primer 4, Reverse1; Inner / High Temperature Sensitivity Specific reverse primer.
Fig. 4 shows the nucleotide sequence of the BoHsp70 gene promoter portion of the insect-resistant variety HO and the high-temperature sensitive cultivar EB.
FIG. 5 shows the results of PCR using the cabbage western / high temperature sensitivity specific primer. (Bo01g139130 (pro) -F3_ SEQ ID NO: 7) and the reverse primer (Bo01g139130 (pro)) were extracted from the genomic DNAs from the domestic calligraphy varieties HO, RK and 401 and high temperature sensitive cultivars EB, JK and NB, (Bo01g139130 (pro) -F4_ SEQ ID NO: 8) and the reverse primer (Bo01g139130 (pro) -R_ SEQ ID NO: 9) 9) (bottom gel photograph).

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 7의 서열 내의 15개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드들로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 및 서열번호 9의 서열 내의 15개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드들로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드를 포함하는 올리고뉴클레오티드 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트를 제공한다.In order to accomplish the object of the present invention, the present invention provides an oligonucleotide comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of at least 15 consecutive nucleotides in the sequence of SEQ ID NO: 7 and at least 15 oligonucleotides in the sequence of SEQ ID NO: An oligonucleotide primer set comprising an oligonucleotide primer set comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of consecutive nucleotides.

상기 올리고뉴클레오티드는 바람직하게는 서열번호 7의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상, 25개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다. 또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 9의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.The oligonucleotide is preferably at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 Lt; RTI ID = 0.0 > oligonucleotides < / RTI > consisting of fragments of more than two consecutive nucleotides. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive nucleotides in the sequence of SEQ ID NO: 9.

본 발명의 일 구현예에 따른 올리고뉴클레오티드 프라이머 세트는 더욱 바람직하게는 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트이다.The set of oligonucleotide primers according to one embodiment of the present invention is more preferably a set of oligonucleotide primers of SEQ ID NOS: 7 and 9.

본 발명의 일 구현예에 따른 올리고뉴클레오티드 프라이머 세트는 서열번호 8의 올리고뉴클레오티드 프라이머 세트를 추가로 포함할 수 있으나, 이에 제한되지 않는다. An oligonucleotide primer set according to an embodiment of the present invention may further include, but is not limited to, an oligonucleotide primer set of SEQ ID NO: 8.

상기 올리고뉴클레오티드는 바람직하게는 서열번호 8의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.The oligonucleotides preferably comprise fragments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 consecutive nucleotides in the sequence of SEQ ID NO: 8 Lt; / RTI > oligonucleotides.

본 발명은 내서성 양배추 품종을 선별하기 위해, 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있고, 특히, 서열번호 8의 올리고뉴클레오티드 프리아머를 추가로 이용할 경우, 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트는 내서성 양배추 품종을 특이적으로 선별할 수 있고, 서열번호 8 및 9의 올리고뉴클레오티드 프라이머 세트는 고온 민감성 양배추 품종을 특이적으로 선별할 수 있어 이들 3개 프라이머를 동시에 이용할 경우 내서성 양배추 품종을 비교적 쉽고 정확하게 선별할 수 있다.The present invention can use oligonucleotide primer sets of SEQ ID NOs: 7 and 9 to select the endosperm cabbage variety, and particularly, when oligonucleotide primers of SEQ ID NO: 8 are additionally used, The oligonucleotide primer sets of SEQ ID NOs: 8 and 9 can specifically select high temperature sensitive cabbage cultivars. When these three primers are used simultaneously, Cabbage varieties can be selected relatively easily and accurately.

본 발명에 있어서, "프라이머"는 증폭하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity) 뿐만 아니라 온도 및 이온 농도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ion concentration, as well as the complexity of the desired DNA or RNA target.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)을 포함할 수 있거나 또는 삽입 물질(intercalating agent)을 포함할 수 있다.As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은In order to achieve still another object of the present invention,

본 발명에 따른 올리고뉴클레오티드 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 내서성 양배추 품종을 선별하기 위한 키트를 제공한다. 본 발명의 키트에서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 중합효소, dNTPs, 완충용액 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.An oligonucleotide primer set according to the present invention; And a reagent for carrying out an amplification reaction. The present invention also provides a kit for selecting an endemic cabbage variety. In the kit of the present invention, the reagent for carrying out the amplification reaction may include a DNA polymerase, dNTPs, a buffer solution and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은In order to achieve still another object of the present invention,

양배추 시료에서 게놈 DNA를 분리하는 단계;Isolating the genomic DNA from the cabbage sample;

상기 분리된 게놈 DNA를 주형으로 하고, 상기 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및Amplifying the target sequence by using the separated genomic DNA as a template and carrying out an amplification reaction using the oligonucleotide primer set; And

상기 증폭 산물을 검출하는 단계를 포함하는, 내서성 양배추 품종을 선별하기 위한 방법을 제공한다.And detecting the amplification product. The present invention also provides a method for selecting an endemic cabbage variety.

본 발명의 방법은 양배추 시료에서 게놈 DNA를 분리하는 단계를 포함한다. 상기 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 올리고뉴클레오티드 프라이머 세트를 프라이머로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, 중합효소연쇄반응이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 중합효소연쇄반응 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.The method of the present invention comprises isolating genomic DNA from a cabbage sample. A method known in the art can be used as a method for separating the genomic DNA from the sample. Using the separated genomic DNA as a template, an oligonucleotide primer set according to an embodiment of the present invention may be used as a primer to perform an amplification reaction to amplify the target sequence. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, the polymerase chain reaction is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such polymerase chain reaction methods are well known in the art, and commercially available kits may be used.

본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 일 구현 예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 중합효소연쇄반응을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 중합효소연쇄반응 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 중합효소연쇄반응 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 올리고뉴클레오티드 프라이머 세트는 상기에 기재된 바와 같다.In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, Cy-5 or Cy-3 is labeled at the 5'-end of the primer and the polymerase chain reaction is performed, whereby the target sequence can be labeled with a detectable fluorescent labeling substance. When a radioactive isotope such as 32 P or 35 S is added to the polymerase chain reaction, the amplification product is synthesized, and the radioactive substance is incorporated into the amplification product. When the amplification product is radioactive ≪ / RTI > The set of oligonucleotide primers used to amplify the target sequence are as described above.

본 발명의 방법은 상기 증폭 산물을 검출하는 단계를 포함한다. 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 중합효소연쇄반응을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 중합효소연쇄반응 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 중합효소연쇄반응 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when Cy-5 or Cy-3 is labeled at the 5'-end of the primer and the polymerase chain reaction is performed, the target is labeled with a fluorescent label capable of detecting the target sequence. Can be measured. In addition, in the radioactive determination method, a radioactive isotope such as 32 P or 35 S is added to the polymerase chain reaction to label the amplified product, and then a radioactive measurement instrument such as a Geiger counter Geiger counter or liquid scintillation counter can be used to measure the radioactivity.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

실시예Example 1. 양배추 내서성/고온 민감성 품종의 고온 스트레스 표현형 확인 1. Identification of high-temperature stress phenotype in susceptible / high temperature susceptible varieties in cabbage

양배추 내서성 품종 HO, RK 및 401과 고온 민감성 품종 EB, JK 및 NB는 모두 아시아 종묘로부터 실험용 종자로 분양받아 사용하였다(표 1). 아시아 종묘로부터 분류된 내서성 표현형을 실험실 조건에서 확인하기 위하여 1주된 유식물체와 2주된 식물체를 대상으로 고온 스트레스를 처리하여 표현형을 관찰하였다. 70% 에탄올과 10% RAX를 사용하여 양배추 종자를 소독한 후, 1/2MS 아가(1/2MS, 1% 수크로스, 0.5% 피토 아가) 배지에서 파종하여 배양실 조건 (23℃, 16h 명/8h 암)에서 1주일간 키웠다. 고온 스트레스는 42℃ 생장 챔버(growth chamber)에서 5시간 처리하였으며, 스트레스 처리 후 4일 뒤 표현형을 관찰하였다. 내서성 품종인 HO, RK 및 401 식물체는 고온 스트레스 처리 후, 식물체의 떡잎(cotyledon)이 스트레스를 처리하지 않은 정상조건에 비해 크기가 줄어들었지만 잎의 형태는 정상 조건과 유사하게 회복된 반면, 고온 민감성 품종인 EB, JK 및 NB 식물체는 고온 스트레스에 의해 떡잎이 마르고 백화현상이 나타나며 정상적으로 회복하지 못하는 표현형을 나타내었다(도 1). In the cabbage, Seosung variety HO, RK and 401 and high temperature sensitive variety EB, JK and NB were all sold as experimental seeds from Asian seeds (Table 1). In order to confirm the phenotype of endogenous seeds classified from Asian seedlings under laboratory conditions, one week old and 2 weeks old plants were treated with high temperature stress to observe the phenotype. Cabbage seeds were sterilized with 70% ethanol and 10% RAX and seeded in 1 / 2MS agar (1 / 2MS, 1% sucrose, 0.5% phytoagar) medium and cultured under culture conditions (23 ℃, 16h / 8h Cancer) for one week. The high temperature stress was treated in a 42 ° C growth chamber for 5 hours and the phenotype was observed 4 days after the stress treatment. The cotyledons of HO, RK and 401, which were resistant to stress, were reduced in size compared to the normal condition in which the cotyledon was not stress-treated, but the shape of the leaves recovered similar to the normal condition, The susceptible varieties EB, JK and NB plants exhibited a phenotype in which the cotyledon was dry and bleached due to high temperature stress and could not be recovered normally (Fig. 1).

품종 명칭Name of varieties 분류Classification HOHO 내서성My spouse RKRK 내서성My spouse 401401 내서성My spouse EBEB 고온 민감성High Temperature Sensitivity JKJK 고온 민감성High Temperature Sensitivity NBNB 고온 민감성High Temperature Sensitivity

실시예Example 2. 양배추 내서성/고온 민감성 품종의  2. Cabbage Seosung / High Temperature Sensitive Varieties 마커Marker 유전자 ( gene ( BoHsp70BoHsp70 ) 발굴) excavation

총 6개의 양배추 품종에 대하여 고온 스트레스 처리시 내서성 품종과 고온 민감성 품종에서 유전자 발현에 차이가 나는 마커 유전자를 선별하고자 고온 스트레스에 관련된 여러 유전자를 qRT-PCR로 분석하였다. 2주간 배양실 조건에서 키운 6 품종의 양배추를 정상조건(NS)과 고온 스트레스 처리 조건(HS, 42℃, 5시간)에서 식물체의 잎을 채취하여 총 RNA를 추출하였다. 추출한 총 RNA로부터 역전사효소(reverse transcriptase)를 이용하여 cDNA를 합성하고 이를 qRT-PCR의 주형으로 사용하였다. 고온 스트레스 관련 여러 유전자의 발현을 확인하였으며, 그 중 BoHsp70 유전자의 발현을 보기 위해 BoHsp70(Bo01g139130) 유전자 특이적 프라이머 정방향 (BoHsp70-F, 5'-GGG AAG GCT GTC GAA GGA AGA G-3'_서열번호 2)과 역방향 (BoHsp70-R, 5'-GCC ACC AGC TCC ACC CAT ATC-3'_서열번호 3)을 사용하였다(표 2). BoActin1 유전자의 프라이머 정방향 (5'-CGA GGG TTT CTC TCT TCC ACA C-3'_서열번호 4)과 역방향 (5'-CTG CTT GGT GCA AGT GCT GTG-3'_서열번호 5)을 사용하여 qRT-PCR의 정량화를 하였다. 고온 스트레스 조건에서 내서성 품종과 고온 민감성 품종의 BoHsp70 유전자 발현을 비교 분석해 본 결과, 고온 민감성 품종인 EB, JK 및 NB에서는 상대적인 발현값이 0.5-1.0 사이인 반면 내서성 품종인 HO, RK 및 401은 3.0-4.5 사이로 고온 민감성 품종에 비해 약 4 배 정도 발현 값이 증가한 것을 확인하였다(도 2). 내서성 양배추인 3개의 품종과 고온 민감성인 3개 품종에서 공통적으로 이러한 차이를 나타냄을 근거로 하여 양배추의 내서성 관련 마커 유전자로서 BoHsp70(Bo01g139130) 유전자(서열번호 1)를 선정하였다.For six cabbage varieties, several genes related to high-temperature stress were analyzed by qRT-PCR to identify marker genes that differ in gene expression in endosperm and high temperature susceptible varieties at high temperature stress. The total RNA was extracted from the leaves of the cabbage grown in two cultivars under the normal condition (NS) and the high temperature stress treatment condition (HS, 42 ℃, 5 hours). CDNA was synthesized from the extracted total RNA using reverse transcriptase and used as a template for qRT-PCR. In order to examine the expression of BoHsp70 gene, BoHsp70 (Bo01g139130) gene-specific primer forward (BoHsp70-F, 5'-GGG AAG GCT GTC GAA GGA AGA G-3'_ sequence 2) and reverse (BoHsp70-R, 5'-GCC ACC AGC TCC ACC CAT ATC-3'_ SEQ ID NO: 3) (Table 2). (5'-CTG CTT GGT GCA AGT GCT GTG-3'_ SEQ ID NO: 5) and the reverse direction (5'-CTG CTT GGT GGA AGT GCT GTG-3'_ SEQ ID NO: 5) of the BoActin1 gene in the primer forward direction -PCR was quantified. As a result of comparing the expression of BoHsp70 gene in endogenous and high temperature susceptible varieties under high temperature stress conditions, the relative expression values of EB, JK and NB, which are high temperature sensitive varieties, ranged between 0.5 and 1.0, while those of endogenous varieties HO, RK and 401 Was between 3.0 and 4.5, indicating that the expression level was increased about 4 times as compared with that of the high temperature sensitive cultivar (FIG. 2). BoHsp70 (Bo01g139130) gene (SEQ ID NO: 1) was selected as a marker gene for resistance to internalization of cabbage on the basis of the fact that these three varieties are common in three varieties of domestic lettuce cabbage and three varieties of high temperature sensitivity.

프라이머primer 명칭 designation 프라이머primer 서열(5’- 3’)(서열번호) The sequence (5'-3 ') (SEQ ID NO: BoHsp70-FBoHsp70-F GGGAAGGCTGTCGAAGGAAGAG(2) GGGAAGGCTGTCGAAGGAAGAG (2) BoHsp70-RBoHsp70-R GCCACCAGCTCCACCCATATC(3) GCCACCAGCTCCACCCATATC (3) Bo01g139130(pro)-F2Bo01g139130 (pro) -F2 AGGGTGCCTCACACATTCACTGATC(6) AGGGTGCCTCACACATTCACTGATC (6) Bo01g139130(pro)-F3Bo01g139130 (pro) -F3 CCTCAGTTATTTTACGTGGTTTTACG(7) CCTCAGTTATTTTACGTGGTTTTACG (7) Bo01g139130(pro)-F4Bo01g139130 (pro) -F4 TCGTTACTATGTACGGTAAAAATC(8) TCGTTACTATGTACGGTAAAAATC (8) Bo01g139130(pro)-RBo01g139130 (pro) -R TCGCTAACCGCGTCTAAACCG(9) TCGCTAACCGCGTCTAAACCG (9)

실시예Example 3. 내서성/고온 민감성 품종의  3. Inner Seosung / High Temperature Sensitive Varieties 마커Marker 유전자 프로모터 염기서열 분석 Sequence analysis of gene promoter

고온 스트레스 조건에서 내서성/고온 민감성 품종에 따라 BoHsp70 유전자의 발현 정도가 차이 나는 원인을 조사하기 위하여 BoHsp70 유전자의 프로모터 부위의 염기서열을 분석하였다. 내서성 품종인 HO, RK 및 401과 고온 민감성 품종인 EB, JK 및 NB를 대상으로 식물체를 2주 키운 뒤 식물체의 본 잎에서 게놈 DNA를 추출하였다. 게놈 DNA는 식물체 잎을 액체 질소를 이용하여 파쇄한 뒤, 식물체 게놈 DNA 추출 버퍼(50mM Tris-Cl pH8.0, 100mM NaCl, 50mM EDTA, 0.5% SDS)와 페놀 추출 방법을 통해 추출하였다. 양배추 총 게놈 시퀀싱 결과를 바탕으로 BoHsp70 유전자 프로모터 염기서열 (상위 600-100bp)을 확인할 수 있는 정방향 프라이머 (Bo01g139130(pro)-F2, 5'-AGG GTG CCT CAC ACA TTC ACT GAT C-3'_서열번호 6)와 역방향 프라이머 (Bo01g139130(pro)-R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_서열번호 9)를 사용해 PCR 후, PCR 생성물의 염기서열을 분석하였다(도 4). 6개 품종에 대한 염기서열 분석 결과를 클러스터 W2 프로그램을 사용하여 정렬(mutiple sequence alignment)한 결과, 내서성 품종인 HO, RK 및 401의 서열은 모두 일치하였으며 민감성 품종인 EB, JK 및 NB는 내서성 품종의 서열과 부분적으로 다른 염기서열을 공통적으로 가지고 있는 것을 확인하였다(도 3). 위의 결과를 통해 내서성/고온 민감성 품종에서 나타나는 프로모터 염기서열 차이가 BoHsp70 유전자 발현에 영향을 주었을 것이라 추측해 볼 수 있었다. 또한 게놈 DNA 상에서 내서성/고온 민감성 품종을 선별할 수 있도록 하기 위해 내서성 품종과 고온 민감성 품종의 프로모터 염기서열 분석에서 상대적으로 많은 염기서열이 차이를 보이는 위치를 선정하여 마커 유전자에 대한 프라이머를 제작하였다.
The sequence of the promoter region of the BoHsp70 gene was analyzed to investigate the cause of the difference in the expression level of the BoHsp70 gene according to the tolerance / temperature susceptibility varieties under the high temperature stress condition. Genomic DNA was extracted from the leaf of the plant after two to three weeks of planting for HO, RK and 401, and high temperature susceptible varieties EB, JK and NB. Genomic DNA was extracted from plant leaves using liquid nitrogen and extracted with a genomic DNA extraction buffer (50 mM Tris-Cl pH 8.0, 100 mM NaCl, 50 mM EDTA, 0.5% SDS) and phenol extraction method. (Bo01g139130 (pro) -F2, 5'-AGG GTG CCT CAC ACA TTC ACT GAT C-3'_ sequence which can confirm BoHsp70 gene promoter base sequence (upper 600-100 bp) based on the results of cabbage total genome sequencing No. 6) and reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9). Sequences of HO, RK, and 401, which are endemic varieties, were all consistent as a result of sequence sequencing of six varieties using the cluster W2 program. As a result, EB, JK and NB, (Fig. 3). In addition, it was confirmed that the nucleotide sequence was partially different from that of the Seosung variety (Fig. 3). These results suggest that the difference in the promoter sequence in the seed / high temperature susceptible varieties might have affected the expression of BoHsp70 gene. Also, in order to select the endogenous / high temperature susceptible varieties on genomic DNA, the positions where the nucleotide sequences are relatively different from each other in the promoter sequence analysis of endemic varieties and high temperature susceptible varieties were selected to prepare primers for marker genes Respectively.

실시예Example 4.  4. 마커Marker 유전자의  Gene 프라이머를Primer 이용한 내서성/고온 민감성 품종 구별 Differentiate between internal / high temperature susceptible varieties

마커 유전자(BoHsp70)의 프로모터 염기서열을 바탕으로 제작한 프라이머의 활용성을 검증하기 위하여 총 6개 품종을 대상으로 PCR을 수행하였다. 내서성 품종인 HO, RK 및 401과 고온 민감성 품종인 EB, JK 및 NB로부터 게놈 DNA를 추출하여 내서성 품종 특이적 정방향 프라이머 (Bo01g139130(pro)-F3, 5'-CCT CAG TTA TTT TAC GTG GTT TTA CG-3'_서열번호 7)와 역방향 프라이머 (Bo01g139130(pro)-R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_서열번호 9)로 PCR 수행한 결과, 내서성 품종인 HO, RK 및 401 품종에서만 PCR 밴드가 확인되었으며 고온 민감성 품종에서는 PCR 밴드가 확인되지 않았다. 또한 고온 민감성 품종 특이적 정방향 프라이머 (Bo01g139130(pro)-F4, 5'-TCG TTA CTA TGT ACG GTA AAA ATC-3'_서열번호 8)와 역방향 프라이머 (Bo01g139130(pro)-R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_서열번호 9)로 PCR 수행한 결과, 고온 민감성 품종인 EB, JK 및 NB에서 PCR 밴드가 확인되는 반면, 내서성 품종에서는 PCR 밴드가 확인되지 않았다(도 5). 이를 통해서 마커 유전자(BoHsp70)의 프로모터 염기서열을 바탕으로 제작한 프라이머를 양배추 내서성/고온 민감성 품종 구별에 사용할 수 있음을 확인하였다. In order to verify the applicability of the primers based on the promoter sequence of the marker gene (BoHsp70), PCR was performed on a total of six cultivars. Genomic DNAs were extracted from horseradish varieties HO, RK and 401 and high temperature susceptible varieties EB, JK and NB, PCR was carried out with reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9) , PCR bands were confirmed only in RK and 401 cultivars, and PCR bands were not confirmed in high temperature sensitive cultivars. (Bo01g139130 (pro) -F4, 5'-TCG TTA CTA TGT ACG GTA AAA ATC-3'_ Sequence No. 8) and reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9), PCR bands were confirmed in high temperature sensitive varieties EB, JK and NB, whereas PCR bands were not confirmed in endemic varieties (FIG. 5 ). Through this, it was confirmed that the primer based on the promoter sequence of the marker gene (BoHsp70) can be used for distinguishing between the susceptible and high temperature susceptible varieties of cabbage.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof <130> PN14113 <160> 9 <170> KopatentIn 2.0 <210> 1 <211> 2504 <212> DNA <213> Brassica oleracea <400> 1 atggcgagta aaggcgaagg tccagcgatc ggaatcgatc tcggcactac ctactcctgc 60 gtcggcgtgt ggcagcacga ccgcgtcgaa atcatcgcca acgatcaagg caaccgcacc 120 actccttcct acgtcgcctt caccgacagc gagcgtctca tcggagacgc cgccaagaac 180 caagtcgcta tgaaccctac caacaccgtc ttcggtaagc tcttctcatc tcaaaaccac 240 gaactccgcc ttagattcca gctcttgatg taatgtttgt tcacatactg tatagctcag 300 atctgaaccg gatattcaac tctttaagtt ttaataatca gtgttctaaa attcggttta 360 aatcggttta ggcgcggtta gcaattttta caacattggg ttaaatagag ctggcggatc 420 gtgttgtttg acggttatcg gtttaaatcg gtttagacgc ggttagcgat ttttaaaaca 480 ttgtgtgaaa atagattgat ggaacagtgt tcgaaaaatc ggtttagacg cggttagcga 540 tttttaaaac attgtgtgaa aatagattga tggaacagtg ttcgaaaaat cggtttagac 600 gcggttagcg atttttaaaa cattgtgtga aaatagattg atggacgtat tgtttgacgg 660 ttatcggttt aaatcggttt agacgcggtt ggcgattttt aaaacattgt gctcaaatag 720 agtgatggaa tgaatcgtgt tgtttgacgg ttactcttaa cgtctatgca gatgctaagc 780 gtcttatcgg aagaaggttc agcgacccct ccgtccaggc ggacatgagg cactggcctt 840 tcaaggtcat ctccggccca gctgagaagc ccatgatcgt cgtcaactac aagggagagg 900 agaaacagtt ctcagctgag gagatatcct ccatggtcct cacaaagatg cgtgagatcg 960 cagaagcctt cctcggcacg tccgtcaaaa acgccgtcgt tacagtcccc gcttacttca 1020 acgactctca gcgtcaagcc acaaaggacg ccggagtcat ctcgggactc aacgtgatgc 1080 gcatcatcaa cgagccaacc gctgcggcca tcgcctacgg tctcgacaag aaggcgtcta 1140 gcgttgggga gaagaacgtg ctgatatttg acttgggagg tgggacgttc gatgtgtcgt 1200 tgctcacgat cgaggaaggg atcttcgaag tgaaggcgac ggctggtgat actcatctcg 1260 gtggtgagga ttttgataac aggatggtga accacttcgt tcaggagttt aagaggaagc 1320 acaagaagga tatcaccggg aacccgaggg cgttgaggag gctgaggacg gcgtgcgaga 1380 gagccaagag gactctctct tcgacagcgc agacgacgat tgagattgat tctctctacg 1440 agggggttga tttctacacg actatcacgc gcgcgaggtt tgaggagctg aacatggatc 1500 tgttcaggaa gtgtatggag ccggtggaga agtgtttgag ggacgcgaag atggataaga 1560 gcaatgttca tgacgttgtg ctcgttggtg ggtccactag gatccctaag gttcagcagc 1620 tgttgcagga tttttttaac gggaaggagc tttgtaagag tattaaccct gacgaggctg 1680 ttgcttacgg agcggctgtt caggccgcga ttttgagcgg ggaggggaat gagaaggttc 1740 aggacttgtt gcttcttgat gttacgcctc tgtcattggg gttggagact gctggaggtg 1800 tgatgactgt tttgattccg aggaacacga cgattccgac gaagaaggag cagatcttct 1860 cgacttattc ggacaaccag cctggtgtgt tgattcaagt ctacgaagga gagagagcga 1920 ggacgaagga caacaacctt ttggggaagt ttgagctcag cggcatcccg cctgcaccac 1980 gaggcgttcc tcagatcact gtctgttttg acatagacgc caacggtatc ctgaacgtgt 2040 cggctgaaga caagacgact ggtcagaaga ataaaatcac gatcaccaac gacaagggaa 2100 ggctgtccaa ggaagagatt gagaagatgg tacaagaagc ggagaagtac aaggcagagg 2160 atgaggaaca caagaagaag gtggatgcga agaatgctct ggagaactac gcgtacaaca 2220 tgagaaacac gatcaaggat gagaagatcg cgtctaagct tgatgcagct gacaagaaga 2280 agatcgagga tgcgatcgat caggctattg aatggttgga gggtaatcag ctggcggaag 2340 cggatgagtt tgaggataag atgaaggagc tcgagtctct ctgcaaccca atcattgcga 2400 gaatgtacca aggcggtgat atgggtggag ctggtggcat ggacgacgat gctcctgccg 2460 gtggtagcgg tggtgctgga cccaagattg aagaagttga ttaa 2504 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gggaaggctg tcgaaggaag ag 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gccaccagct ccacccatat c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cgagggtttc tctcttccac ac 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctgcttggtg caagtgctgt g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agggtgcctc acacattcac tgatc 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cctcagttat tttacgtggt tttacg 26 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tcgttactat gtacggtaaa aatc 24 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tcgctaaccg cgtctaaacc g 21 <110> Korea Research Institute of Bioscience and Biotechnology <120> Specific primer for selecting heat-tolerant Brassica oleracea          cultivar and uses thereof <130> PN14113 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 2504 <212> DNA <213> Brassica oleracea <400> 1 atggcgagta aaggcgaagg tccagcgatc ggaatcgatc tcggcactac ctactcctgc 60 gtcggcgtgt ggcagcacga ccgcgtcgaa atcatcgcca acgatcaagg caaccgcacc 120 actccttcct acgtcgcctt caccgacagc gagcgtctca tcggagacgc cgccaagaac 180 caagtcgcta tgaaccctac caacaccgtc ttcggtaagc tcttctcatc tcaaaaccac 240 gaactccgcc ttagattcca gctcttgatg taatgtttgt tcacatactg tatagctcag 300 atctgaaccg gatattcaac tctttaagtt ttaataatca gtgttctaaa attcggttta 360 aatcggttta ggcgcggtta gcaattttta caacattggg ttaaatagag ctggcggatc 420 gtgttgtttg acggttatcg gtttaaatcg gtttagacgc ggttagcgat ttttaaaaca 480 ttgtgtgaaa atagattgat ggaacagtgt tcgaaaaatc ggtttagacg cggttagcga 540 tttttaaaac attgtgtgaa aatagattga tggaacagtg ttcgaaaaat cggtttagac 600 gcggttagcg atttttaaaa cattgtgtga aaatagattg atggacgtat tgtttgacgg 660 ttatcggttt aaatcggttt agacgcggtt ggcgattttt aaaacattgt gctcaaatag 720 agtgatggaa tgaatcgtgt tgtttgacgg ttactcttaa cgtctatgca gatgctaagc 780 gtcttatcgg aagaaggttc agcgacccct ccgtccaggc ggacatgagg cactggcctt 840 tcaaggtcat ctccggccca gctgagaagc ccatgatcgt cgtcaactac aagggagagg 900 agaaacagtt ctcagctgag gagatatcct ccatggtcct cacaaagatg cgtgagatcg 960 cagaagcctt cctcggcacg tccgtcaaaa acgccgtcgt tacagtcccc gcttacttca 1020 acgactctca gcgtcaagcc acaaaggacg ccggagtcat ctcgggactc aacgtgatgc 1080 gcatcatcaa cgagccaacc gctgcggcca tcgcctacgg tctcgacaag aaggcgtcta 1140 gcgttgggga gaagaacgtg ctgatatttg acttgggagg tgggacgttc gatgtgtcgt 1200 tgctcacgat cgaggaaggg atcttcgaag tgaaggcgac ggctggtgat actcatctcg 1260 gtggtgagga ttttgataac aggatggtga accacttcgt tcaggagttt aagaggaagc 1320 acaagaagga tatcaccggg aacccgaggg cgttgaggag gctgaggacg gcgtgcgaga 1380 gagccaagag gactctctct tcgacagcgc agacgacgat tgagattgat tctctctacg 1440 agggggttga tttctacacg actatcacgc gcgcgaggtt tgaggagctg aacatggatc 1500 tgttcaggaa gtgtatggag ccggtggaga agtgtttgag ggacgcgaag atggataaga 1560 gcaatgttca tgacgttgtg ctcgttggtg ggtccactag gatccctaag gttcagcagc 1620 tgttgcagga tttttttaac gggaaggagc tttgtaagag tattaaccct gacgaggctg 1680 ttgcttacgg agcggctgtt caggccgcga ttttgagcgg ggaggggaat gagaaggttc 1740 aggacttgtt gcttcttgat gttacgcctc tgtcattggg gttggagact gctggaggtg 1800 tgatgactgt tttgattccg aggaacacga cgattccgac gaagaaggag cagatcttct 1860 cgacttattc ggacaaccag cctggtgtgt tgattcaagt ctacgaagga gagagagcga 1920 ggacgaagga caacaacctt ttggggaagt ttgagctcag cggcatcccg cctgcaccac 1980 gaggcgttcc tcagatcact gtctgttttg acatagacgc caacggtatc ctgaacgtgt 2040 cggctgaaga caagacgact ggtcagaaga ataaaatcac gatcaccaac gacaagggaa 2100 ggctgtccaa ggaagagatt gagaagatgg tacaagaagc ggagaagtac aaggcagagg 2160 atgaggaaca caagaagaag gtggatgcga agaatgctct ggagaactac gcgtacaaca 2220 tgagaaacac gatcaaggat gagaagatcg cgtctaagct tgatgcagct gacaagaaga 2280 agatcgagga tgcgatcgat caggctattg aatggttgga gggtaatcag ctggcggaag 2340 cggatgagtt tgaggataag atgaaggagc tcgagtctct ctgcaaccca atcattgcga 2400 gaatgtacca aggcggtgat atgggtggag ctggtggcat ggacgacgat gctcctgccg 2460 gtggtagcgg tggtgctgga cccaagattg aagaagttga ttaa 2504 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gggaaggctg tcgaaggaag ag 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gccaccagct ccacccatat c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cgagggtttc tctcttccac ac 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctgcttggtg caagtgctgt g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agggtgcctc acacattcac tgatc 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cctcagttat tttacgtggt tttacg 26 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tcgttactat gtacggtaaa aatc 24 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tcgctaaccg cgtctaaacc g 21

Claims (8)

서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트를 포함하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트.An oligonucleotide primer set for screening an endosperm cabbage variety comprising an oligonucleotide primer set of SEQ ID NOS: 7 and 9. 삭제delete 제1항에 있어서, 서열번호 8의 올리고뉴클레오티드 프라이머를 추가로 포함하는 것을 특징으로 하는 내서성 양배추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트.The oligonucleotide primer set of claim 1, further comprising an oligonucleotide primer of SEQ ID NO: 8. 제1항 또는 제3항에 따른 올리고뉴클레오티드 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는 내서성 양배추 품종을 선별하기 위한 키트.An oligonucleotide primer set according to any one of claims 1 to 3; And a reagent for carrying out an amplification reaction. 제4항에 있어서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 및 버퍼를 포함하는 것인 내서성 양배추 품종을 선별하기 위한 키트.5. The kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. 양배추 시료에서 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제1항 또는 제3항의 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
상기 증폭 산물을 검출하는 단계를 포함하는, 내서성 양배추 품종을 선별하기 위한 방법.
Isolating the genomic DNA from the cabbage sample;
Amplifying the target sequence by using the separated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of claim 1 or 3; And
And detecting the amplification product. &Lt; Desc / Clms Page number 19 &gt;
제6항에 있어서, 상기 증폭된 표적 서열은 형광, 인광 또는 방사성을 발하는 물질로 표지되어 있는 것인 내서성 양배추 품종을 선별하기 위한 방법.7. The method according to claim 6, wherein the amplified target sequence is labeled with a fluorescent, phosphorescent or radioactive substance. 제6항에 있어서, 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것인 내서성 양배추 품종을 선별하기 위한 방법.7. The method according to claim 6, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
KR1020140051314A 2014-04-29 2014-04-29 Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof KR101609309B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140051314A KR101609309B1 (en) 2014-04-29 2014-04-29 Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140051314A KR101609309B1 (en) 2014-04-29 2014-04-29 Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof

Publications (2)

Publication Number Publication Date
KR20150124615A KR20150124615A (en) 2015-11-06
KR101609309B1 true KR101609309B1 (en) 2016-04-05

Family

ID=54600922

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140051314A KR101609309B1 (en) 2014-04-29 2014-04-29 Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof

Country Status (1)

Country Link
KR (1) KR101609309B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102051578B1 (en) * 2018-10-05 2019-12-03 충남대학교 산학협력단 Primer set for discriminating heat-tolerant Brassica oleracea cultivar using BoTPPI gene and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Int. J. Mol. Sci. 2013, Vol. 14, pp. 11871-11894.*

Also Published As

Publication number Publication date
KR20150124615A (en) 2015-11-06

Similar Documents

Publication Publication Date Title
KR101516190B1 (en) SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR101752658B1 (en) SSR molecular markers for discriminating of Codonopsis lanceolata cultivars and uses thereof
KR102358788B1 (en) Molecular marker and for discriminating low temperature-tolerant cabbage cultivar and uses thereof
KR101804120B1 (en) Complete sequencing of chloroplast genome and nrDNA of Aloe vera, Aloe saponaria and Aloe Saengjang-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof
KR101073000B1 (en) Method of discriminating ginseng cultivars using STS primers
KR101573419B1 (en) Primer set for discrimination of pepper cultivar having high content of capsinoid and uses thereof
CN116555475B (en) Indel molecular marker of corn gene ZmPOP10 and application thereof
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
KR101609309B1 (en) Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof
CN108004236B (en) Corn stalk rot disease-resistant molecular breeding method and application thereof
KR102332689B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Panax ginseng &#39;GeumJin&#39; and &#39;SeonHyang&#39; cultivar and uses thereof
KR102332688B1 (en) Molecular marker based on nuclear genome sequence for discriminating Panax ginseng &#39;SeonHyang&#39; cultivar and uses thereof
KR20150121794A (en) Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same
KR101563351B1 (en) New aloe cultivar Aloe vera Saengjang and molecular marker for discriminating the same
KR101301863B1 (en) A method for identifying lettuce varieties using microsatellite primer set
CN104313143A (en) Molecular marker closely interlocked with anti-anthracnose gene locus of common beans and detection method of molecular marker
KR101735244B1 (en) Marker for discriminating bolting time in radish and uses thereof
KR102162805B1 (en) Marker composition for discriminating anthracnose-resistant or sensitive grape cultivar and uses thereof
KR102507555B1 (en) Molecular marker for discriminating presence or absence of russet formation in pear and uses thereof
CN112094940B (en) Indel marker linked with cucumber long hypocotyl gene lh1 as well as primer, kit and application thereof
KR102066594B1 (en) Korea Gold, new cultivar of Euonymus hamiltonianus and molecular marker for discriminating the same
KR102524050B1 (en) Molecular marker for discriminating sex of Actinidia arguta and uses thereof
KR102066593B1 (en) Orange Beauty, new cultivar of Lilium lancifolium and molecular marker for discriminating the same
KR102066599B1 (en) First Bell, new cultivar of Hosta capitata and molecular marker for discriminating the same
KR102212518B1 (en) SSR marker for discriminating cultivars or resources of Atractylodes japonica and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20190207

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20200204

Year of fee payment: 5