CN110791569B - Duck egg shell color related molecular marker and application thereof - Google Patents
Duck egg shell color related molecular marker and application thereof Download PDFInfo
- Publication number
- CN110791569B CN110791569B CN201810875930.XA CN201810875930A CN110791569B CN 110791569 B CN110791569 B CN 110791569B CN 201810875930 A CN201810875930 A CN 201810875930A CN 110791569 B CN110791569 B CN 110791569B
- Authority
- CN
- China
- Prior art keywords
- duck
- seq
- shell
- genotype
- egg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention belongs to the field of poultry molecular breeding, and relates to a duck egg shell color molecular marker and application thereof in duck egg shell color prediction and egg type breeding duck breeding. The nucleotide sequence of the molecular marker is shown as SEQ ID No.1 or SEQ ID No.2, and the change of the genotype at the locus of the molecular marker G1157A is analyzed by using a PCR (polymerase chain reaction) and sequencing method, so that the color prediction of the eggshell of the duck egg can be accurately, quickly and effectively carried out, and a powerful molecular biological basis and an implementation method are provided for breeding ducks.
Description
Technical Field
The invention belongs to the field of poultry breeding and molecular biology. In particular to a duck egg shell color related molecular marker and application thereof in duck egg shell color prediction and breeding.
Background
Eggshells of poultry are mainly classified into three types, namely brown shell, green shell and white shell, according to the colors of the eggshells, wherein the brown shell and the white shell are two main eggshell colors. The color of the eggshell of the poultry is one of the important characteristics of the variety and the strain as the feather and the feather color of the eggshell of the poultry, and becomes the important content of variety and strain breeding in the breeding process.
The color of the eggshell is one of indexes for measuring the quality of the egg product, and compared with other two colors, the eggshell of the green-shell egg is generally considered to be thicker, the strength of the eggshell is higher, the solar radiation resistance, the oxidation resistance and the breakage resistance are stronger, the storage time of the egg is increased, and the economic loss caused by the breakage of the eggshell in the processing, transportation and storage processes is reduced; on the other hand, researches show that the content of calcium and amino acid (except lysine) in the green-shell egg protein is higher than that of common eggs, the green-shell egg protein has richer nutritional value, natural and bright appearance, is popular with consumers and has obvious price advantage. Therefore, the breeding of egg-type poultry is mainly green-shell eggs in the color of the eggshells. In view of this, a plurality of egg-laying duck varieties develop the conventional breeding work of green-shell line.
At present, the research on the genetic mechanism of the green shell character of the duck is still in the primary stage. In 1991, Liyanzhong and the like take Putian black ducks, Jinding ducks and Conbel ducks as materials, and utilize genetic methods such as hybridization, backcross, selfing and the like to discuss the genetic rule of the color of duck eggshells, reveal that the duck green-shell character is an autosomal dominant character controlled by a single gene, and lay a genetic foundation for the molecular mechanism research of the duck green-shell character. The biliverdin reductase A gene (BLVRA) is closely related to the content of biliverdin which is a main pigment component for forming the green-shell character, the BLVRA gene is used as a research object in Zhangole 2010 for preliminarily exploring a genetic mechanism for forming the green-shell character of the Jinyun sheldrake, the expression quantity of mRNA of the BLVRA gene at the uterine part of the uterine tube of the Jinyun sheldrake is gradually reduced along with the deepening of the color of the green shell, and the expression change rule is presumed to have important influence on the formation of the green-shell character of the duck. Simultaneously, microsatellite markers AY493302 highly related to eggshell colors are successfully screened in Jinyun sheldrake of Yuan Qingyan and the like, the JJ genotypes of the markers only appear in the Jinyun sheldrake, but not in the Jinyun sheldrake, the frequency difference between the two ducks is extremely obvious (P <0.0001), genes linked with the markers are presumed to possibly participate in regulating and controlling synthesis of duck eggshell pigments, and the microsatellite markers are positioned on duck chromosome 3 according to the reports of yellow honeysuckle, and the duck green shell genes are presumed to possibly be positioned on duck chromosome 3. The results lay the foundation for researching the genetic mechanism of the duck green shell character. However, no effective molecular marker can be accurately used for breeding the green-shell laying duck so far.
At present, the breeding of green-shell laying ducks mainly adopts a conventional breeding method. The method has the defects of complex breeding process, long breeding period, need of multi-generation continuous breeding, high breeding cost and the like. The molecular breeding technology is rapidly advanced in recent years, so that the breeding efficiency and accuracy can be improved; on the other hand, individuals can be selected early, so that the defects of the conventional breeding method are avoided; therefore, the development of a molecular marker directly used for the breeding of the green-shell laying duck becomes a common appeal in the industry.
Reference documents: 1. lahti, D.C. (2008). Point differentiation and Rapid evaluation of egg colour in access with native irradiation. Auk 125: 796-.
2. Zhangbao le, Li Guoqin, Octopus, Shen military, Li Chengjun and so on (2010) duck BLVRA gene cDNA clone and correlation analysis of mRNA expression quantity and blue shell character in the uterine part of the oviduct. Livestock veterinary bulletin 41: 1082-1089.
3. Yuan Qingyan, Dougong, Limonitou, Shenmilitary, Chengyochun et al (2010) correlation of microsatellite marker AY493302 with the color of egg shells of Jinyun Ma duck 26: 12-16.
Disclosure of Invention
Aiming at the defects in the prior art, in order to solve the problems, the invention provides a molecular marker capable of accurately judging the egg production color (green shell or white shell) of ducks by utilizing six varieties of Shaoxing ducks, wild sheldrake, Jinyun sheldrake, Beijing ducks, Zhi county sheldrake and green-head wild ducks for verification on the basis of reading the whole duck genome data information, and can accurately breed the individual ducks producing green shell eggs or white shell eggs by detecting the genotype of the molecular marker.
The specific technical scheme of the invention is as follows:
the invention provides a molecular marker for duck egg shell color, and a nucleotide sequence of the molecular marker is shown in SEQ ID No. 1.
The invention provides a molecular marker for duck egg shell color, and a nucleotide sequence of the molecular marker is shown in SEQ ID No. 2.
The invention provides a group of primers for predicting or detecting the color of duck egg shells, and the nucleotide sequences of the primers are shown as SEQ ID NO.3 and SEQ ID NO. 4.
The invention provides a method for predicting or detecting the color of an eggshell of a duck egg, which comprises the following steps:
1) extracting duck genome DNA as a template;
2) designing a primer aiming at the 1157 site of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and carrying out PCR amplification;
3) detecting the genotype of 1157 site of the sequence shown by SEQ ID NO.1 or SEQ ID NO.2 of the individual to be detected.
In the method, any primer of which the amplification product can cover the 1157 site of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 can be used for the PCR amplification in the step 2); the PCR amplification in step 2) is preferably carried out using primers shown in SEQ ID NO.3 and SEQ ID NO. 4.
In the above method, according to the sequence characteristics of the primer, one skilled in the art can set a PCR amplification system and amplification conditions according to his conventional technical knowledge; preferably, the PCR amplification conditions of step 2) are: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30S, annealing at 65 ℃ for 30S, and extension at 72 ℃ for 1min for 30 cycles; finally, extension is carried out for 5min at 72 ℃.
In the method, the genotype in the step 3) is AA or AG, the duck egg shell presents a green shell phenotype, and the genotype is GG, the duck egg shell presents a white shell phenotype.
The invention provides application of a molecular marker shown in SEQ ID NO.1 or SEQ ID NO.2 and/or primers shown in SEQ ID NO.3 and SEQ ID NO.4 in predicting or detecting the color of duck egg shells.
The invention provides application of a molecular marker shown in SEQ ID NO.1 or SEQ ID NO.2 and/or primers shown in SEQ ID NO.3 and SEQ ID NO.4 in breeding duck breeding.
In the application, the breeding duck is an egg-type breeding duck, and produces green shell protein or white shell protein.
The duck of the present invention includes all kinds of ducks, particularly, but not limited to, shaoxing duck, shan mao duck, jin yun mao duck, beijing duck, you county mao duck, and green wild duck.
The molecular marker related to the color of the egg shell of the duck egg and the breeding method for the breeding duck by applying the molecular marker have the following advantages: 1) the breeding efficiency is generally improved, and the breeding period is effectively shortened; 2) the breeding accuracy is improved; 3) the early acquisition of germplasm resources is realized; 4) the molecular biology experiment method is simple and easy to implement; 5) compared with the traditional breeding method, the cost is low.
Drawings
FIG. 1 shows a genotype map of GG gene at a locus G1157A of a duck egg shell color trait related molecular marker.
FIG. 2 is a diagram of an AG genotype at the site of a molecular marker G1157A related to the color traits of duck egg shells.
FIG. 3 is a diagram of AA genotype at the site of a molecular marker G1157A related to the color traits of duck egg shells.
Detailed Description
The invention is further illustrated by the following examples, which are not to be construed as limiting the invention.
Example 1 discovery of molecular markers
16283527 SNPs are obtained in total by performing genome-wide re-sequencing on three genotypes of 6 homozygous green-shell, 10 heterozygous green-shell and 10 homozygous white-shell, wherein 7179415 SNPs are used for genome-wide association analysis. The results found that 3491669 to 3603975 of KB742619.1 were significantly related to the duck egg shell phenotype (P)<10-6). Genetic-haplotype analysis is carried out on the region, and the genotype of 7 SNP loci is consistent with the genotype of a sequenced individual. To pairThe 7 SNP loci are subjected to experimental verification and population genotype amplification verification, the 1157 locus (G1157A) of the sequence shown by SEQ ID NO.1 or SEQ ID NO.2 is found to be a causative locus of the duck egg shell or white shell character, and the egg laying color of the duck can be judged by detecting the genotype of the locus.
1. Duck blood sample collection and DNA extraction
The Shaoxing duck used in the experiment was obtained from Wei poultry industry Co., Ltd, Cisco City.
After the color of eggs laid by 127 shaoxing ducks is recorded, 2mL of blood is collected from the veins of wings, the blood is put into a centrifuge tube containing EDTA (ethylene diamine tetraacetic acid, EDTA) anticoagulant, and the blood is gently shaken and stored at the temperature of minus 20 ℃.
Extracting duck blood genome DNA by using a phenol-chloroform extraction method, dissolving the duck blood genome DNA in sterile water, and storing the duck blood genome DNA at the temperature of minus 20 ℃ for later use.
2. Primer design and PCR amplification
2.1 primer design
Aiming at 1157 th base (G1157A) of duck genome sequence SEQ ID NO.1, designing PCR amplification primers by using biological software Primer-blast, wherein the amplification primers are as follows:
F：5’CTATGCATTCCCTGGTTGAC 3’
R：5’GAATCTTGGCTTACGCTCTG 3’
2.2PCR amplification
1) The PCR amplification system was 25 ul:
2) the PCR amplification conditions were:
pre-denaturation at 94 ℃ for 5 min;
denaturation at 94 ℃ for 30S, annealing at 65 ℃ for 30S, and extension at 72 ℃ for 1min for 30 cycles;
finally, extension is carried out for 5min at 72 ℃.
3) 5% of the PCR products were extracted and detected by electrophoresis on a 1.5% agarose gel. The obtained PCR product was sent to Shanghai Xiang Yin company for sequencing.
3. Genotype determination and correlation analysis of to-be-detected locus
When the sequencing result is checked by using chromas biological software, the genotype result of the 1157 th site of the sequence SEQ ID NO.1 or SEQ ID NO.2 is shown in figures 1-3, and if the site is homozygous, only one peak is shown: g peak or a peak (fig. 1, fig. 3); if the site is heterozygous, A, G doublets occur (FIG. 2). And comparing with the eggshell color record result, finding that the genotype AA and AG of the tested individual at the G1157A site show a blue shell phenotype, and the genotype GG shows a white shell phenotype.
Example 2 validation of genotype-phenotype associations at the G1157A site in different populations
Shaoxing ducks, Shanma Ma ducks and you county Ma ducks used for experiments are from Zhongji city national Wei poultry industry Co Ltd; beijing duck is from Zhangwang agricultural science and technology, Huzhou; the green-headed mallard comes from professional cooperative society of Fenghua Oji poultry industry.
Blood samples of 1328 individuals of the shaoxing duck, the wild duck, the Jinyun sheldrake, the Beijing duck, the Zhi county sheldrake and the green wild duck are collected, and the genotype analysis of the color molecular marker of the duck eggshell is performed by the method described in example 1.
And after the blood-sampled individual lays eggs, recording and counting the egg laying color of the blood-sampled individual. The correlation analysis results of the duck egg shell color molecular marker G1157A locus genotype and the egg shell color in different varieties are shown in Table 1. As can be seen from the table, the genotype at the G1157A locus is GG, and each population presents a white shell phenotype; the genotype at the G1157A site is A/-, and each population presents a blue-shell phenotype.
Therefore, the genotype of the 1157 site (G1157A) of the duck egg shell color molecular marker SEQ ID NO.1 or SEQ ID NO.2 can be used for accurately and quickly screening the breeding duck individuals with green shells or white shells as egg shells, and can be used as an effective molecular marker for the color of the duck egg shells. The correlation relationship between the genotype and the phenotype based on the molecular marker is consistent among 6 varieties of ducks, so that the molecular marker and the application thereof in eggshell color breeding can be popularized to other varieties of ducks, and a convenient, effective and rapid method and means are provided for breeding green-shell-egg or white-shell-egg ducks.
TABLE 1 Duck egg shell color molecular marker SEQ ID NO.1 or G1157A site of SEQ ID NO.2 genotype and egg shell color correlation analysis results in different populations
SEQUENCE LISTING
<110> Zhejiang province academy of agricultural sciences
<120> duck egg shell color related molecular marker and application thereof
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 1388
<212> DNA
<213> Artificial sequence
<400> 1
gcatacacag ccaagagggt ggagcagagg ctttaagctg ggacgttaga tgcttcaaac 60
tcttgcagct aactctgctt agtgacacca aagagcagat tctcttttca ggatttagaa 120
aagcattaga cattatggtg tgtgtttctc tgtgtgtccg tttctgtctt tctctcataa 180
atatgtttat taaaatactg ttgagccaag ttttataaaa agctttcaaa tgtatttttc 240
cattgtattt attatatata tatgtttttt aagtgaagaa ataaaagtag gatgtttagt 300
gcagttagca attaagcctg tgcaactgta ggatgttttc tttatacagc aatcatatat 360
tttgtttaac ctgcagtgtg tgcaaataaa agaagtctac agtggaatgt gcaggacttt 420
ccctttgtac agtctcattc catacagcgg tctggattct tagtcctgaa ttgtgcttgg 480
ggtccacatg tttcagaaga gactgaggca gaatagacta ccctgggcac agagtcgcag 540
atgttacttc tttcagcatc cccccccaac tatgcattcc ctggttgaca ctgagaaaac 600
ataatgaatg cataagacgc tacaataaat gaggtcccaa gcccttttgt atttatgtag 660
aggtcccaag tacatttggt tcatttcttt tctgccatgt atgcagatga ctgagctgta 720
attttccaga aacagaagct catacagtac aaactaaaca tgacttgaac tatcccaaac 780
tgtctttaac agctggaagt acttcaggat tcatctccag ccccagggga gttatgatgt 840
tgtaaaacaa gagctcagac tggcagttca ggctcaagta cctccatggt gctggagatg 900
gtgggagatc tgaatggaca gctatgagtg tgatcacatt atcacttact gttgcacttc 960
gcagtcttaa ggtcagttaa aaacaggttt tgatactcag gttttgggca cactgtggat 1020
acgtctgagg tcacttgtct gaggtttttc ctcggtgctc tcacttctgt tacacctttc 1080
tgtcaaattg cttttatttc atggctctga gcaacctggg tgtctctctg ctttttttcc 1140
attaacttct gccactagag gcaggagggg tgatgattct tcccaatgga ggactgagtt 1200
gaagaccagt tggcctgcgc tgcacagata gaagcagctc ttctcagctc ccgcattaga 1260
acagagacgt gggagcacct cagagggaca gacgggcaag agcagcagca gagcgtaagc 1320
caagattccc aggtatatgc tatttctatc cagctagtgg gagtgattaa tcttcaccat 1380
gtcctcac 1388
<210> 2
<211> 1388
<212> DNA
<213> Artificial sequence
<400> 2
gcatacacag ccaagagggt ggagcagagg ctttaagctg ggacgttaga tgcttcaaac 60
tcttgcagct aactctgctt agtgacacca aagagcagat tctcttttca ggatttagaa 120
aagcattaga cattatggtg tgtgtttctc tgtgtgtccg tttctgtctt tctctcataa 180
atatgtttat taaaatactg ttgagccaag ttttataaaa agctttcaaa tgtatttttc 240
cattgtattt attatatata tatgtttttt aagtgaagaa ataaaagtag gatgtttagt 300
gcagttagca attaagcctg tgcaactgta ggatgttttc tttatacagc aatcatatat 360
tttgtttaac ctgcagtgtg tgcaaataaa agaagtctac agtggaatgt gcaggacttt 420
ccctttgtac agtctcattc catacagcgg tctggattct tagtcctgaa ttgtgcttgg 480
ggtccacatg tttcagaaga gactgaggca gaatagacta ccctgggcac agagtcgcag 540
atgttacttc tttcagcatc cccccccaac tatgcattcc ctggttgaca ctgagaaaac 600
ataatgaatg cataagacgc tacaataaat gaggtcccaa gcccttttgt atttatgtag 660
aggtcccaag tacatttggt tcatttcttt tctgccatgt atgcagatga ctgagctgta 720
attttccaga aacagaagct catacagtac aaactaaaca tgacttgaac tatcccaaac 780
tgtctttaac agctggaagt acttcaggat tcatctccag ccccagggga gttatgatgt 840
tgtaaaacaa gagctcagac tggcagttca ggctcaagta cctccatggt gctggagatg 900
gtgggagatc tgaatggaca gctatgagtg tgatcacatt atcacttact gttgcacttc 960
gcagtcttaa ggtcagttaa aaacaggttt tgatactcag gttttgggca cactgtggat 1020
acgtctgagg tcacttgtct gaggtttttc ctcggtgctc tcacttctgt tacacctttc 1080
tgtcaaattg cttttatttc atggctctga gcaacctggg tgtctctctg ctttttttcc 1140
attaacttct gccactggag gcaggagggg tgatgattct tcccaatgga ggactgagtt 1200
gaagaccagt tggcctgcgc tgcacagata gaagcagctc ttctcagctc ccgcattaga 1260
acagagacgt gggagcacct cagagggaca gacgggcaag agcagcagca gagcgtaagc 1320
caagattccc aggtatatgc tatttctatc cagctagtgg gagtgattaa tcttcaccat 1380
gtcctcac 1388
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
ctatgcattc cctggttgac 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
gaatcttggc ttacgctctg 20
Claims (6)
1. A molecular marker related to the color traits of duck egg shells is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID No.1 or SEQ ID No.2, the genotype at the 1157 th site of SEQ ID No.1 or SEQ ID No.2 is AA and AG which presents a blue-shell phenotype, and the genotype is GG which presents a white-shell phenotype; the duck eggs are selected from Shaoxing duck, Shanma duck, Jinyun duck, Beijing duck, Zhixian duck, or green wild duck.
2. A group of primers for predicting or detecting the color of the eggshell of a duck egg, which is characterized in that the nucleotide sequence of the primers is shown as SEQ ID NO.3 and SEQ ID NO. 4; the primer is used for amplifying a nucleotide sequence shown by SEQ ID NO.1 or SEQ ID NO.2, the genotype at the 1157 th site of the SEQ ID NO.1 or SEQ ID NO.2 is AA and AG which presents a blue-shell phenotype, and the genotype at GG presents a white-shell phenotype; the duck eggs are selected from Shaoxing duck, Shanma duck, Jinyun duck, Beijing duck, Zhixian duck, or green wild duck.
3. A method for predicting or detecting the color of the eggshell of a duck egg, which is characterized by comprising the following steps:
1) extracting duck genome DNA as a template;
2) designing a primer aiming at the 1157 site of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and carrying out PCR amplification;
3) detecting the genotype of 1157 site of the sequence shown in SEQ ID NO.1 or SEQ ID NO. 2; if the genotype is AA or AG, the duck egg shell presents a green shell phenotype, and if the genotype is GG, the duck egg shell presents a white shell phenotype;
the duck eggs are selected from Shaoxing duck, Shanma duck, Jinyun duck, Beijing duck, Zhixian duck, or green wild duck.
4. The method of claim 3, wherein the PCR amplification in step 2) is performed using the primers of claim 2.
5. The method of claim 4, wherein the PCR amplification conditions of step 2) are: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 1min for 30 cycles; finally, extension is carried out for 5min at 72 ℃.
6. The use of the primer of claim 2 in predicting or detecting the color of the eggshell of a duck egg; the duck eggs are selected from Shaoxing duck, Shanma duck, Jinyun duck, Beijing duck, Zhixian duck and green wild duck.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810875930.XA CN110791569B (en) | 2018-08-03 | 2018-08-03 | Duck egg shell color related molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810875930.XA CN110791569B (en) | 2018-08-03 | 2018-08-03 | Duck egg shell color related molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110791569A CN110791569A (en) | 2020-02-14 |
| CN110791569B true CN110791569B (en) | 2022-05-10 |
Family
ID=69426203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810875930.XA Active CN110791569B (en) | 2018-08-03 | 2018-08-03 | Duck egg shell color related molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791569B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111705139B (en) * | 2020-06-11 | 2022-09-16 | 广西大学 | Screening method and application of Nandan Yao egg shell color association SNP molecular marker |
| CN114045346B (en) * | 2021-11-04 | 2023-09-01 | 中国农业大学 | Method for predicting eggshell color and special SNP locus thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2008261604A1 (en) * | 2007-06-13 | 2008-12-18 | Australian Poultry Crc Pty Ltd | Modulating production traits in avians |
| CN101935653A (en) * | 2010-06-23 | 2011-01-05 | 中国农业大学 | Method for assisting identification of hens laying green-shelled eggs and special primer pair thereof |
| CN104273094A (en) * | 2014-09-26 | 2015-01-14 | 中国农业大学 | Method for breeding pink-shell egg chicken leather color auto-sexing commercial line |
| CN106701919A (en) * | 2016-11-25 | 2017-05-24 | 浙江省农业科学院 | Molecular genetic maker for egg quality of laying hen and application of molecular genetic marker |
-
2018
- 2018-08-03 CN CN201810875930.XA patent/CN110791569B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2008261604A1 (en) * | 2007-06-13 | 2008-12-18 | Australian Poultry Crc Pty Ltd | Modulating production traits in avians |
| CN101935653A (en) * | 2010-06-23 | 2011-01-05 | 中国农业大学 | Method for assisting identification of hens laying green-shelled eggs and special primer pair thereof |
| CN104273094A (en) * | 2014-09-26 | 2015-01-14 | 中国农业大学 | Method for breeding pink-shell egg chicken leather color auto-sexing commercial line |
| CN106701919A (en) * | 2016-11-25 | 2017-05-24 | 浙江省农业科学院 | Molecular genetic maker for egg quality of laying hen and application of molecular genetic marker |
Non-Patent Citations (4)
| Title |
|---|
| ACCESSION No.: KB742619.1 Anas platyrhynchos breed Pekin duck unplaced genomic scaffold scaffold229, whole genome shotgun sequence;Li,N.;《GenBank Database》;20150321;"Location/Qualifiers source"部分 * |
| Study of formation of green eggshell color in ducks through global gene expression;Fa Qiong Xu等;《PLoS One》;20180129;第13卷(第1期);第1-19页 * |
| 微卫星标记AY493302与缙云麻鸭;袁青妍等;《中国农学通报》;20100420;第26卷(第8期);第12-16页 * |
| 鸭蛋壳颜色与强度的关系及其候选基因分析研究;梁素芸;《中国优秀博硕士学位论文全文数据库(硕士)农业科技辑》;20180515(第05期);D050-87 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110791569A (en) | 2020-02-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117665B (en) | SNP molecular marker located on pig No. 16 chromosome and related to pig lean meat percentage and eye muscle area and application | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN108220408B (en) | Grain-saving green-shin recessive white feather broiler new strain breeding method | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN110106255B (en) | Molecular marker located on pig No. 7 chromosome and related to Duroc pig daily gain trait and application | |
| CN107227373B (en) | SNP functional molecular marker of japonica rice lodging-resistant gene and application | |
| CN112159858B (en) | Molecular marker closely linked with purple cauliflower gene and application thereof | |
| CN110791569B (en) | Duck egg shell color related molecular marker and application thereof | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN113430285B (en) | Molecular marker related to Muscovy duck breeding traits and application | |
| CN111575350B (en) | Screening method and application of SNP molecular markers related to concentrated egg white height and yolk color of Nandan Yao chicken eggs | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN110699465B (en) | Molecular marker for rapidly improving green shell rate of duck group and application | |
| CN110551829B (en) | SNP molecular marker related to color depth of eggshell of chicken eggshell powder and application thereof | |
| CN108250285B (en) | Haplotype marker related to rapid growth of largemouth bass and application thereof | |
| CN114317780B (en) | SNP molecular marker related to chicken prematurity and application | |
| CN111705146B (en) | Molecular marker for identifying duck jute feather character and application thereof | |
| CN110373489B (en) | KASP marker related to wheat grain protein content and application thereof | |
| CN109439764B (en) | Molecular marker for identifying native-like eggs and native eggs and application | |
| CN111826449A (en) | Method for obtaining molecular marker related to gynogenesis bighead malformation character and application thereof | |
| CN111850139B (en) | Molecular marker located on pig chromosome 12 and related to formation of pig monocrchidism and application | |
| CN113430283B (en) | Application of chicken BMP15 gene as chicken testicular character molecular marker | |
| CN117904328B (en) | Structural variation molecular marker primer related to pigeon pale feather character and application thereof | |
| CN113308557B (en) | Molecular marker related to duck phoenix head characters and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |