CN110777152A

CN110777152A - Transcription factor EjBZR1 for inhibiting fruit cell expansion and application thereof

Info

Publication number: CN110777152A
Application number: CN201910899692.0A
Authority: CN
Inventors: 苏文炳; 林顺权; 杨向晖; 邵子坤; 甘小清
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2019-09-23
Filing date: 2019-09-23
Publication date: 2020-02-11
Anticipated expiration: 2039-09-23
Also published as: CN110777152B

Abstract

The invention discloses a transcription factor EjBZR1 for inhibiting fruit cell expansion and application thereof, wherein a BES1/BZR1 family member EjBZR1 gene for regulating loquat fruit cell expansion and fruit growth is obtained by separating and cloning from 'Zao Zhong 6'. The nucleotide sequence is shown as SEQ ID No.1 and comprises an open reading frame of 888 bp; 295 amino acids are coded, and the coded amino acid sequence is shown as SEQ ID No. 2. The transcription factor provides a gene target for regulating and controlling the cell size and fruit size of loquat fruits, provides a theoretical basis for improving the sizes of the organs of the fruits and other crop seeds and the like and ensuring the crop yield, provides a new molecular breeding gene resource for reducing the using amount of a growth regulator in the production of the fruits and provides a new genetic resource for the production of environment-friendly agricultural products.

Description

Transcription factor EjBZR1 for inhibiting fruit cell expansion and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a transcription factor EjBZR1 for inhibiting fruit cell expansion and application thereof

Background

Loquat is ripe in autumn, winter flower and spring, and is a characteristic and rare fruit in China. The acre yield of a common loquat orchard is about 500kg, the acre yield of only a few orchards with excellent management can reach 1000kg, and the yield per unit can not reach 30% of tree species such as apples, oranges and the like. The high production cost caused by low yield per unit becomes an important resistance for the development of the loquat industry at present. The fruit size is an important quality character of the fruit and an important basis for yield formation. Each inflorescence of the loquat has a large number of single flowers, and although each cluster can naturally bear 10-20 fruits, the fruits grow unevenly and have poor marketability; in production, fruit thinning is generally required to promote fruit enlargement and quality improvement. The cultivation of big-fruit high-quality variety is an important way for improving yield and benefit, but the molecular mechanism for controlling the growth of loquat fruit is not clear at present, and the genetic improvement speed of variety is slow.

Loquat grows and develops from flowering to fruit ripening for 4 to 5 months, and the fruit undergoes a young fruit stagnation period, a cell rapid division period, a fruit rapid expansion period and a mature period, but the cytological basis influencing the fruit size is not clear. The inventor analyzes the cell characteristics of the main cultivar 'early 6' fruit in the full development period in the early period, finds that the maintenance time of the division of the flowering fruit real cells accounts for 1/4 of the fruit development, and the number of cell layers is not increased by one time; and the cell expansion is carried out at about 3/4 times in the development process, the cell area of the mature fruit is increased by about 40 times compared with the calyx barrel in the flowering stage, and the contribution of the cell size to the expansion of the loquat fruit is suggested to be larger. Subsequently, 9 representative resources were analyzed for correlation of fruit cytological characteristics with fruit size, confirming that the contribution of cell size to the enlargement of the loquat fruit was greater than the number of cells. The comprehensive results in the previous stage show that the cell size is an important cytological basis for the size of the loquat fruit. However, key genes for regulating the size of the loquat fruit have not been found.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a transcription factor EjBZR1 for inhibiting fruit cell expansion and application thereof.

The first object of the present invention is to provide a transcription factor EjBZR1 gene which inhibits organ and/or cell expansion.

It is a second object of the present invention to provide a transcription factor EjBZR1 which inhibits organ and/or cell expansion.

The third purpose of the invention is to provide the application of the transcription factor EjBZR1 gene or the transcription factor EjB ZR1 in inhibiting the expansion of plant organs and/or cells or serving as a target point for the growth of plant organs and/or cells.

The fourth purpose of the invention is to provide the application of the transcription factor EjBZR1 gene inhibitor or the transcription factor EjBZR1 inhibitor in regulating and controlling the plant organ and/or cell expansion.

A fifth object of the present invention is to provide a method for enlarging loquat fruits.

The sixth object of the present invention is to provide a recombinant vector.

The seventh object of the present invention is to provide a recombinant strain.

An eighth object of the present invention is to provide the use of either said recombinant vector or said recombinant strain for promoting the expansion of plant organs and/or cells.

The ninth object of the present invention is to provide the use of either said recombinant vector or said recombinant strain for inhibiting plant organ and/or cell expansion.

In order to achieve the purpose, the invention is realized by the following technical scheme:

through cytological and transcriptome analysis of extreme large/small fruit hybrid sister loquat fruits, a BZR1 transcription factor is found, the expression change of the gene in different loquat strain fruits is obviously negatively related to the cell size (and the fruit size), and the inhibition of the expression of the gene in the fruits can promote the fruit expansion; the organs of an arabidopsis thaliana plant over expressing the gene are obviously reduced, the cell expansion is inhibited, and the gene is named as EjBZR 1. Further separating and cloning from 'early clock No. 6' to obtain a BES1/BZR1 family member EjBZR1 gene for regulating the expansion of loquat fruit cells and the growth of fruits. The nucleotide sequence is shown as SEQ ID No.1 and comprises an open reading frame of 888 bp; encodes 295 amino acids, and the encoded amino acid sequence is shown in SEQ ID No. 2.

The invention therefore claims the following:

a transcription factor EjBZR1 gene for suppressing organ and/or cell expansion has the nucleotide sequence shown in SEQ ID No. 1.

Cloning the primer pair of the EjBZR1 gene cDNA sequence, wherein the sequence of the upstream primer EjBZR1-F is shown as SEQ ID No.3, and the sequence of the downstream primer EjBZR1-R is shown as SEQ ID No. 4.

A transcription factor EjBZR1 for inhibiting organ and/or cell expansion has an amino acid sequence shown in SEQ ID NO. 2.

The application of any one of the transcription factor EjBZR1 gene or the transcription factor EjBZR1 in inhibiting the expansion of plant organs and/or cells or serving as a target point for the growth of plant organs and/or cells also belongs to the protection scope of the invention.

The application of the transcription factor EjBZR1 gene inhibitor or the transcription factor EjBZR1 inhibitor in promoting the expansion of plant organs and/or cells also belongs to the protection scope of the invention.

Preferably, the plant is loquat.

Preferably, the organ includes, but is not limited to, fruit, leaves, and the like.

A method for enlarging loquat fruit comprises silencing EjBZR1 gene of transcription factor in loquat.

Preferably, the transcription factor EjBZR1 gene in the loquat fruit is silenced by using a virus-induced gene silencing technology.

More preferably, the method comprises the following steps:

s1, subcloning the transcription factor EjBZR1 gene to a TRV2 vector to obtain a recombinant vector;

s2, respectively transferring the recombinant vector and the auxiliary vector constructed in the previous step into the GV3101 agrobacterium to obtain two recombinant strains;

and S3, mixing and incubating the two recombinant strains, and injecting the mixture into the middle of the loquat at the initial stage of cell expansion of the loquat.

A recombinant vector, a vector inserted with the transcription factor EjBZR1 gene.

Preferably, the vector is an overexpression vector and a gene silencing vector.

More preferably, the overexpression vector is pBI121, and further preferably, the insertion site of the gene is between BamH I and Sac I.

More preferably, the gene silencing vector is TRV2, and even more preferably, the insertion site of the gene is between Xho I and Xma I.

A recombinant strain carrying the recombinant vector.

The invention also claims the following:

the application of the recombinant vector or the recombinant strain in promoting plant organs and/or cells to expand is characterized in that the recombinant vector is a recombinant gene silencing vector.

The recombinant vector or the recombinant strain is applied to inhibiting the expansion of plant organs and/or cells, and is characterized in that the recombinant vector is a recombinant overexpression vector.

Compared with the prior art, the invention has the following beneficial effects:

1. the transcription factor EjBZR1 is obtained for the first time, and the transcription factor provides a gene target for regulating and controlling the cell size and the fruit size of the loquat fruit, provides a theoretical basis for improving the sizes of the fruit and the organs of products such as grains of other crops and the like and ensuring the yield of the crops, provides a new molecular breeding gene resource for reducing the use amount of a growth regulator in the production of the loquat fruit, and provides a new genetic resource for the production of environment-friendly agricultural products.

2. Through agrobacterium-mediated genetic transformation and gene silencing, an over-expression arabidopsis plant and a gene suppression loquat fruit are obtained, and biological function verification shows that the cloned EjBZR1 has the function of simultaneously regulating and controlling enzymes in a synthesis path of a plurality of gene coding brassinosteroids, so that the expansion of organ cells such as arabidopsis and loquat fruits is suppressed. EjBZR1 has the characteristic of simultaneously regulating and controlling a plurality of genes, and can provide a more efficient target for molecular breeding of fruit trees.

Drawings

FIG. 1 is an electrophoresis diagram of EjBZR1 product after PCR amplification according to the present invention. Wherein M is DNA marker (the bands are respectively 2000bp, 1000bp, 750bp and 500bp from top to bottom); the arrows in lanes A1 and A2 indicate the band as the full-length PCR amplification product of EjBZR1 gene.

FIG. 2 shows the clustering and conserved domain analysis of the BES1/BZR1 protein of EjBZR1 and other plants according to the present invention; wherein, the graph a shows that EjBZR1 is clustered with BES1/BZR1 proteins of other plants; panel b shows the conserved domain analysis of BES1/BZR1 protein between EjBZR1 and other plants.

FIG. 3 shows the correlation between fruit morphology and cell characteristics of ZP44 and ZP65 of the cross-bred sister line of the invention and EjBZR1 gene expression; wherein, the picture a shows the fruit morphology of ZP44 and ZP65 of the cross-bred sister series; FIG. b is a section of mature fruit cells of a cross-bred sister line ZP44 and ZP 65; the graph c shows the dynamic change of the fruit diameters of the crossed sister lines ZP44 and ZP 65; FIG. d shows the dynamic change of the pulp thickness of ZP44 and ZP65 in the cross-breeding sister series; the graph e shows the dynamic change of the sizes of fruit cells of the crossed sister lines ZP44 and ZP 65; the figure f is the expression comparison of EjBZR1 gene in the fruit growth process of ZP44 and ZP65 of the cross-bred sister line.

FIG. 4 shows the effect of EjBZR1 gene silencing on loquat fruit gene expression and fruit size; wherein, the graph a shows the growth condition of EjBZR1 gene silencing consequence; panel b shows the change in fruit weight following EjBZR1 gene silencing; panel c is meat slices resulting from EjBZR1 gene silencing; FIG. d shows the change in fruit cell size following EjBZR1 gene silencing; FIG. e is the viral capsid protein PCR detection after Agrobacterium injection; panel f is the change in EjBZR1 gene expression following gene silencing; FIG. g shows the expression changes of the genes involved in the synthesis of fruit brassinosteroids after the EjBZR1 gene silencing.

FIG. 5 shows the phenotype of EjBZR1 over-expressed plants according to the invention; wherein, the graph a is the plant size comparison of EjBZR1 overexpression strain and the control plant before and after bolting; FIG. b shows the comparison of the sizes of plants after flowering of EjBZR1 overexpression lines and control plants; FIG. c shows the comparison of EjBZR1 overexpression lines with rosette leaves of control plants; FIG. d is a comparison of the petal size of EjBZR1 overexpression lines with control plants; FIG. eEjBZR1 overexpression lines vs. control plant petal cell observations; FIG. f is a comparison of the petal cell size of EjBZR1 overexpression lines with control plants; panel g shows a comparison of EjBZR1 overexpression lines with control plants siliques; FIG. h shows the semi-quantitative results of EjBZR1 gene expression compared with control plants in EjBZR1 overexpression lines.

FIG. 6 shows the expression analysis of EjBZR1 and Arabidopsis thaliana brassinosteroid biosynthesis related genes in transgenic plants of the present invention.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

EXAMPLE 1 cloning of cDNA sequence of EjBZR1 Gene of Eriobotrya japonica

First, experiment method

1. Sample collection

'early bell 6' 4 developmental stage fruit samples were collected from a flourishing 'early bell 6' tree grown in a germplasm resources garden of eriobotrya at the university of south china agricultural. Fresh fruit samples were snap frozen in liquid nitrogen and stored in a-80 ℃ freezer.

2. Extraction of RNA

Extracting RNA of the grinded fruit sample by using an EASYspin Plus plant RNA rapid extraction kit (Edley) according to a method of an instruction, wherein the method comprises the following steps: adding 1.0mL of RLT lysate into 1.5mL of a centrifuge tube, adding 100mg of ground fruit sample powder, violently shaking for 20s, and then cracking at 55 ℃ for 20 min; centrifuging the lysate at 13000rpm for 5-10 min; taking the supernatant, transferring the supernatant into a new centrifuge tube, adding absolute ethyl alcohol with half volume of the supernatant, and slightly sucking, beating and uniformly mixing; adding the mixture into RA adsorption column, standing for 30s, and centrifuging at 13000rpm for 2 min; discarding the waste liquid, repeating the previous step, and filtering all the mixtures through an RA adsorption column; discarding the waste liquid, adding 700 μ l deproteinized liquid RW1 into the adsorption column, standing for 1min, and centrifuging at 13000rpm for 30 s; discarding the waste liquid, adding 500 μ l of rinsing liquid RW into the adsorption column, standing for 1min, and centrifuging at 13000rpm for 30 s; discarding the waste liquid, and adding a rinsing liquid RW for one time; discarding the waste liquid, and putting the adsorption column back into the hollow tube for centrifugation at 13000rpm for 2-3 min; taking out the adsorption column, putting the adsorption column into a new RNase free centrifuge tube, adding 30-50 mu l of RNase free water into the middle of an adsorption film, standing at room temperature for 1-2 min, and centrifuging at 12000rpm for 1 min; and sucking the eluted RNA back to the middle of the original adsorption membrane, standing at room temperature for 1-2 min, and centrifuging at 12000rpm for 1min to obtain the RNA.

3. Reverse transcription to synthesize cDNA

After the concentration of the obtained RNA in the different samples was determined, water was added to adjust the concentration to the same concentration, followed by PrimeScript ^TMFirst strand cDNA was synthesized using RT reagent Kit with the instructions for the gDNA Eraser reverse transcription system (Takara).

4. Amplification of BZR1 homologous Gene

The full length of the BZR1 homologous gene sequence annotated by the loquat genome is called, a Primer is designed by using Primer Premier 5.0, and a Shanghai bioengineering company Limited is entrusted to synthesize a full-length sequence amplification Primer pair, wherein the amplification Primer pair comprises the following components: SEQ ID No.3 and SEQ ID No. 4.

EjBZR1 sequence cloning upstream primer EjBZR1-F, SEQ ID NO. 3: ATGACGTCTGATGGGGC, respectively;

EjBZR1 sequence cloning downstream primer EjBZR1-R, SEQ ID NO. 4: TTAAATCCGAGCCTTTCCATTC are provided.

Using 4-stage 'early-clock No. 6' fruit-combined cDNAs as template and using high-fidelity enzyme HS DNApolymerase (Takara Shuzo Co., Ltd.) PCR-amplified the target gene. After the PCR amplification procedure was completed, 0.2. mu.l rTaq polymerase was added to the system and extension was continued at 72 ℃ for 30min to add A tail to the PCR product. After the reaction, the PCR product was electrophoresed through 1.5% agarose gel.

And then connecting the amplified product to a pGEM-T vector (Promega, USA) and transferring the amplified product into escherichia coli competence, and handing the escherichia coli positive clone to a Jinzhi biology company for Sanger sequencing after PCR detection to obtain an accurate target gene sequence.

Second, experimental results

The result shows that the designed primer pair can amplify specific 888bp (SEQ ID No.1 and FIG. 1) in the corresponding fruit template. This sequence encodes 295 amino acid residues (SEQ ID No. 2).

The MEGA5 software is used for constructing a homologous gene evolutionary tree, and several OsBZRs of monocotyledon rice and other genes in Arabidopsis BES1/BZR1 family are found to be gathered in a branch. EjBZR1 is clustered with BZR1 homologous genes of dicotyledonous plants of autumn pears (PuBZR1), tomatoes (SlBZR1), soybeans (GmBZR1), eucalyptus grandis (EgBZR1) and Arabidopsis thaliana (BZR1) in another branch (FIG. 2 a); EjBZR1 has 63% amino acid identity with Arabidopsis thaliana BZR1, but it encodes 295 amino acids (SEQ ID No.2) with the same sequence as that of the autumn pear PuBZR1, and the amino acid identity is 91.86%, and the relationship is recent. The conserved domains/motifs of the amino acids encoded by these genes were then analyzed by ClustalX software and found that EjBZR1 encodes amino acids that have 4 conserved functional domains (DNA-binding domain, 14-3-3 binding site, pest domain and EAR motif) as well as other BES1/BZR1 family genes, where the DNA-binding domain contains a stretch of nuclear-localized amino acid residues (fig. 2 b).

Example 2 analysis of the expression patterns of EjBZR1 during ZP44 and ZP65 fruit growth

First, experiment method

Collecting loquat fruit samples and measuring the diameter, thickness and weight of the loquat fruit/receptacle at different development stages of the loquat fruit. Samples of 'ZP 44' and 'ZP 65' fruits were taken 10 different times after fruit set for fruit weight, cell characteristics and gene expression level comparison, with 3 biological replicates taken for all fruit measurements, 10 fruits per replicate.

TABLE 1 primer pair sequence Listing for Gene expression analysis

Making the slices as follows: fixing the small pulp blocks of the fruits at each period by FAA fixing liquid, placing the fixed pulp blocks in a vacuum pump for about 1 hour, and performing suction filtration until the small pulp blocks floating in the fixing liquid sink to the bottom of the bottle to ensure that cells are fully fixed; taking out the sample block, putting the sample block into a flushing cage, and flushing the sample block for more than 24 hours by using slow tap water; dehydrating with 15%, 30%, 50%, 70%, 85%, 95% and 100% gradient alcohol (with interval time of 1-1.5 h, wherein 70% alcohol is soaked overnight, and can be stored for a long time, and 100% alcohol is soaked for 1h twice to ensure that the sample block is completely dehydrated), and removing water in the material; then dyeing for 2-3h by using 1/2 anhydrous alcohol and a safranin saturated solution of 1/2 dimethylbenzene; 1/2 adding 1/2 dimethylbenzene into anhydrous alcohol, and 100% dimethylbenzene (twice) is transparent for 0.5 h; adding dimethylbenzene to half of a small bottle, adding wax to fill the small bottle, sealing the small bottle, soaking the small bottle in a constant-temperature water bath kettle at 38-40 ℃ for 1-2 days or storing the small bottle for more than a plurality of days, transferring the material into an aluminum sheet loop, and carrying out graded wax dipping on 50% paraffin, 50% dimethylbenzene, 75% paraffin, 25% dimethylbenzene, pure wax A, pure wax B and pure wax C in a constant-temperature box at 65 ℃; embedding the material in a small carton with filtered clean virgin wax; cutting the solidified wax block into small blocks, fixing the small blocks on the small blocks, slicing the small blocks by using a slicer, wherein the thickness of the small blocks is 8-10 mu m, spreading the small blocks in a 40 ℃ water bath, attaching the slices to a clean glass slide, and drying the slices in a 40 ℃ thermostat; and (3) soaking the dried slices in xylene for dewaxing, repeating the soaking and dewaxing once for about 30min each time, taking out the slices, slightly drying the slices, and sealing the slices with neutral gum. Observing and photographing the prepared slices by using an AxioVision LE64 software system (Carl Zeiss, German), and directly tabletting the petals of the transgenic plants and then performing microscopic examination and photographing by using an optical microscope; the photographs of the cells taken were analyzed for cell size using Images J software (http:// rsb. info. nih. gov/vj /).

RNA was extracted from each loquat fruit sample according to the method of example 1 and cDNA was synthesized. Fluorescent quantitative primers were designed according to the genes found above, and the sequences of all primers are shown in Table 1, after specificity and amplification efficiency detection. Using cDNA at each stage as template, iTaqTM univeral

Green Supermix (Bio-Rad) and the qPCR reaction was performed on a LightCycler 480(Roche) fluorescent quantitative PCR instrument. And amplifying and using EjACT as an internal reference gene for loquat gene expression to carry out gene expression level homogenization. 10.0 mul of the mixed solution is mixed for 60s at 95 ℃; repeating at 95 deg.C for 10s, 60 deg.C for 20s, and 72 deg.C for 15s for 39 times; the dissolution curves were analyzed according to the kit default program. All the above experiments were designed for 3 replicates.

Second, experimental results

The results show that ZP65 fruits are bigger than ZP44 from fruit set, and the difference in fruit size between the two lines increases gradually as the fruit grows (fig. 3a, c); the difference in fruit size between the two materials is manifested in terms of fruit diameter (fig. 3c), pulp thickness (fig. 3d) and pulp cell size (fig. 3b, e). Gene expression analysis found that the expression level of the EjBZR1 gene in the fruits at various stages of ZP44 was higher than that in ZP65 (fig. 3 f). Analysis of the dynamic correlation between gene expression patterns and cell enlargement shows that the expression of EjBZR1 gene is inversely correlated with cell enlargement and fruit growth. It was shown that EjBZR1 may be a negative regulator of fruit growth.

Example 3 EjBZR1 Gene silencing vector construction and loquat fruit VIGS treatment

First, experiment method

The virus-induced gene silencing vector TRV2-EjBZR1 was constructed by subcloning EjBZR1 into TRV2 vector using the primers shown in Table 2. The vector construction specifically comprises the following steps: using Gibson

Master Mix and corresponding endonuclease (from NewEngland Bio labs) were used to linearize the linearized vector at 37 ℃. The enzyme digestion product was purified using gel DNA minirecovery kit (magenta). The purified enzyme-cleaved product was ligated to the desired vector using the Clonexpress one-step directed cloning seamless cloning kit, and the reaction system contained 1. mu.l of the purified recovered PCR amplification product, 1. mu.l of linearized vector, 2. mu.l of 5 × CE II buffer, and 1. mu.l of Exnase ^TMII and 4 mu l of sterile water, the reaction system is cooled for 5min on ice after reacting for half an hour at 37 ℃, and then 5 mu l of ligation product is transferred into 50 mu l of escherichia coli DH5 α competent cellsCells are subjected to PCR identification and Sanger sequencing to obtain a TRV2-EjBZR1 recombinant plasmid containing the target fragment.

TABLE 2 primers for construction of plant overexpression vectors and virus-induced gene silencing vectors

The constructed expression vector and auxiliary vector (TRV1) are respectively transferred into GV3101 Agrobacterium, and glycerol is added to be stored at-80 ℃ for later use. Before VIGS treatment, firstly, taking glycerol bacteria to streak and activate on a plate containing antibiotics; adding sterile water to 150mL with 30mL MES (concentration 100mM), 30mL MgCl2 (concentration 100mM), adding 150 μ L acetosyringone (concentration 100mM), mixing to obtain MCLS working solution, and storing in refrigerator at 4 deg.C; inoculating 400-500 μ L of newly activated bacterial liquid into 5-10 mL of YEP liquid culture medium containing 50 μ L Kan and 100mL Rif, shaking for 24h to alternate morning (if activated, the shaking time can be shortened properly), and collecting bacterial liquid A ₆₀₀The value is 0.8 to 1.0; taking 2mL of bacterial liquid, and centrifuging at 5000rpm for 10 min; discarding the supernatant, adding 2mL of MCLS working solution into the precipitate, and suspending the thalli; centrifuging at 5000rpm for 10 min; discarding the supernatant, repeating the suspension-centrifugation for 1 time, and adding the suspension into a 10-15 mL test tube; adding working solution to dilute to bacterial solution A ₆₀₀The value is about 0.2 (working solution is used as blank control); mixing the diluted bacteria liquid containing TRV1 Empty carrier with TRV2-EjBZR1 (or TRV2-Empty) bacteria liquid solution in equal volume; after mixing uniformly, incubating for about 3 hours at room temperature in a dark place; at the early stage of loquat cell expansion (about 42-60 days after blossom), the mark is made on the near equatorial plane of the fruit by using the needle of a 25ml syringe, the TRV1+ TRV2-EjBZR1 mixed bacteria liquid is injected into the middle part of the fruit by using an Injex-30 type syringe, and the fruit injected by the TRV1+ TRV2-Empty mixed bacteria liquid is used as a control. 7 days after injection, fruit samples were collected for analysis of gene expression, reference example 1 for RNA extraction and cDNA synthesis reference, and reference example 2 for analysis of expression of EjBZR1 and related genes of loquat brassinosterol biosynthesis in VIGS-treated fruits, and all primer pair sequences for quantitative analysis are shown in Table 2. At the same time, the fruit weight changes of the fruits are analyzed at the time of fruit ripening, and then the fruit samples are fixed by FAA according to reference example 2The blocks were sliced and the cells were observed.

Second, experimental results

TRV1+ TRV2-Empty as a control, it was found that TRV2-EjBZR1 fruits were significantly larger after VIGS treatment (FIG. 4a, b). Section analysis revealed a significant increase in cells from gene-silenced fruits (fig. 4c, d). The PCR detection of the uninjected fruits as blank control shows that the empty vector and the TRV2-EjBZR1 injected fruits can detect the transcript of the virus capsid protein (figure 4e), which proves that the VIGS system can be expressed in the loquat fruits. The expression level of EjBZR1 in the fruits of TRV1+ TRV2-Empty and TRV1+ TRV2-EjBZR1 is detected, and the expression level of EjBZR1 in the loquat fruits can be obviously reduced after VIGS treatment (figure 4 f). With the decrease in the expression level of EjBZR1, the expression level of several brassinosteroid synthesis-related genes, in particular EjCYP90A, was significantly up-regulated in VIGS-treated fruits (fig. 4 g). The EjBZR1 is proved to be a fruit growth inhibitor, and the reduction of the expression level can promote the fruit cell enlargement and the fruit growth.

Example 4 construction of plant overexpression vector and verification of Arabidopsis genetic transformation function

First, experiment method

Reference example 1 for RNA extraction and cDNA Synthesis and reference example 2 for gene expression analysis, the primer pair in Table 2 was used to subclone EjBZR1 into pBI121 plasmid to construct 35S, EjBZR1 overexpression vector, vector construction and specific operation steps for vector Agrobacterium transformation reference example 3.

Carrying out Arabidopsis genetic transformation by adopting a floral dip method, and specifically operating as follows: selecting a single colony of detected agrobacterium tumefaciens, inoculating the single colony of the detected agrobacterium tumefaciens into 5mL of YEP (containing 50 mu g/mL kanamycin, 50 mu g/mL rifampicin, 25 mu g/mL gentamicin and 5 mu g/mL tetracycline), and carrying out shaking culture at 28 ℃ and 200rpm for overnight; inoculating the strain into 100mL YEP liquid culture medium containing the corresponding antibiotic according to 1/50(V/V), performing shaking culture at 28 deg.C and 200rpm to A ₆₀₀About 0.8; centrifuging at 5000rpm for 10min to collect thallus; 100mL of transformation permeate (5% sucrose, 0.05% Silwet L-77) was prepared and the cells were resuspended; soaking the flower bud of arabidopsis into penetrating fluid by adopting a floral dip method, and gently shaking the inflorescence in the infection process; after about 1minTaking out the plants, transversely placing the plants in a plastic tray, shading, and culturing at 22 ℃ for 24 hours; then, the normal growth is recovered by transferring to the conventional illumination condition; after the primary transformation for 7d, the infection can be repeated for 1-2 times so as to improve the transformation efficiency; after the transformation, the seeds grow for about 1 month, and when the seeds are mature, the seeds are collected for resistance screening; phenotypic comparative analysis was performed with plants of the T3 generation.

Arabidopsis thaliana used for genetic transformation is vernalized at 4 ℃, and then resistant plants and control plants are planted in a greenhouse under the long-day condition of 16h/8h at 22 ℃. Transgenic arabidopsis thaliana is photographed before and after bolting (when all leaves are completely unfolded) to compare the size difference of plants and leaves, and petals are collected on the day of flower opening for comparing the area of the petals with the size of cells. Arabidopsis plants are collected 3 weeks after sowing (the stage of rapid expansion of plant leaves), RNA is extracted and cDNA reference is synthesized in reference example 1, EjBZR1 of over-expressed plants and expression conditions of genes related to biosynthesis of Arabidopsis brassinosteroids are analyzed in reference example 2, and sequences of all primer pairs for quantitative analysis are shown in Table 2. The gene expression level was normalized by using AtUBQ10 as a reference gene for gene expression.

Second, experimental results

The wild Col-0 Arabidopsis thaliana is used as a control, and the plant size, the leaves, the petals and the fruits of 3 EjBZR1 overexpression lines are obviously reduced in different degrees (figure 5a, b, c, d and g); wherein the leaves and fruit also exhibit varying degrees of deformity, curling (fig. 5c, d). Taking transgenic strain No.2 as an example, the correlation between the characteristics of the petal epidermal cells and the sizes of petals is analyzed, and the petal cells of the over-expression plants are found to be obviously reduced (FIG. 5 e); eventually, the petals of each over-expressed line plant were also smaller than the wild type (FIG. 5 f). Analysis of gene expression by semi-quantitative (FIG. 5h) and qPCR quantitative methods revealed that each line had a high EjBZR1 gene expression level, but no gene expression was detected in wild-type plants (FIG. 6). At the same time, 8 brassinosteroid biosynthesis related genes of the 3 over-expressed Arabidopsis line plants were found to be significantly inhibited (FIG. 6). Arabidopsis genetic transformation proves that EjBZR1 is a growth inhibition transcription factor, overexpression inhibits brassinosteroid synthesis gene expression, and limits cell expansion and organ growth.

Sequence listing

<110> southern China university of agriculture

<120> transcription factor EjBZR1 for inhibiting fruit cell expansion and application

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>888

<212>DNA

<213>Eriobotrya japonica

<400>1

atgacgtctg atggggcgac ttcagcggcg acgacggcgc ggaggaagcc gtcgtggcgg 60

gagagggaga acaaccggag gagagagcgg aggaggagag ccgtcgcggc gaagatattc 120

gccggcctcc gagctcaggg agacttcaat ttgcccaagc actgcgacaa caacgaggtc 180

cttaaagctc tctgcctcca ggccggctgg accgtagagg acgacggcac cacctaccgg 240

aagggattaa agccgattca aactgatacg ccgggcgcat caaccaagat cagcccgtac 300

tcgtcgctaa atccgagtcc aatcccgtcc taccaagtca gtccgtcgtc ttcgtcctat 360

cccagtccca cccgcttcga tcccgtctct aattcatcca atccaattca ctatctccgt 420

tctgcaatcc caccatctct tcctcccctg cgaatttcca acagtgcccc tgtaaccccg 480

ccgctctcct ccccgacctc cagacgcccc aacccaattc ccaactggga caccattgcc 540

aaacagtcca tggcctcttt cgattacccg ttttatgccg tctccgctcc agcgagcccg 600

acccgccaac accatcctca tcctacagct gccactatcc ccgaatgcga cgagtccgat 660

gcttccaccg tcgattccgg acaatgggta tgcttccaga gatttgctcc ttctctgtca 720

gcaatgccag cctctccgac ctttaatctt gtgaagcctg ctttccctca gcagaatatt 780

cccgcggatc aaatcccgga cgtaaagccg tggatcgggg agaagattca cgaggtggga 840

ttggatgact tggagctcac gcttgggaat ggaaaggctc ggatttaa 888

<210>2

<211>295

<212>PRT

<213>Eriobotrya japonica

<400>2

Met Thr Ser Asp Gly Ala Thr Ser Ala Ala Thr Thr Ala Arg Arg Lys

1 5 10 15

Pro Ser Trp Arg Glu Arg Glu Asn Asn Arg Arg Arg Glu Arg Arg Arg

20 25 30

Arg Ala Val Ala Ala Lys Ile Phe Ala Gly Leu Arg Ala Gln Gly Asp

35 40 45

Phe Asn Leu Pro Lys His Cys Asp Asn Asn Glu Val Leu Lys Ala Leu

50 55 60

Cys Leu Gln Ala Gly Trp Thr Val Glu Asp Asp Gly Thr Thr Tyr Arg

65 70 75 80

Lys Gly Leu Lys Pro Ile Gln Thr Asp Thr Pro Gly Ala Ser Thr Lys

85 90 95

Ile Ser Pro Tyr Ser Ser Leu Asn Pro Ser Pro Ile Pro Ser Tyr Gln

100 105 110

Val Ser Pro Ser Ser Ser Ser Tyr Pro Ser Pro Thr Arg Phe Asp Pro

115 120 125

Val Ser Asn Ser Ser Asn Pro Ile His Tyr Leu Arg Ser Ala Ile Pro

130 135 140

Pro Ser Leu Pro Pro Leu Arg Ile Ser Asn Ser Ala Pro Val Thr Pro

145 150 155 160

Pro Leu Ser Ser Pro Thr Ser Arg Arg Pro Asn Pro Ile Pro Asn Trp

165 170 175

Asp Thr Ile Ala Lys Gln Ser Met Ala Ser Phe Asp Tyr Pro Phe Tyr

180 185 190

Ala Val Ser Ala Pro Ala Ser Pro Thr Arg Gln His His Pro His Pro

195 200 205

Thr Ala Ala Thr Ile Pro Glu Cys Asp Glu Ser Asp Ala Ser Thr Val

210 215 220

Asp Ser Gly Gln Trp Val Cys Phe Gln Arg Phe Ala Pro Ser Leu Ser

225 230 235 240

Ala Met Pro Ala Ser Pro Thr Phe Asn Leu Val Lys Pro Ala Phe Pro

245 250 255

Gln Gln Asn Ile Pro Ala Asp Gln Ile Pro Asp Val Lys Pro Trp Ile

260 265 270

Gly Glu Lys Ile His Glu Val Gly Leu Asp Asp Leu Glu Leu Thr Leu

275 280 285

Gly Asn Gly Lys Ala Arg Ile

290 295

<210>3

<211>17

<212>DNA

<213>Eriobotrya japonica

<400>3

atgacgtctg atggggc 17

<210>4

<211>22

<212>DNA

<213>Eriobotrya japonica

<400>4

ttaaatccga gcctttccat tc 22

Claims

1. A transcription factor EjBZR1 gene for inhibiting organ and/or cell expansion, which has a nucleotide sequence shown in SEQ ID NO. 1.

2. A transcription factor EjBZR1 for inhibiting organ and/or cell expansion is characterized in that the amino acid sequence is shown as SEQ ID NO. 2.

3. Use of the transcription factor EjBZR1 gene of claim 1 or the transcription factor EjBZR1 gene of claim 2 for inhibiting the expansion of plant organs and/or cells, or as a target for plant organ and/or cell growth.

4. Use of the transcription factor EjBZR1 gene inhibitor according to claim 1 or the transcription factor EjBZR1 inhibitor according to claim 2 for promoting the expansion of plant organs and/or cells.

5. A method for enlarging loquat fruit, comprising silencing EjBZR1 gene which is the transcription factor of claim 1 in loquat.

6. The method of claim 5, wherein the transcription factor EjBZR1 gene of claim 1 in loquat fruit is silenced using virus-induced gene silencing technology.

7. A recombinant vector comprising the transcription factor EjBZR1 gene according to claim 1 inserted therein.

8. A recombinant strain, characterized in that it is a strain carrying the recombinant vector of claim 7.

9. Use of the recombinant vector according to claim 7 or the recombinant strain according to claim 8 for promoting expansion of a plant organ and/or cell, wherein the recombinant vector is a recombinant gene silencing vector.

10. Use of the recombinant vector according to claim 7 or the recombinant strain according to claim 8 for inhibiting the expansion of plant organs and/or cells, wherein the recombinant vector is a recombinant overexpression vector.