CN110791462A - Bacillus subtilis and application thereof in fermentation production of adenosine - Google Patents
Bacillus subtilis and application thereof in fermentation production of adenosine Download PDFInfo
- Publication number
- CN110791462A CN110791462A CN201911291412.4A CN201911291412A CN110791462A CN 110791462 A CN110791462 A CN 110791462A CN 201911291412 A CN201911291412 A CN 201911291412A CN 110791462 A CN110791462 A CN 110791462A
- Authority
- CN
- China
- Prior art keywords
- bacillus subtilis
- fermentation
- aca301
- adenosine
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
- C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/38—Nucleosides
- C12P19/40—Nucleosides having a condensed ring system containing a six-membered ring having two nitrogen atoms in the same ring, e.g. purine nucleosides
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Bacillus subtilis and application thereof in fermentation production of adenosine, wherein the bacillus subtilis is bacillus subtilis (Bacillus subtilis: (B))Bacillus subtilis) The ACA301, the Bacillus subtilis ACA301 is preserved in China general microbiological culture Collection center with the strain preservation number of CGMCC No. 16753. The bacillus subtilis ACA301 has the advantages that the strain stability is greatly improved, the breakthrough progress is achieved in the technology, the yield and the conversion rate are relatively high, the advancement is remarkable, the fermentation raw materials are easy to obtain, the culture conditions are extensive, the control process is simple, the bacillus subtilis ACA301 is suitable for industrial production, and the industrial application prospect is good.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to bacillus subtilis and application thereof in adenosine fermentation production.
Background
Adenosine (Adenosine), chemical name 6-amino-9- β -D-ribofuranosyl-9-hydrogen purine, belongs to important nucleotide derivatives, is a dephosphorylated product of adenine nucleotide, can directly enter cardiac muscle as endogenous nucleoside distributed in human cells, can be phosphorylated to generate adenylic acid, and participates in cardiac muscle energy metabolism.
Adenosine, an important nucleotide derivative, attracts a large number of researchers at home and abroad to invest in the research of adenosine fermentation production technology. At present, adenosine fermentation strains have high requirements on raw materials, culture conditions and control processes, the strains have poor stability, the fermentation yield and the conversion rate are relatively in a low level, the raw materials and energy consumption are high, the production cost is high, few adenosine manufacturers at home and abroad are caused, and the produced adenosine cannot meet the market demand. The raw materials of China are rich, the market is huge, and the requirement on adenosine is necessarily greater and greater, so that the improvement of the production capacity and the level of the adenosine play an important role in the national economic development of China.
Disclosure of Invention
The invention aims to provide a bacillus subtilis and application thereof in producing adenosine through fermentation.
In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: the Bacillus subtilis ACA301 is the Bacillus subtilis ACA301, and the Bacillus subtilis ACA301 is preserved in China general microbiological culture collection center with the culture preservation number of CGMCC No. 16753.
In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: the application of the bacillus subtilis ACA301 in the production of adenosine by fermentation.
In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a method for producing adenosine by fermenting Bacillus subtilis ACA301 comprises the following steps:
step 1: strain culture
Inoculating the bacillus subtilis ACA301 strain into a sterile activation culture medium, and culturing at 28-40 ℃ for 18-24 hours until fresh thalli grow out to obtain the activated bacillus subtilis ACA301 strain; then inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing until logarithmic phase;
step 2: inoculating the strain in the logarithmic phase prepared in the step 1 into a fermentation culture medium for fermentation culture, and finishing the culture after 30-72 hours to obtain adenosine fermentation liquor;
and step 3: and (2) filtering the adenosine fermentation liquor obtained in the step (2) by adopting a micro-membrane to obtain thalli and microfiltration clear liquid, filtering the thalli by using a plate frame to obtain thalli protein, passing the microfiltration clear liquid through an ultrafiltration system to obtain ultrafiltration clear liquid, then carrying out decolorization treatment on the ultrafiltration clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, filtering or carrying out centrifugal separation to remove mother liquor to obtain an adenosine crude product, redissolving the adenosine crude product, carrying out decolorization treatment, then carrying out recrystallization, and drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product.
The preferable technical scheme is as follows: the sterile activation medium per liter comprises 1-10 g of glucose, 2-20 g of peptone, 2-20 g of beef extract, 2-20 g of yeast extract powder, 5-30 g of corn steep liquor, 1-10 g of sodium chloride, 5-50 g of agar and 1 part of trace elements.
The preferable technical scheme is as follows: each liter of the seed culture medium comprises 1-20 g of glucose, 1-30 g of corn steep liquor, 0.1-10 g of yeast powder, 0.01-1 g of magnesium sulfate, 0.01-5 g of monopotassium phosphate and 1 part of trace elements.
The preferable technical scheme is as follows: each liter of the fermentation medium comprises 5-50 g of glucose, 1-40 g of corn steep liquor, 0.1-20 g of yeast extract powder, 0.1-5 g of dipotassium hydrogen phosphate, 0.01-2 g of magnesium sulfate, 0.01-3 g of ammonium sulfate and 1 part of trace elements.
The preferable technical scheme is as follows: inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing, wherein the culture conditions of the strain when the strain is cultured to a logarithmic growth phase are as follows: the temperature is 28-40 ℃, the pH value is 6.5-7.5, the dissolved oxygen is more than or equal to 10%, and the tank pressure of the fermentation tank is 0.02-0.05 MPa.
The preferable technical scheme is as follows: the fermentation culture control conditions of the step 2 are as follows: the temperature is 28-40 ℃, the pH value is 6.5-7.5, the dissolved oxygen is not less than 10%, the tank pressure of a fermentation tank is 0.02-0.10 MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.05-5.0%.
The preferable technical scheme is as follows: in the step 3, the equipment for micro-membrane filtration is a ceramic membrane, an organic membrane or a metal membrane, and the aperture is 8 nm-100 nm; the molecular weight cut-off of the ultrafiltration system is 800-5000D; decolorizing the ultrafiltered clear liquid with activated carbon, resin or nano-filtration; the evaporation concentration crystallization adopts a multi-effect evaporation crystallizer, the concentration vacuum degree is-0.05 to-0.09 MPa, the evaporation temperature is 50 to 85 ℃, and the concentration ratio is 3 to 8 times; the equipment for cooling crystallization is a cold crystallizer, a step cooling control mode is adopted, the lowest temperature is 0-10 ℃, and a plate-frame filter or a centrifuge can be used for removing the mother liquor after cooling crystallization; and removing the mother liquor by using a plate and frame filter or a centrifuge after recrystallization.
The preferable technical scheme is as follows: the microelements comprise iron, magnesium, zinc, copper, manganese, sodium and potassium.
The preferable technical scheme is as follows: 1 part of trace element means that each liter of the sterile activation culture medium contains 0.5-1.5g of trace element; each liter of the seed culture medium contains 0.5-1.5g of trace elements; each liter of the fermentation medium contains 0.5-1.5g of trace elements.
Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:
1. the bacillus subtilis ACA301 which is preserved in China general microbiological culture collection center with the preservation number of CGMCC No.16753 in the application is obtained by screening the bacillus subtilis CICC10082 through modification processes such as mutation breeding and the like. The strain has unique physiological and biochemical characteristics and can be researched and applied in the fields of scientific research, industry and the like.
2. The bacillus subtilis ACA301 has the advantages that the strain stability is greatly improved, the breakthrough progress is achieved in the technology, the yield and the conversion rate are relatively high, the advancement is remarkable, the fermentation raw materials are easy to obtain, the culture conditions are extensive, the control process is simple, the bacillus subtilis ACA301 is suitable for industrial production, and the industrial application prospect is good.
Detailed Description
The following description of the embodiments of the present invention is provided for illustrative purposes, and other advantages and effects of the present invention will become apparent to those skilled in the art from the present disclosure.
Preservation of biological materials: the Bacillus subtilis ACA301 is classified and named as Bacillus subtilis and is preserved in China general microbiological culture Collection center (CGMCC), the preservation time is 11 months and 19 days in 2018, the strain preservation number is CGMCC No.16753, and the preservation address is the microbial research institute of China academy of sciences No. 3 of West Lu No.1 Beijing Korean district, Beijing city.
Example 1: bacillus subtilis and application thereof in fermentation production of adenosine
A Bacillus subtilis ACA301 is classified and named as Bacillus subtilis and is preserved in China general microbiological culture collection center (CGMCC) for 11 and 19 days in 2018, and the strain preservation number is CGMCC No. 16753.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation comprise the following steps:
(1) and (3) strain culture, namely inoculating the preserved bacillus subtilis ACA301 strain into a sterile activated culture medium, culturing at 34 ℃ for 21 hours until fresh thalli grow out, sterilizing the seed culture medium, cooling to 40 ℃, adjusting the pH to 7, inoculating the activated bacillus subtilis ACA301 strain into the seed culture medium, and culturing until the logarithmic phase. And (3) strain culture conditions: the temperature is 34 ℃, the pH value is 7, the dissolved oxygen is 12 percent, and the tank pressure is 0.035 MPa.
(2) And (2) performing fermentation culture, namely sterilizing a fermentation culture medium, cooling to 40 ℃, adjusting the pH to 7, inoculating the strain in the logarithmic phase prepared in the step (1) into the fermentation culture medium for fermentation culture, and finishing the culture until 46 hours to obtain adenosine fermentation liquor. Fermentation culture control conditions: the temperature is 34 ℃, the pH value is 7, the dissolved oxygen is 11 percent, the tank pressure is 0.06MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.25 percent.
(3) And (3) extracting and purifying, namely sequentially filtering the adenosine fermentation liquor obtained in the step (2) by virtue of a micro-membrane to remove thalli to obtain micro-filtered clear liquid, filtering the thalli by virtue of a plate frame to obtain mycoprotein, removing impurities such as protein and the like from the micro-filtered clear liquid by virtue of an ultrafiltration system to obtain ultra-filtered clear liquid, carrying out decolorization treatment on the ultra-filtered clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, further filtering or carrying out centrifugal separation to remove mother liquor to obtain crude adenosine, redissolving the crude adenosine, carrying out decolorization treatment by virtue of activated carbon or nanofiltration, then carrying out recrystallization, drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product, and adding the mother liquor.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation are characterized in that a strain activation culture medium comprises 5.5g/L of glucose, 11g/L of peptone, 11g/L of beef extract, 11g/L of yeast extract powder, 17.5g/L of corn steep liquor, 5.5g/L of sodium chloride, 27.5g/L of agar and 1 part of trace elements. The trace elements are a mixture of zinc, copper, manganese, sodium and potassium in equal proportion. The trace element 1 part is that each liter of the sterile activation culture medium contains 1g of the trace element.
Wherein the culture medium for culturing the strain comprises 11.5g/L of glucose, 15.5g/L of corn steep liquor, 5.05g/L of yeast powder, 0.55g/L of magnesium sulfate, 2.55g/L of potassium dihydrogen phosphate and 1 part of trace elements. The trace elements are iron and magnesium according to the proportion of 1: 1 in a mass ratio. 1 part of trace element means 1 g.
The bacillus subtilis ACA301 and the application thereof in the fermentation production of adenosine, wherein a culture medium for fermentation culture comprises 27.5g/L of glucose, 20.5g/L of corn steep liquor, 10.5g/L of yeast extract powder, 2.55g/L of dipotassium hydrogen phosphate, 1.05g/L of magnesium sulfate, 1.55g/L of ammonium sulfate and 1 part of trace elements. The microelement is iron.
The trace element 1 part is that each liter of the fermentation medium contains 1g of the trace element.
The bacillus subtilis ACA301 and the application thereof in the fermentation production of adenosine are characterized in that a micro-membrane filtration device is a ceramic membrane, an organic membrane or a metal membrane, the aperture is 50nm, the intercepted molecular weight of an ultrafiltration system is 3000D, a decolorization system is activated carbon decolorization or resin decolorization or nanofiltration decolorization, an evaporation concentration crystallization device is a multi-effect evaporation crystallizer, the concentration vacuum degree is-0.07 MPa, the evaporation temperature is 67 ℃, the concentration ratio is 5 times, a cooling crystallization device is a cold crystallizer, a stepped cooling control mode is adopted, the lowest temperature is 5 ℃, a plate-frame centrifuge or a nanofiltration centrifuge can be used for removing mother liquor after cooling crystallization, the adenosine crude product can be dissolved and then be decolorized by activated carbon or nanofiltration, and the mother liquor can be removed by the plate-frame filter or the centrifuge after.
The culture is carried out in the way, a 30L fermentation tank is adopted for culture, the fermentation culture is carried out for 60 hours, the adenosine production is 55.48g/L, and the conversion rate is 20.95%. Extracting and purifying to obtain adenosine crystal 748.9.
The conversion rate is calculated by the formula (fermentation liquor volume L multiplied by fermentation yield g/L)/total sugar consumption g multiplied by 100%.
Example 2: bacillus subtilis and application thereof in fermentation production of adenosine
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation comprise the following steps:
(1) and (2) strain culture, namely inoculating the preserved bacillus subtilis ACA301 strain into a sterile activation culture medium, culturing at 28 ℃ for 18 hours until fresh thalli grow out, sterilizing the seed culture medium, cooling to 40 ℃, adjusting the pH to 6.5, inoculating the activated bacillus subtilis ACA301 strain into the seed culture medium, and culturing until the logarithmic phase. And (3) strain culture conditions: the temperature is 28 ℃, the pH value is 6.5, the dissolved oxygen is 10 percent, and the tank pressure is 0.02 MPa.
(2) And (2) performing fermentation culture, namely sterilizing a fermentation culture medium, cooling to 40 ℃, adjusting the pH to 6.5, inoculating the strain in the logarithmic phase prepared in the step (1) into the fermentation culture medium for fermentation culture, and culturing for 30 hours to obtain adenosine fermentation liquor. Fermentation culture control conditions: the temperature is 28 ℃, the pH value is 6.5, the dissolved oxygen is 10 percent, the tank pressure is 0.02MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.05 percent.
(3) And (3) extracting and purifying, namely sequentially filtering the adenosine fermentation liquor obtained in the step (2) by virtue of a micro-membrane to remove thalli to obtain micro-filtered clear liquid, filtering the thalli by virtue of a plate frame to obtain mycoprotein, removing impurities such as protein and the like from the micro-filtered clear liquid by virtue of an ultrafiltration system to obtain ultra-filtered clear liquid, carrying out decolorization treatment on the ultra-filtered clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, further filtering or carrying out centrifugal separation to remove mother liquor to obtain crude adenosine, redissolving the crude adenosine, carrying out decolorization treatment by virtue of activated carbon or nanofiltration, then carrying out recrystallization, drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product, and adding the mother liquor.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation are characterized in that a strain activation culture medium comprises 1g/L of glucose, 2g/L of peptone, 2g/L of beef extract, 2g/L of yeast extract, 5g/L of corn steep liquor, 1g/L of sodium chloride, 5g/L of agar and 1 part of trace elements. The trace elements are sodium and potassium according to a ratio of 1: 2 in mass ratio.
The preferable technical scheme is as follows: the trace element 1 part is that each liter of the sterile activation culture medium contains 0.5g of the trace element.
Wherein the culture medium for culturing the strain comprises 1g/L glucose, 1g/L corn steep liquor, 0.1g/L yeast powder, 0.01g/L magnesium sulfate, 0.01g/L potassium dihydrogen phosphate and 1 part of trace elements. The trace element is magnesium. The seed culture medium contains 0.5g of trace elements per liter.
The bacillus subtilis ACA301 and the application thereof in the fermentation production of adenosine, wherein a culture medium for fermentation culture comprises 5g/L of glucose, 1g/L of corn steep liquor, 0.1g/L of yeast extract powder, 0.1g/L of dipotassium hydrogen phosphate, 0.01g/L of magnesium sulfate, 0.01g/L of ammonium sulfate and 1 part of trace elements. The trace element is zinc. The fermentation medium contained 1.5g of trace elements per liter.
The bacillus subtilis ACA301 and the application thereof in the fermentation production of adenosine are characterized in that a micro-membrane filtration device is a ceramic membrane, an organic membrane or a metal membrane, the aperture is 8nm, the intercepted molecular weight of an ultrafiltration system is 800D, a decolorization system is activated carbon decolorization or resin decolorization or nanofiltration decolorization, an evaporation concentration crystallization device is a multi-effect evaporation crystallizer, the concentration vacuum degree is-0.05 MPa, the evaporation temperature is 50 ℃, the concentration ratio is 3 times, a cooling crystallization device is a cold crystallizer, a stepped cooling control mode is adopted, the lowest temperature is 0 ℃, a mother solution can be removed by using a plate-and-frame filter or a centrifuge after cooling crystallization, the adenosine crude product can be dissolved and then decolorized by using activated carbon or nanofiltration, and the mother solution can be removed by using the plate-and-frame filter or.
By adopting the mode, a 50-ton fermentation tank is adopted for culture, the fermentation culture is carried out for 66 hours, the adenosine production is 46.75g/L, and the conversion rate is 20.17%. After extraction and purification, 1.32 tons of adenosine crystals are obtained, and the quality of the product is detected to meet the standard of 'Chinese pharmacopoeia' 2015 edition.
The conversion rate is calculated by the formula (fermentation liquor volume L multiplied by fermentation yield g/L)/total sugar consumption g multiplied by 100%.
Example 3: bacillus subtilis and application thereof in fermentation production of adenosine
The mutagenesis screening method of the bacillus subtilis ACA301 comprises the following steps:
bacillus subtilis CICC10082 is taken as a starting bacterium, and is subjected to multiple times of chemical mutagenesis and ultraviolet mutagenesis by diethyl sulfate (DES), and then is separated, purified and screened to obtain the adenosine high-yield strain with substrate resistance and genetic markers.
Spawn running: bacillus subtilis CICC10082
Starting bacterium characteristics: g +, irregular thallus and movement. The colony is round, smooth in surface, low in convexity, notched in edge, grey white and translucent. The liquid culture was turbid. And (5) liquefying the gelatin. V.P positive, M.R. positive, H2S positive, urease negative, catalase positive and aerobic. The optimum growth temperature is 28-32 ℃, the maximum growth temperature is 50 ℃, the litmus milk reaction is alkali-producing and peptonizing, and nitrate is utilized.
DES mutagenesis treatment method: inoculating a ring of bacillus subtilis from a fresh inclined plane into a30 mL/500mL conical flask of a seed culture medium, and culturing at 30-32 ℃ and 160r/min for 12-18 h; centrifuging and settling for 10min (3000r/min), collecting thalli cells, washing with sterile normal saline for three times, washing with 0.1mol/L phosphate buffer solution with the pH value of 7.0-7.2 for one time, suspending the scattered thalli cell suspension in 30mL of 0.1mol/L phosphate buffer solution (pH value of 7.0-7.2) containing 0.5-2.0 mL of diethyl sulfate (DES), and shaking at the temperature of 32 ℃ for 0.25-1 h; after the reaction, the reaction is stopped by sodium thiosulfate solution, the thalli cells are collected by centrifugation, washed by sterile normal saline, inoculated into a culture medium and cultured for 24 hours, and single colony is separated and screened.
The ultraviolet mutation treatment method comprises the following steps: inoculating the strain growing on the slant culture medium for 20h into a seed culture medium, culturing for 16-18 h, washing with 0.1mol/L phosphate buffer solution with pH of 7.0-7.2 for three times, and diluting to 10%8-9Perml cell, make into bacterial suspension. Absorbing 5ml of single cell suspension, placing the single cell suspension in a culture dish subjected to dry heat sterilization treatment in advance, placing a rotor subjected to sterilization in advance in the culture dish, irradiating the single cell suspension by using a 15-watt ultraviolet lamp, wherein the irradiation distance is 30cm, and the irradiation time is 0s, 5s, 10s, 15s, 20s, 25s and 30s respectively, properly diluting the single cell suspension, coating the single cell suspension on a flat plate, culturing the single cell suspension at a constant temperature of 32 ℃ for 72 hours, calculating the lethality rate of different irradiation times, drawing a lethality curve by using the irradiation time as a horizontal coordinate and the lethality rate as a vertical coordinate, selecting the irradiation time with the lethality rate of 70% -80% according to the lethality rate curve, performing ultraviolet mutagenesis for multiple times, and separating the mutagenized.
The screening method of the adenine deaminase negative strain comprises the following steps: according to the guidance of the metabolic engineering theory, the synthesized adenosine can be accumulated in large quantity by blocking AMP → IMP metabolic pathway, namely, mutant strains lacking adenine deaminase are bred. Adenine deaminase can remove the toxic action of 8-azaguanine on strains, 8-azaguanine (8-AG) with the concentration of 50mg/L is added into a culture medium, and mutant strains which cannot grow on the culture medium are screened, so that the strains with the negative genetic property of adenine deaminase are obtained.
The screening method of the resistant mutant strain comprises the following steps: preparing a basic culture medium, adding a proper amount of structural analogs (8-azaguanine, 8-azaxanthine, 5-fluorouracil, 5-bromouracil, 6-chloropurine, 6-mercaptopurine and sulfaguanidine) after sterilization to ensure that the concentrations of the structural analogs in the plate are respectively 5mg/L, 10mg/L, 15mg/L and 20mg/L, coating a proper amount of bacterial suspension of mutagenic bacteria on each structural analog plate with different concentrations, observing the growth condition, and determining the concentration of the structural analogs for screening according to the concentration of the structural analogs endured by the mutagenic bacteria. And (3) coating the mutagenized bacterial liquid on a screening plate with the concentration determined by the method, culturing the bacterial liquid in an incubator at 32 ℃ for 2-3 days, and randomly selecting growing colonies for shake flask screening.
Inoculating the obtained high-yield adenosine mutant strain containing the resistance marker into a 250mL triangular flask filled with 30mL of seed culture medium, carrying out shake culture at 32 ℃ for 24h, then inoculating the seed solution into a 250mL triangular flask filled with 50mL of fermentation culture medium with the inoculation amount of 20%, carrying out shake culture at 32 ℃ for 36-48 h, and screening out the strain with high yield.
The adenosine fermentation performance of the spawn-producing and mutant strain ACA301 is examined on the shake flask level, and the result is shown in Table 1. As can be seen from Table 1, the adenosine production rate and the conversion rate of the mutant strain were much higher.
Table 1 shows a comparison of the properties of the fermented adenosines of the starter and mutant strains
| Bacterial number | Adenosine yield (g/L) | Conversion (%) |
| Tricholoma orientale CICC10082 | 0 | 0 |
| Mutant strain ACA301 | 15.48 | 13.4 |
Genetic stability test: and (3) carrying out single colony separation on the adenosine high-yield strains obtained by screening, carrying out continuous shake flask subculture for 10 generations, carrying out seed culture on each generation of strains, and carrying out a genetic marker experiment and a fermentation yield experiment. Shake flask passaging method: the adenosine high-producing strain is transferred from a slant into a shake flask, and is transferred to the next generation shake flask after being cultured until the logarithmic growth phase.
Each strain of 10 serial passages was cultured in a 30L fermenter, and the genetic stability of the strain was examined by measuring the adenosine production at the end of fermentation. The results are shown in table 2:
TABLE 2 genetic stability of the Strain ACA301
| Number of passages | Adenosine yield (g/L) |
| 1 | 52.1 |
| 2 | 53.4 |
| 3 | 49.8 |
| 4 | 50.2 |
| 5 | 51.9 |
| 6 | 52.6 |
| 7 | 50.5 |
| 8 | 53.5 |
| 9 | 52.3 |
| 10 | 51.8 |
As can be seen from Table 2, the genetic stability of the mutant strain ACA301 is good, the adenosine yield after 10 continuous passages and 30L fermentation tank culture is basically stabilized at about 50g/L, the adenosine fermentation production technology level is greatly improved, and the method is more suitable for industrial production.
The strain is subjected to subculture, named as bacillus subtilis ACA301, is preserved in China general microbiological culture Collection center (CGMCC), is classified and named as bacillus subtilis, has the preservation time of 2018, 11 months and 19 days, has the strain preservation number of CGMCC No.16753, and has the preservation address of China academy of sciences, namely institute of microbiology 3, Nacio West Lu No.1 of the Nacio district, Beijing City.
The research institute of microorganisms of Chinese academy of sciences carries out detection and identification on items such as the cell morphology, the physiological and biochemical characteristics, the 16SrRNA gene sequence (the gene sequence is shown as SEQ NO. 1), the gyrB gene sequence (the gene sequence is shown as SEQ NO. 2) and the like of the Bacillus subtilis ACA301, the number of a detection and identification report (2018) is No. 476, and through comprehensive analysis of detection and identification experimental data, reference is made to Bergey's Manual of bacteria of the system and the International Journal of systematic evolution Microbiology related research papers, and the identification result of the strain number ACA301 is Bacillus subtilis.
The invention relates to a bacillus subtilis ACA301 and application thereof in producing adenosine by fermentation, which comprises the following steps:
(1) and (2) strain culture, namely inoculating the preserved bacillus subtilis ACA301 strain into a sterile activated culture medium, culturing at 28-40 ℃ for 18-24 hours until fresh thalli grow out, sterilizing the seed culture medium, cooling to about 40 ℃, adjusting the pH to 6.5-7.5, inoculating the activated bacillus subtilis ACA301 strain into the seed culture medium, and culturing until the logarithmic growth phase. And (3) strain culture conditions: the temperature is 28-40 ℃, the pH value is about 6.5-7.5, the dissolved oxygen is more than or equal to 10%, and the tank pressure is 0.02-0.05 MPa.
(2) And (2) performing fermentation culture, namely sterilizing the fermentation culture medium, cooling to about 40 ℃, adjusting the pH to 6.5-7.5, inoculating the strain in the logarithmic phase prepared in the step (1) into the fermentation culture medium for fermentation culture, and finishing the culture after 30-72 hours to obtain adenosine fermentation liquor. Fermentation culture control conditions: the temperature is 28-40 ℃, the pH value is 6.5-7.5, the dissolved oxygen is more than or equal to 10%, the tank pressure is 0.02-0.10 MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.05-5.0%.
(3) And (3) extracting and purifying, namely sequentially filtering the adenosine fermentation liquor obtained in the step (2) by virtue of a micro-membrane to remove thalli to obtain micro-filtered clear liquid, filtering the thalli by virtue of a plate frame to obtain mycoprotein, removing impurities such as protein and the like from the micro-filtered clear liquid by virtue of an ultrafiltration system to obtain ultra-filtered clear liquid, carrying out decolorization treatment on the ultra-filtered clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, further filtering or carrying out centrifugal separation to remove mother liquor to obtain crude adenosine, redissolving the crude adenosine, carrying out decolorization treatment by virtue of activated carbon or nanofiltration, then carrying out recrystallization, drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product, and adding the mother liquor.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation are characterized in that a strain activation culture medium comprises 1-10 g/L of glucose, 2-20 g/L of peptone, 2-20 g/L of beef extract, 2-20 g/L of yeast extract powder, 5-30 g/L of corn steep liquor, 1-10 g/L of sodium chloride, 5-50 g/L of agar and 1 part of trace elements; wherein the culture medium for strain culture comprises 1-20 g/L glucose, 1-30 g/L corn steep liquor, 0.1-10 g/L yeast powder, 0.01-1 g/L magnesium sulfate, 0.01-5 g/L potassium dihydrogen phosphate and 1 part of trace elements. The trace elements are iron, zinc and copper according to the proportion of 1: 1: 3 in a mass ratio. The trace element 1 part is that each liter of the sterile activation culture medium contains 1.5g of the trace element.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation are characterized in that a culture medium for fermentation culture comprises 5-50 g/L of glucose, 1-40 g/L of corn steep liquor, 0.1-20 g/L of yeast extract powder, 0.1-5 g/L of dipotassium hydrogen phosphate, 0.01-2 g/L of magnesium sulfate, 0.01-3 g/L of ammonium sulfate and 1 part of trace elements.
The bacillus subtilis ACA301 and the application thereof in the production of adenosine by fermentation have the advantages that the strain stability is greatly improved, breakthrough progress is achieved, the yield and the conversion rate are relatively high, the progress is remarkable, the raw materials of the fermentation formula are simple and easy to obtain, and the process control is simple. Through the production of a 50-ton fermentation tank, the production technology level is stable, and the product quality reaches the standard of 'Chinese pharmacopoeia' 2015 edition. The technology of the invention is suitable for industrial production and popularization, and has obvious advancement and good application prospect.
Example 4: bacillus subtilis and application thereof in fermentation production of adenosine
The Bacillus subtilis ACA301 is the Bacillus subtilis ACA301, and the Bacillus subtilis ACA301 is preserved in China general microbiological culture collection center with the culture preservation number of CGMCC No. 16753.
The application of the bacillus subtilis ACA301 in the production of adenosine by fermentation.
A method for producing adenosine by fermenting Bacillus subtilis ACA301 comprises the following steps:
step 1: strain culture
Inoculating the bacillus subtilis ACA301 strain into a sterile activation culture medium, and culturing at 40 ℃ for 24 hours until fresh thalli grow out to obtain the activated bacillus subtilis ACA301 strain; then inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing until logarithmic phase;
step 2: inoculating the strain in the logarithmic phase prepared in the step 1 into a fermentation culture medium for fermentation culture, and finishing the culture until 72 hours to obtain adenosine fermentation liquor;
and step 3: and (2) filtering the adenosine fermentation liquor obtained in the step (2) by adopting a micro-membrane to obtain thalli and microfiltration clear liquid, filtering the thalli by using a plate frame to obtain thalli protein, passing the microfiltration clear liquid through an ultrafiltration system to obtain ultrafiltration clear liquid, then carrying out decolorization treatment on the ultrafiltration clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, filtering or carrying out centrifugal separation to remove mother liquor to obtain an adenosine crude product, redissolving the adenosine crude product, carrying out decolorization treatment, then carrying out recrystallization, and drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product.
The preferred embodiment is: the sterile activation medium comprises 10g of glucose, 20g of peptone, 20g of beef extract, 20g of yeast extract powder, 30g of corn steep liquor, 10g of sodium chloride, 50g of agar and 1 part of trace elements per liter. The trace element comprises copper. The trace element 1 part is that each liter of the sterile activation culture medium contains 0.5-1.5g of the trace element.
The preferred embodiment is: the seed culture medium comprises 20g of glucose, 30g of corn steep liquor, 10g of yeast powder, 1g of magnesium sulfate, 5g of monopotassium phosphate and 1 part of trace elements per liter. The trace element is sodium. The seed culture medium contains 1.5g of trace elements per liter.
The preferred embodiment is: the fermentation medium per liter comprises 50g of glucose, 40g of corn steep liquor, 20g of yeast extract powder, 5g of dipotassium hydrogen phosphate, 2g of magnesium sulfate, 3g of ammonium sulfate and 1 part of trace elements. The microelement is manganese. The fermentation medium contained 1.5g of trace elements per liter.
The preferred embodiment is: inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing, wherein the culture conditions of the strain when the strain is cultured to a logarithmic growth phase are as follows: the temperature is 40 ℃, the pH value is 7.5, the dissolved oxygen is 10.5 percent, and the tank pressure of the fermentation tank is 0.05 MPa.
The preferred embodiment is: the fermentation culture control conditions of the step 2 are as follows: the temperature is 40 ℃, the pH value is 7.5, the dissolved oxygen is 11%, the tank pressure of a fermentation tank is 0.10MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.05-5.0%.
The preferred embodiment is: in the step 3, the equipment for micro-membrane filtration is a ceramic membrane, an organic membrane or a metal membrane, and the aperture is 100 nm; the molecular weight cut-off of the ultrafiltration system is 5000D; decolorizing the ultrafiltered clear liquid with activated carbon, resin or nano-filtration; the evaporation concentration crystallization adopts a multi-effect evaporation crystallizer, the concentration vacuum degree is-0.09 MPa, the evaporation temperature is 85 ℃, and the concentration ratio is 8 times; the equipment for cooling crystallization is a cold crystallizer, a step cooling control mode is adopted, the lowest temperature is 10 ℃, and a plate-frame filter or a centrifuge can be used for removing the mother liquor after cooling crystallization; and removing the mother liquor by using a plate and frame filter or a centrifuge after recrystallization.
The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.
Sequence listing
<110> AoChua Biotechnology Ltd of Jiangsu
<120> bacillus subtilis and application thereof in production of adenosine by fermentation
<130>20191216
<160>2
<210>1
<211>1370
<212>DNA
<213> Natural sequence
<223>16S rRNA gene sequence
<400>1 ACCGACTTCG GGTGTTACAA ACTCTCGTGG TGTGACGGGC GGTGTGTACA AGGCCCGGGAACGTATTCAC CGCGGCATGC TGATCCGCGA TTACTAGCGA TTCCAGCTTC ACGCAGTCGA GTTGCAGACTGCGATCCGAA CTGAGAACAG ATTTGTGGGA TTGGCTTAAC CTCGCGGTTT CGCTGCCCTT TGTTCTGTCCATTGTAGCAC GTGTGTAGCC CAGGTCATAA GGGGCATGAT GATTTGACGT CATCCCCACC TTCCTCCGGTTTGTCACCGG CAGTCACCTT AGAGTGCCCA ACTGAATGCT GGCAACTAAG ATCAAGGGTT GCGCTCGTTGCGGGACTTAA CCCAACATCT CACGACACGA GCTGACGACA ACCATGCACC ACCTGTCACT CTGCCCCCGAAGGGGACGTC CTATCTCTAG GATTGTCAGA GGATGTCAAG ACCTGGTAAG GTTCTTCGCG TTGCTTCGAATTAAACCACA TGCTCCACCG CTTGTGCGGG CCCCCGTCAA TTCCTTTGAG TTTCAGTCTT GCGACCGTACTCCCCAGGCG GAGTGCTTAA TGCGTTAGCT GCAGCACTAA GGGGCGGAAA CCCCCTAACA CTTAGCACTCATCGTTTACG GCGTGGACTA CCAGGGTATC TAATCCTGTT CGCTCCCCAC GCTTTCGCTC CTCAGCGTCAGTTACAGACC AGAGAGTCGC CTTCGCCACT GGTGTTCCTC CACATCTCTA CGCATTTCAC CGCTACACGTGGAATTCCAC TCTCCTCTTC TGCACTCAAG TTCCCCAGTT TCCAATGACC CTCCCCGGTT GAGCCGGGGGCTTTCACATC AGACTTAAGA AACCGCCTGC GAGCCCTTTA CGCCCAATAA TTCCGGACAA CGCTTGCCACCTACGTATTA CCGCGGCTGC TGGCACGTAG TTAGCCGTGG CTTTCTGGTT AGGTACCGTC AAGGTACCGCCCTATTCGAA CGGTACTTGT TCTTCCCTAA CAACAGAGCT TTACGATCCG AAAACCTTCA TCACTCACGCGGCGTTGCTC CGTCAGACTT TCGTCCATTG CGGAAGATTC CCTACTGCTG CCTCCCGTAG GAGTCTGGGCCGTGTCTCAG TCCCAGTGTG GCCGATCACC CTCTCAGGTC GGCTACGCAT CGTTGCCTTG GTGAGCCATTACCTCACCAA CTAGCTAATG CGCCGCGGGT CCATCTGTAA GTGGTAGCCG AAGCCACCTT TTATGTTTGAACCATGCGGT TCAAACAACC ATCCGGTATT AGCCCCGGTT TCCCGGAGTT ATCCCAGTCT TACAGGCAGGTTACCCACGT GTTACTCACC CGTCCGCCGC TAACATCAGG GAGCAAGCTC
<210>2
<211>1128
<212>DNA
<213> Natural sequence
<223> gyrB Gene sequence
<400>2 TTACACGGTG TAGGTGCGTC GGTCGTAAAC GCACTATCAA CAGAGCTTGA TGTGACGGTTCACCGTGACG GTAAAATTCA CCGCCAAACC TATAAACGCG GAGTTCCGGT TACAGACCTT GAAATCATTGGCGAAACGGA TCATACAGGA ACGACGACAC ATTTTGTCCC GGACCCTGAA ATTTTCTCAG AAACAACCGAGTATGATTAC GATCTGCTTG CCAACCGCGT GCGTGAATTA GCCTTTTTAA CAAAGGGCGT AAACATCACGATTGAAGATA AACGTGAAGG ACAAGAGCGC AAAAATGAAT ACCATTACGA AGGCGGAATT AAAAGTTATGTAGAGTATTT AAACCGCTCT AAAGAGGTTG TCCATGAAGA GCCGATTTAC ATTGAAGGCG AAAAGGACGGCATTACGGTT GAAGTGGCTT TGCAATACAA TGACAGCTAC ACAAGCAACA TTTACTCGTT TACAAACAACATTAACACGT ACGAAGGCGG TACCCATGAA GCTGGCTTCA AAACGGGCCT GACTCGTGTT ATCAACGATTACGCCAGAAA AAAAGGGCTT ATTAAAGAAA ATGATCCAAA CCTAAGCGGA GATGACGTAA GGGAAGGGCTGACAGCGATT ATTTCAATCA AACACCCTGA TCCGCAGTTT GAGGGCCAAA CAAAAACAAA GCTGGGCAACTCAGAAGCAC GGACGATCAC CGATACGTTA TTTTCTACGG CGATGGAAAC ATTTATGCTG GAAAATCCAGATGCAGCCAA AAAAATTGTC GATAAAGGTT TAATGGCGGC AAGAGCAAGA ATGGCTGCGA AAAAAGCGCGTGAACTAACA CGCCGTAAGA GTGCTTTGGA AATTTCAAAC CTGCCCGGTA AGTTAGCGGA CTGCTCTTCAAAAGATCCGA GCATCTCCGA GTTATATATC GTAGAGGGTG ACTCTGCCGG AGGATCTGCT AAACAAGGACGCGACAGACA TTTCCAAGCC ATTTTGCCGC TTAGAGGTAA AATCCTAAAC GTTGAAAAGG CCAGACTGGATAAAATCCTT TCTAACAACG AAGTTCGCTC TATGATCACA GCGCTCGGCA CAGGTATCGG AGAAGACTTCAACCTTGAGA AAGCCCGT
Claims (10)
1. A bacillus subtilis strain is characterized in that: the bacillus subtilis is bacillus subtilis (A), (B)Bacillus subtilis) The ACA301, the Bacillus subtilis ACA301 is preserved in China general microbiological culture Collection center with the strain preservation number of CGMCC No. 16753.
2. The Bacillus subtilis ACA301 of claim 1 wherein: the application of the bacillus subtilis ACA301 in the production of adenosine by fermentation.
3. A method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 1, wherein the method comprises the following steps: comprises the following steps:
step 1: strain culture
Inoculating the bacillus subtilis ACA301 strain into a sterile activation culture medium, and culturing at 28-40 ℃ for 18-24 hours until fresh thalli grow out to obtain the activated bacillus subtilis ACA301 strain; then inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing until logarithmic phase;
step 2: inoculating the strain in the logarithmic phase prepared in the step 1 into a fermentation culture medium for fermentation culture, and finishing the culture after 30-72 hours to obtain adenosine fermentation liquor;
and step 3: and (2) filtering the adenosine fermentation liquor obtained in the step (2) by adopting a micro-membrane to obtain thalli and microfiltration clear liquid, filtering the thalli by using a plate frame to obtain thalli protein, passing the microfiltration clear liquid through an ultrafiltration system to obtain ultrafiltration clear liquid, then carrying out decolorization treatment on the ultrafiltration clear liquid to obtain decolorized liquid, carrying out reduced pressure evaporation concentration crystallization on the decolorized liquid, then cooling and crystallizing, filtering or carrying out centrifugal separation to remove mother liquor to obtain an adenosine crude product, redissolving the adenosine crude product, carrying out decolorization treatment, then carrying out recrystallization, and drying adenosine crystals obtained by recrystallization to obtain an adenosine finished product.
4. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: the sterile activation medium per liter comprises 1-10 g of glucose, 2-20 g of peptone, 2-20 g of beef extract, 2-20 g of yeast extract powder, 5-30 g of corn steep liquor, 1-10 g of sodium chloride, 5-50 g of agar and 1 part of trace elements.
5. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: each liter of the seed culture medium comprises 1-20 g of glucose, 1-30 g of corn steep liquor, 0.1-10 g of yeast powder, 0.01-1 g of magnesium sulfate, 0.01-5 g of monopotassium phosphate and 1 part of trace elements.
6. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: each liter of the fermentation medium comprises 5-50 g of glucose, 1-40 g of corn steep liquor, 0.1-20 g of yeast extract powder, 0.1-5 g of dipotassium hydrogen phosphate, 0.01-2 g of magnesium sulfate, 0.01-3 g of ammonium sulfate and 1 part of trace elements.
7. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: inoculating the activated bacillus subtilis ACA301 strain to a seed culture medium for culturing, wherein the culture conditions of the strain when the strain is cultured to a logarithmic growth phase are as follows: the temperature is 28-40 ℃, the pH value is 6.5-7.5, the dissolved oxygen is more than or equal to 10%, and the tank pressure of the fermentation tank is 0.02-0.05 MPa.
8. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: the fermentation culture control conditions of the step 2 are as follows: the temperature is 28-40 ℃, the pH value is 6.5-7.5, the dissolved oxygen is not less than 10%, the tank pressure of a fermentation tank is 0.02-0.10 MPa, sugar is supplemented in the fermentation process, and the content of residual sugar is controlled to be 0.05-5.0%.
9. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: in the step 3, the equipment for micro-membrane filtration is a ceramic membrane, an organic membrane or a metal membrane, and the aperture is 8 nm-100 nm; the molecular weight cut-off of the ultrafiltration system is 800-5000D; decolorizing the ultrafiltered clear liquid with activated carbon, resin or nano-filtration; the evaporation concentration crystallization adopts a multi-effect evaporation crystallizer, the concentration vacuum degree is minus 0.05 to minus 0.09MPa, the evaporation temperature is 50 to 85 ℃, and the concentration ratio is 3 to 8 times; the equipment for cooling crystallization is a cold crystallizer, a step cooling control mode is adopted, the lowest temperature is 0-10 ℃, and a plate-frame filter or a centrifuge can be used for removing the mother liquor after cooling crystallization; and removing the mother liquor by using a plate and frame filter or a centrifuge after recrystallization.
10. The method for producing adenosine by fermentation of bacillus subtilis ACA301 according to claim 3, wherein: the microelements comprise iron, magnesium, zinc, copper, manganese, sodium and potassium; 1 part of trace element means that each liter of the sterile activation culture medium contains 0.5-1.5g of trace element; each liter of the seed culture medium contains 0.5-1.5g of trace elements; each liter of the fermentation medium contains 0.5-1.5g of trace elements.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911291412.4A CN110791462B (en) | 2019-12-16 | 2019-12-16 | Bacillus subtilis and application thereof in fermentation production of adenosine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911291412.4A CN110791462B (en) | 2019-12-16 | 2019-12-16 | Bacillus subtilis and application thereof in fermentation production of adenosine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110791462A true CN110791462A (en) | 2020-02-14 |
| CN110791462B CN110791462B (en) | 2021-06-15 |
Family
ID=69448377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911291412.4A Active CN110791462B (en) | 2019-12-16 | 2019-12-16 | Bacillus subtilis and application thereof in fermentation production of adenosine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791462B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703243A (en) * | 2021-12-31 | 2022-07-05 | 杭州中美华东制药有限公司 | Method for producing adenosine by fermentation |
| CN114891656A (en) * | 2021-12-31 | 2022-08-12 | 杭州中美华东制药有限公司 | Bacillus subtilis and application thereof in adenosine production by fermentation |
| CN117802004A (en) * | 2024-01-16 | 2024-04-02 | 天津博创合成生物科技有限公司 | Preparation method of high-purity adenine nucleoside |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1657608A (en) * | 2005-03-23 | 2005-08-24 | 江苏省微生物研究所有限责任公司 | Adenosme generation bacteria and method for generating adenosine by fermentation |
| CN102154165A (en) * | 2011-01-05 | 2011-08-17 | 南京工业大学 | Bacillus subtilis capable of producing adenosine at high yield |
-
2019
- 2019-12-16 CN CN201911291412.4A patent/CN110791462B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1657608A (en) * | 2005-03-23 | 2005-08-24 | 江苏省微生物研究所有限责任公司 | Adenosme generation bacteria and method for generating adenosine by fermentation |
| CN102154165A (en) * | 2011-01-05 | 2011-08-17 | 南京工业大学 | Bacillus subtilis capable of producing adenosine at high yield |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703243A (en) * | 2021-12-31 | 2022-07-05 | 杭州中美华东制药有限公司 | Method for producing adenosine by fermentation |
| CN114891656A (en) * | 2021-12-31 | 2022-08-12 | 杭州中美华东制药有限公司 | Bacillus subtilis and application thereof in adenosine production by fermentation |
| CN117802004A (en) * | 2024-01-16 | 2024-04-02 | 天津博创合成生物科技有限公司 | Preparation method of high-purity adenine nucleoside |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110791462B (en) | 2021-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108220175B (en) | High-density culture method and pH regulation and control method for saccharomyces cerevisiae | |
| CN110791462B (en) | Bacillus subtilis and application thereof in fermentation production of adenosine | |
| CN111304106B (en) | Bacillus clausii and method for producing tetrahydropyrimidine by using same | |
| CN113430151B (en) | Corynebacterium glutamicum and application thereof in fermentation production of L-valine | |
| CN114480173B (en) | Escherichia coli and application thereof in fermentation production of L-tryptophan | |
| CN110982706B (en) | Geotrichum candidum and method for producing single-cell protein by treating high-ammonia nitrogen biogas slurry with same | |
| CN112359002B (en) | Streptomyces albus and application thereof in production of epsilon-polylysine | |
| CN117143933B (en) | Method for producing tryptophan by fermentation | |
| CN109266578B (en) | Escherichia coli ACThr1032 and application thereof in fermentation production of L-threonine | |
| CN111893065B (en) | Low-temperature cellulose degradation bacterium | |
| CN110982717B (en) | Honey yeast and method for producing single-cell protein by treating high-ammonia-nitrogen biogas slurry with same | |
| CN112300953B (en) | Bacillus subtilis and application thereof in fermentation production of adenylate deaminase | |
| CN116179356B (en) | Method for high-density heterotrophic culture of chlamydomonas reinhardtii and application thereof | |
| CN116716231A (en) | Escherichia coli and application thereof in fermentation production of tryptophan | |
| CN116200286B (en) | Clostridium thermocellum capable of efficiently saccharifying cellulose and application thereof | |
| CN106399218A (en) | Bacillus subtilis engineering bacteria and application thereof | |
| CN113234637B (en) | Fermentation medium for large-scale efficient production of bacterial cellulose and fermentation method thereof | |
| CN118064334B (en) | Paenibacillus polymyxa T9 and application thereof | |
| CN116590203B (en) | Corynebacterium glutamicum and application thereof in fermentation production of L-isoleucine | |
| CN116590202B (en) | Corynebacterium glutamicum and application thereof in fermentation production of L-leucine | |
| CN118256402B (en) | Acid-resistant bacillus subtilis and application thereof in fermentation production of inosine | |
| CN116355814B (en) | Escherichia coli and application thereof in fermentation production of L-arginine | |
| CN116515795B (en) | Application of Aspergillus tubingensis in preparing phytase and/or degrading phytic acid | |
| CN116121085B (en) | Cold-resistant yeast suitable for low-temperature aquaculture and biocontrol application thereof | |
| CN110982767B (en) | Cell fusion strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |