KR101609309B1 - Specific primer for selecting heat-tolerant Brassica oleracea cultivar and uses thereof - Google Patents

Abstract

The present invention relates to an oligonucleotide primer set for selecting an endosperm cabbage cultivar comprising the primer set of SEQ ID NOS: 7 and 9, a kit for selecting an endosperm cabbage variety including the primer set, Provides a method of screening cabbage varieties.

Description

Specific primers and their uses for screening of endosperm cabbage varieties. Specific primers for selecting heat-tolerant Brassica oleracea cultivar and uses thereof.

More particularly, the present invention relates to an oligonucleotide primer set for screening an endosperm cabbage cultivar containing a primer set represented by SEQ ID NOS: 7 and 9, A primer set, and a method for selecting an endosperm cabbage cultivar using the primer set.

Under natural and agricultural conditions, plants must constantly endure stress. Some environmental factors (eg, high or low temperatures) can be very stressful in a very short time, and other stresses (eg, soil water content or mineral nutrients) can take a long time to stress plants. In general, environmental stresses affecting plants can be in the form of climate-related stress, air pollution stress, chemical stress, and nutritional stress.

Examples of climate-related stresses include droughts, floods, frosts, low temperatures, high temperatures, excessive light, and insufficient light. Air pollution stress can be in the form of carbon dioxide, carbon monoxide, sulfur dioxide, NOx, hydrocarbons, ozone, ultraviolet and acid rain. Chemical stresses can result from the application of insecticides, fungicides, herbicides and heavy metals. Nutritional stress can be caused by fertilizers, micronutrients and macromutrients.

Susceptible species are cold-weathered at temperatures that are too low to grow normally and not low enough to grow normally. Such damage usually occurs in species of tropical or subtropical origin. When cooled, the leaves show discoloration or lesions, which give the leaves a water-soaked appearance. Once the roots have cooled down, the plants can die. On the other hand, the freezing temperature and concomitant formation of ice crystals in the plant may be fatal if the ice crystals are extended to protoplasts or maintained for a long time.

Stress can also be caused by other excessive temperatures, and almost all plants can not survive at high temperatures. If the cells or tissues of the higher plant are not dehydrated or grown, these cells can survive at higher temperatures than the cells in hydration, nutrition and growth. Actively growing tissues can hardly survive at temperatures above 45 ° C.

On the other hand, cabbage is a plant belonging to the cruciferous family. It is used for food by picking leaf parts. It is a food material with low calorie content and rich in minerals and dietary fiber such as vitamin C, potassium and calcium. Especially in the western part, It is called longevity food. Cabbage contains a large amount of sulfur, chlorine, vitamins U and vitamin K to strengthen the mucous membranes of the stomach, as well as alleviating ulcers and is known to have the effect of preventing stomach cancer. Therefore, it is recommended to continue to eat for the above health.

For this reason, cabbage is one of the most cultivated vegetable crops in the world, but recently the damage of cabbage cultivation has become serious due to global weather conditions (shortage of sunshine, lack of sunshine time, low temperature, high temperature and frequent rainfall) Since these factors are more likely to occur in the future, it is imperative to secure a stable (high temperature) resistant variety as a countermeasure.

Korean Patent Laid-Open Publication No. 2014-0043591 discloses a potato-derived high-temperature stress-resistance gene and a high-temperature stress-resistant transformant prepared therefrom. Korean Patent Laid-Open Publication No. 2014-0028277 discloses a sweet potato IbOrange gene Although the use thereof has been disclosed, the specific primers for selecting the endosperm cabbage cultivars and the use thereof have never been described in the present invention.

The present inventors have found that the cabbage plants were treated with high temperature stress and then phenotypic observations were made to distinguish between internal and external temperature sensitive cultivars. After the high temperature (42 캜) stress treatment, Analysis of various gene expressions of cabbage and high temperature susceptible cabbage revealed that BoHSP70, a gene marker that specifically increased expression in endosperm cabbage cultivars. The gene markers were heat shock protein 70 (BoHsp70) gene of cabbage, and it was confirmed that gene expression was increased about 4 times as compared with that of high temperature susceptible varieties at high temperature stress treatment. Sequence analysis of the promoter region of the corresponding gene marker on the genomic DNA revealed the difference in the nucleotide sequence between the resistant strain and the susceptible strain. Based on the nucleotide sequence that shows difference between the inner and outer temperature sensitive varieties, primers for distinguishing the inner seedling cabbage were prepared and the present invention was completed by proving the applicability of the primers to six cabbage cultivars.

In order to accomplish the object of the present invention, the present invention provides a set of oligonucleotide primers for screening an endosperm cabbage variety comprising oligonucleotide primer sets of SEQ ID NOS: 7 and 9.

In addition, the present invention provides a kit for screening an endosperm cabbage variety comprising the above primer set.

In addition, the present invention provides a method for selecting an endosperm cabbage cultivar using the primer set.

According to the present invention, a phenotypic analysis method by high temperature stress treatment was established in the laboratory conditions of the cabbage western / high temperature sensitive varieties. In addition, BoHsp70 was selected as a marker gene by comparing and analyzing the high temperature stress related gene expression of the internal / high temperature sensitive cultivars of six cabbage cultivars. Through the nucleotide sequence analysis of the promoter of the corresponding gene, internal / Primers were prepared. Therefore, through the present invention, a simple genomic DNA PCR method can be expected to distinguish the endogenous trait of cabbage from the young stage in cabbage breeding site.

FIG. 1 is a diagram showing the phenotype after high-temperature stress of cabbage western varieties and high temperature susceptible varieties. Phenotypic photographs of 6 cabbage cultivars after high temperature stress treatment (42 ℃, 5 hours) in infant plants. NS; Non stress, plants grown under normal conditions without stress (24 ℃), HS; Heat stress, plants after high temperature stress treatment.
Fig. 2 shows the expression of BoHsp70 gene in endemic and high temperature susceptible varieties. This is a graph showing the expression of BoHsp70 gene in qPCR by extracting RNA from plants treated with high temperature stress (42 ° C., 5 hours) and plants not subjected to high temperature stress after two weeks of growing under normal conditions. Gene expression values were quantified as BoActin1 gene expression values.
FIG. 3 shows the result of sequence alignment of the BoHsp70 gene promoter region of a total of six cabbage cultivars. A) A simple schematic of the BoHsp70 gene promoter region on the cabbage genomic DNA. UP_1kb; BoHsp70 gene 1 kb upstream of coding sequence start site. B) Sequence alignment of BoHsp70 gene promoter region and location of nucleotide sequences showing differences in endogenous and high temperature susceptible varieties. Forward3; Myxogenic variety specific forward primer 3, Forwad4; High temperature sensitive varieties specific forward primer 4, Reverse1; Inner / High Temperature Sensitivity Specific reverse primer.
Fig. 4 shows the nucleotide sequence of the BoHsp70 gene promoter portion of the insect-resistant variety HO and the high-temperature sensitive cultivar EB.
FIG. 5 shows the results of PCR using the cabbage western / high temperature sensitivity specific primer. (Bo01g139130 (pro) -F3_ SEQ ID NO: 7) and the reverse primer (Bo01g139130 (pro)) were extracted from the genomic DNAs from the domestic calligraphy varieties HO, RK and 401 and high temperature sensitive cultivars EB, JK and NB, (Bo01g139130 (pro) -F4_ SEQ ID NO: 8) and the reverse primer (Bo01g139130 (pro) -R_ SEQ ID NO: 9) 9) (bottom gel photograph).

In order to accomplish the object of the present invention, the present invention provides an oligonucleotide comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of at least 15 consecutive nucleotides in the sequence of SEQ ID NO: 7 and at least 15 oligonucleotides in the sequence of SEQ ID NO: An oligonucleotide primer set comprising an oligonucleotide primer set comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of consecutive nucleotides.

The oligonucleotide is preferably at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 Lt; RTI ID = 0.0 > oligonucleotides < / RTI > consisting of fragments of more than two consecutive nucleotides. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive nucleotides in the sequence of SEQ ID NO: 9.

The set of oligonucleotide primers according to one embodiment of the present invention is more preferably a set of oligonucleotide primers of SEQ ID NOS: 7 and 9.

An oligonucleotide primer set according to an embodiment of the present invention may further include, but is not limited to, an oligonucleotide primer set of SEQ ID NO: 8.

The oligonucleotides preferably comprise fragments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 consecutive nucleotides in the sequence of SEQ ID NO: 8 Lt; / RTI > oligonucleotides.

The present invention can use oligonucleotide primer sets of SEQ ID NOs: 7 and 9 to select the endosperm cabbage variety, and particularly, when oligonucleotide primers of SEQ ID NO: 8 are additionally used, The oligonucleotide primer sets of SEQ ID NOs: 8 and 9 can specifically select high temperature sensitive cabbage cultivars. When these three primers are used simultaneously, Cabbage varieties can be selected relatively easily and accurately.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ion concentration, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In order to achieve still another object of the present invention,

An oligonucleotide primer set according to the present invention; And a reagent for carrying out an amplification reaction. The present invention also provides a kit for selecting an endemic cabbage variety. In the kit of the present invention, the reagent for carrying out the amplification reaction may include a DNA polymerase, dNTPs, a buffer solution and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

Isolating the genomic DNA from the cabbage sample;

Amplifying the target sequence by using the separated genomic DNA as a template and carrying out an amplification reaction using the oligonucleotide primer set; And

And detecting the amplification product. The present invention also provides a method for selecting an endemic cabbage variety.

The method of the present invention comprises isolating genomic DNA from a cabbage sample. A method known in the art can be used as a method for separating the genomic DNA from the sample. Using the separated genomic DNA as a template, an oligonucleotide primer set according to an embodiment of the present invention may be used as a primer to perform an amplification reaction to amplify the target sequence. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, the polymerase chain reaction is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such polymerase chain reaction methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, Cy-5 or Cy-3 is labeled at the 5'-end of the primer and the polymerase chain reaction is performed, whereby the target sequence can be labeled with a detectable fluorescent labeling substance. When a radioactive isotope such as ³² P or ³⁵ S is added to the polymerase chain reaction, the amplification product is synthesized, and the radioactive substance is incorporated into the amplification product. When the amplification product is radioactive ≪ / RTI > The set of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when Cy-5 or Cy-3 is labeled at the 5'-end of the primer and the polymerase chain reaction is performed, the target is labeled with a fluorescent label capable of detecting the target sequence. Can be measured. In addition, in the radioactive determination method, a radioactive isotope such as ³² P or ³⁵ S is added to the polymerase chain reaction to label the amplified product, and then a radioactive measurement instrument such as a Geiger counter Geiger counter or liquid scintillation counter can be used to measure the radioactivity.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. Identification of high-temperature stress phenotype in susceptible / high temperature susceptible varieties in cabbage

In the cabbage, Seosung variety HO, RK and 401 and high temperature sensitive variety EB, JK and NB were all sold as experimental seeds from Asian seeds (Table 1). In order to confirm the phenotype of endogenous seeds classified from Asian seedlings under laboratory conditions, one week old and 2 weeks old plants were treated with high temperature stress to observe the phenotype. Cabbage seeds were sterilized with 70% ethanol and 10% RAX and seeded in 1 / 2MS agar (1 / 2MS, 1% sucrose, 0.5% phytoagar) medium and cultured under culture conditions (23 ℃, 16h / 8h Cancer) for one week. The high temperature stress was treated in a 42 ° C growth chamber for 5 hours and the phenotype was observed 4 days after the stress treatment. The cotyledons of HO, RK and 401, which were resistant to stress, were reduced in size compared to the normal condition in which the cotyledon was not stress-treated, but the shape of the leaves recovered similar to the normal condition, The susceptible varieties EB, JK and NB plants exhibited a phenotype in which the cotyledon was dry and bleached due to high temperature stress and could not be recovered normally (Fig. 1).

Name of varieties Classification HO My spouse RK My spouse 401 My spouse EB High Temperature Sensitivity JK High Temperature Sensitivity NB High Temperature Sensitivity

Example  2. Cabbage Seosung / High Temperature Sensitive Varieties Marker  gene ( BoHsp70 ) excavation

For six cabbage varieties, several genes related to high-temperature stress were analyzed by qRT-PCR to identify marker genes that differ in gene expression in endosperm and high temperature susceptible varieties at high temperature stress. The total RNA was extracted from the leaves of the cabbage grown in two cultivars under the normal condition (NS) and the high temperature stress treatment condition (HS, 42 ℃, 5 hours). CDNA was synthesized from the extracted total RNA using reverse transcriptase and used as a template for qRT-PCR. In order to examine the expression of BoHsp70 gene, BoHsp70 (Bo01g139130) gene-specific primer forward (BoHsp70-F, 5'-GGG AAG GCT GTC GAA GGA AGA G-3'_ sequence 2) and reverse (BoHsp70-R, 5'-GCC ACC AGC TCC ACC CAT ATC-3'_ SEQ ID NO: 3) (Table 2). (5'-CTG CTT GGT GCA AGT GCT GTG-3'_ SEQ ID NO: 5) and the reverse direction (5'-CTG CTT GGT GGA AGT GCT GTG-3'_ SEQ ID NO: 5) of the BoActin1 gene in the primer forward direction -PCR was quantified. As a result of comparing the expression of BoHsp70 gene in endogenous and high temperature susceptible varieties under high temperature stress conditions, the relative expression values of EB, JK and NB, which are high temperature sensitive varieties, ranged between 0.5 and 1.0, while those of endogenous varieties HO, RK and 401 Was between 3.0 and 4.5, indicating that the expression level was increased about 4 times as compared with that of the high temperature sensitive cultivar (FIG. 2). BoHsp70 (Bo01g139130) gene (SEQ ID NO: 1) was selected as a marker gene for resistance to internalization of cabbage on the basis of the fact that these three varieties are common in three varieties of domestic lettuce cabbage and three varieties of high temperature sensitivity.

primer  designation primer  The sequence (5'-3 ') (SEQ ID NO: BoHsp70-F  GGGAAGGCTGTCGAAGGAAGAG (2) BoHsp70-R  GCCACCAGCTCCACCCATATC (3) Bo01g139130 (pro) -F2  AGGGTGCCTCACACATTCACTGATC (6) Bo01g139130 (pro) -F3  CCTCAGTTATTTTACGTGGTTTTACG (7) Bo01g139130 (pro) -F4  TCGTTACTATGTACGGTAAAAATC (8) Bo01g139130 (pro) -R  TCGCTAACCGCGTCTAAACCG (9)

Example  3. Inner Seosung / High Temperature Sensitive Varieties Marker  Sequence analysis of gene promoter

The sequence of the promoter region of the BoHsp70 gene was analyzed to investigate the cause of the difference in the expression level of the BoHsp70 gene according to the tolerance / temperature susceptibility varieties under the high temperature stress condition. Genomic DNA was extracted from the leaf of the plant after two to three weeks of planting for HO, RK and 401, and high temperature susceptible varieties EB, JK and NB. Genomic DNA was extracted from plant leaves using liquid nitrogen and extracted with a genomic DNA extraction buffer (50 mM Tris-Cl pH 8.0, 100 mM NaCl, 50 mM EDTA, 0.5% SDS) and phenol extraction method. (Bo01g139130 (pro) -F2, 5'-AGG GTG CCT CAC ACA TTC ACT GAT C-3'_ sequence which can confirm BoHsp70 gene promoter base sequence (upper 600-100 bp) based on the results of cabbage total genome sequencing No. 6) and reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9). Sequences of HO, RK, and 401, which are endemic varieties, were all consistent as a result of sequence sequencing of six varieties using the cluster W2 program. As a result, EB, JK and NB, (Fig. 3). In addition, it was confirmed that the nucleotide sequence was partially different from that of the Seosung variety (Fig. 3). These results suggest that the difference in the promoter sequence in the seed / high temperature susceptible varieties might have affected the expression of BoHsp70 gene. Also, in order to select the endogenous / high temperature susceptible varieties on genomic DNA, the positions where the nucleotide sequences are relatively different from each other in the promoter sequence analysis of endemic varieties and high temperature susceptible varieties were selected to prepare primers for marker genes Respectively.

Example  4. Marker  Gene Primer  Differentiate between internal / high temperature susceptible varieties

 In order to verify the applicability of the primers based on the promoter sequence of the marker gene (BoHsp70), PCR was performed on a total of six cultivars. Genomic DNAs were extracted from horseradish varieties HO, RK and 401 and high temperature susceptible varieties EB, JK and NB, PCR was carried out with reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9) , PCR bands were confirmed only in RK and 401 cultivars, and PCR bands were not confirmed in high temperature sensitive cultivars. (Bo01g139130 (pro) -F4, 5'-TCG TTA CTA TGT ACG GTA AAA ATC-3'_ Sequence No. 8) and reverse primer (Bo01g139130 (pro) -R, 5'-TCG CTA ACC GCG TCT AAA CCG-3'_ SEQ ID NO: 9), PCR bands were confirmed in high temperature sensitive varieties EB, JK and NB, whereas PCR bands were not confirmed in endemic varieties (FIG. 5 ). Through this, it was confirmed that the primer based on the promoter sequence of the marker gene (BoHsp70) can be used for distinguishing between the susceptible and high temperature susceptible varieties of cabbage.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Specific primer for selecting heat-tolerant Brassica oleracea          cultivar and uses thereof <130> PN14113 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 2504 <212> DNA <213> Brassica oleracea <400> 1 atggcgagta aaggcgaagg tccagcgatc ggaatcgatc tcggcactac ctactcctgc 60 gtcggcgtgt ggcagcacga ccgcgtcgaa atcatcgcca acgatcaagg caaccgcacc 120 actccttcct acgtcgcctt caccgacagc gagcgtctca tcggagacgc cgccaagaac 180 caagtcgcta tgaaccctac caacaccgtc ttcggtaagc tcttctcatc tcaaaaccac 240 gaactccgcc ttagattcca gctcttgatg taatgtttgt tcacatactg tatagctcag 300 atctgaaccg gatattcaac tctttaagtt ttaataatca gtgttctaaa attcggttta 360 aatcggttta ggcgcggtta gcaattttta caacattggg ttaaatagag ctggcggatc 420 gtgttgtttg acggttatcg gtttaaatcg gtttagacgc ggttagcgat ttttaaaaca 480 ttgtgtgaaa atagattgat ggaacagtgt tcgaaaaatc ggtttagacg cggttagcga 540 tttttaaaac attgtgtgaa aatagattga tggaacagtg ttcgaaaaat cggtttagac 600 gcggttagcg atttttaaaa cattgtgtga aaatagattg atggacgtat tgtttgacgg 660 ttatcggttt aaatcggttt agacgcggtt ggcgattttt aaaacattgt gctcaaatag 720 agtgatggaa tgaatcgtgt tgtttgacgg ttactcttaa cgtctatgca gatgctaagc 780 gtcttatcgg aagaaggttc agcgacccct ccgtccaggc ggacatgagg cactggcctt 840 tcaaggtcat ctccggccca gctgagaagc ccatgatcgt cgtcaactac aagggagagg 900 agaaacagtt ctcagctgag gagatatcct ccatggtcct cacaaagatg cgtgagatcg 960 cagaagcctt cctcggcacg tccgtcaaaa acgccgtcgt tacagtcccc gcttacttca 1020 acgactctca gcgtcaagcc acaaaggacg ccggagtcat ctcgggactc aacgtgatgc 1080 gcatcatcaa cgagccaacc gctgcggcca tcgcctacgg tctcgacaag aaggcgtcta 1140 gcgttgggga gaagaacgtg ctgatatttg acttgggagg tgggacgttc gatgtgtcgt 1200 tgctcacgat cgaggaaggg atcttcgaag tgaaggcgac ggctggtgat actcatctcg 1260 gtggtgagga ttttgataac aggatggtga accacttcgt tcaggagttt aagaggaagc 1320 acaagaagga tatcaccggg aacccgaggg cgttgaggag gctgaggacg gcgtgcgaga 1380 gagccaagag gactctctct tcgacagcgc agacgacgat tgagattgat tctctctacg 1440 agggggttga tttctacacg actatcacgc gcgcgaggtt tgaggagctg aacatggatc 1500 tgttcaggaa gtgtatggag ccggtggaga agtgtttgag ggacgcgaag atggataaga 1560 gcaatgttca tgacgttgtg ctcgttggtg ggtccactag gatccctaag gttcagcagc 1620 tgttgcagga tttttttaac gggaaggagc tttgtaagag tattaaccct gacgaggctg 1680 ttgcttacgg agcggctgtt caggccgcga ttttgagcgg ggaggggaat gagaaggttc 1740 aggacttgtt gcttcttgat gttacgcctc tgtcattggg gttggagact gctggaggtg 1800 tgatgactgt tttgattccg aggaacacga cgattccgac gaagaaggag cagatcttct 1860 cgacttattc ggacaaccag cctggtgtgt tgattcaagt ctacgaagga gagagagcga 1920 ggacgaagga caacaacctt ttggggaagt ttgagctcag cggcatcccg cctgcaccac 1980 gaggcgttcc tcagatcact gtctgttttg acatagacgc caacggtatc ctgaacgtgt 2040 cggctgaaga caagacgact ggtcagaaga ataaaatcac gatcaccaac gacaagggaa 2100 ggctgtccaa ggaagagatt gagaagatgg tacaagaagc ggagaagtac aaggcagagg 2160 atgaggaaca caagaagaag gtggatgcga agaatgctct ggagaactac gcgtacaaca 2220 tgagaaacac gatcaaggat gagaagatcg cgtctaagct tgatgcagct gacaagaaga 2280 agatcgagga tgcgatcgat caggctattg aatggttgga gggtaatcag ctggcggaag 2340 cggatgagtt tgaggataag atgaaggagc tcgagtctct ctgcaaccca atcattgcga 2400 gaatgtacca aggcggtgat atgggtggag ctggtggcat ggacgacgat gctcctgccg 2460 gtggtagcgg tggtgctgga cccaagattg aagaagttga ttaa 2504 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gggaaggctg tcgaaggaag ag 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gccaccagct ccacccatat c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cgagggtttc tctcttccac ac 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctgcttggtg caagtgctgt g 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agggtgcctc acacattcac tgatc 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cctcagttat tttacgtggt tttacg 26 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tcgttactat gtacggtaaa aatc 24 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tcgctaaccg cgtctaaacc g 21

Claims (8)

An oligonucleotide primer set for screening an endosperm cabbage variety comprising an oligonucleotide primer set of SEQ ID NOS: 7 and 9. delete The oligonucleotide primer set of claim 1, further comprising an oligonucleotide primer of SEQ ID NO: 8. An oligonucleotide primer set according to any one of claims 1 to 3; And a reagent for carrying out an amplification reaction. 5. The kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. Isolating the genomic DNA from the cabbage sample;
Amplifying the target sequence by using the separated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set of claim 1 or 3; And
And detecting the amplification product. &Lt; Desc / Clms Page number 19 &gt; 7. The method according to claim 6, wherein the amplified target sequence is labeled with a fluorescent, phosphorescent or radioactive substance. 7. The method according to claim 6, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images