CN110760582A

CN110760582A - Application of metformin in treatment of KRAS mutant colorectal cancer

Info

Publication number: CN110760582A
Application number: CN201910620051.7A
Authority: CN
Inventors: 高国全; 周倜; 杨霞; 谢晋烨; 夏良平; 何文卓
Original assignee: National Sun Yat Sen University
Current assignee: Sun Yat Sen University; National Sun Yat Sen University
Priority date: 2019-07-10
Filing date: 2019-07-10
Publication date: 2020-02-07
Also published as: WO2021004372A1

Abstract

The invention discloses a marker for determining a colorectal cancer treatment scheme, wherein the marker is KRAS gene and/or protein, and the KRAS mutant colorectal cancer is treated by metformin. The invention firstly confirms that the benefit of using metformin for KRAS mutant colorectal cancer patients is more remarkable, further confirms that the expression of MATE1 in a metformin discharge channel is reduced, is a key mechanism of sensitivity of KRAS mutant colorectal cancer cells to metformin, and enhances the action of inhibiting the proliferation of tumor cells by metformin by reducing the transcription level of MATE1 and increasing the concentration of metformin in the tumor cells. The invention provides a new thought and method for treating the colorectal cancer, has profound significance and is worthy of vigorous popularization.

Description

Application of metformin in treatment of KRAS mutant colorectal cancer

Technical Field

The invention relates to the technical field of colorectal cancer treatment, in particular to application of metformin in treating KRAS mutant colorectal cancer.

Background

Colorectal cancer (CRC) is one of the most common malignancies. At present, chemotherapy mainly based on oxaliplatin or irinotecan is combined with an anti-Epidermal Growth Factor Receptor (EGFR) monoclonal antibody, so that the median overall survival time of a colorectal cancer patient can be prolonged to more than 2 years. However, about 1/4 patients in China had tumor metastasis at the time of diagnosis, and the chemotherapy effect was poor. In addition, colorectal cancer is a gene-heterogeneous disease, and alterations (mutations or deletions) of genes such as APC, KRAS, TP53, BRAF, PIK3CA, and epigenetic changes such as microsatellite instability (MSI) and Chromosome Instability (CIN) play an important role in the process of intestinal polyps to carcinogenesis, tumor metastasis, and resistance to chemotherapeutic drugs. The KRAS gene mutation probability of Chinese colorectal cancer patients is as high as 30-50%, and a large number of clinical studies show that the patients cannot benefit from anti-EGFR targeted therapy, so that the colorectal cancer tumor related mortality rate in China shows a rapid rising trend.

Therefore, the development of treatment schemes and drugs for individual epigenetic changes of colorectal cancer patients, and the transition from traditional chemotherapy drugs without differential killing of cells to multi-target targeted drug therapy is the key of accurate tumor treatment.

Current therapeutic strategies for the presence of KRAS mutant CRC inhibit KRAS activation or inhibit activation of MEK/ERK, the downstream pro-proliferative signaling pathway of KRAS, but all end in failure of phase two clinical trials. The former because farnesylation transferase inhibitors do not completely inhibit KRAS activation, the latter may be associated with feedback activation of the PI3K/AKT signaling pathway.

Metformin is a first-line medicament for treating type 2diabetes at present, and can effectively reduce and maintain the blood sugar level and the insulin level of a patient and improve insulin resistance. In recent years, more retrospective studies show that metformin has a certain preventive and therapeutic effect on colorectal cancer, and the mechanism mainly comprises direct action on tumor cells: inhibiting the activation of MEK-ERK, PI3K-AKT and mTOR signaling pathways; and indirect effects on tumor cells: such as reducing and maintaining blood sugar and insulin level, inhibiting inflammatory reaction, increasing CD8+ T cell ratio, and improving tumor cell immunity. However, there are also some studies reporting that metformin does not improve the overall survival and progression-free survival of colorectal cancer patients.

The research suggests that the therapeutic effect of metformin on colorectal cancer may vary from type to type and from individual to individual, and the type and the individual for effectively treating colorectal cancer with metformin are not defined and the mechanism thereof is not clarified.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides application of metformin in treating KRAS mutant colorectal cancer.

It is a first object of the present invention to provide a marker for determining a treatment regimen for colorectal cancer.

It is a second object of the present invention to provide the use of KRAS gene and/or protein as a marker for determining a treatment regimen for colorectal cancer.

The third purpose of the invention is to provide the application of the KRAS gene mutation detection reagent in the preparation of a kit for determining a colorectal cancer treatment scheme.

The fourth purpose of the invention is to provide the application of the KRAS protein detection reagent in the preparation of a kit for determining a colorectal cancer treatment scheme.

It is a fifth object of the present invention to provide a kit for determining a treatment regimen for colorectal cancer.

The sixth purpose of the invention is to provide application of metformin in treating colorectal cancer or preparing a medicament for treating the colorectal cancer.

A seventh object of the invention is to provide the use of a combination of the MEK signaling pathway and the AKT signaling pathway as targets for the treatment of colorectal cancer.

An eighth object of the invention is to provide a combination of an inhibitor of the MEK signaling pathway and an inhibitor of the AKT signaling pathway for the treatment of KRAS mutant colorectal cancer.

A ninth object of the present invention is to provide a pharmaceutical composition for treating KRAS mutant colorectal cancer.

In order to achieve the purpose, the invention is realized by the following technical scheme:

1. retrospective studies were performed using a stratified Cox proportional hazards model, the first time it was determined that KRAS mutant colorectal cancer patients benefit more significantly with metformin. Provides evidence-based medical evidence for the selective use of metformin in the treatment of colorectal cancer in clinic.

2. A KRAS (G13D) point mutation model and a KRAS knockdown model are constructed in a cell experiment, and the sensitivity of KRAS mutant colorectal cancer cells to the anti-tumor effect of metformin is verified from the positive direction and the negative direction. The two pathways of inhibiting ERK/cyclin D1/RB and AKT/mTOR/4E-BP1 by metformin are simultaneously clarified to inhibit KRAS mutant colorectal cancer cell proliferation. Provides evidence for enhancing the effect of treating KRAS mutant colorectal cancer cells by clinically using MEK and AKT inhibitors in a combined way, and also provides experimental basis for taking metformin as an optional medicament.

3. The method is used for the first time to confirm that the expression of MATE1 in a metformin excretion channel is down-regulated, and is a key mechanism for the sensitivity of KRAS mutant colorectal cancer cells to metformin. The mutant KRAS protein is clarified, and the methylation of CpG islands of MATE1 promoter is promoted by up-regulating methyltransferase DNMT1 and down-regulating demethylase TET1/2, so that the transcription level of MATE1 is reduced.

4. Clinical specimens and cell experimental evidence suggest that metformin can be selectively used to treat colorectal cancer clinically by detecting the KRAS genotype.

The invention therefore claims the following:

a marker for determining a treatment regimen for colorectal cancer, the marker being KRAS gene and/or protein, KRAS mutant colorectal cancer being treated for colorectal cancer with metformin.

Use of a KRAS gene and/or protein as a marker for determining a colorectal cancer treatment regimen.

In particular, the KRAS mutant colorectal cancer is treated by metformin, wherein the KRAS mutant colorectal cancer continuously activates high expression after mutation of KRAS gene

The application of the KRAS gene mutation detection reagent in preparing a kit for determining a colorectal cancer treatment scheme also belongs to the protection scope of the invention.

The application of the KRAS protein detection reagent in the preparation of a kit for determining a colorectal cancer treatment scheme also belongs to the protection scope of the invention.

A kit for determining a colorectal cancer treatment regimen, the kit comprising KRAS mutant colorectal cancer detection reagents.

Use of metformin in the treatment or manufacture of a medicament for the treatment of colorectal cancer, said colorectal cancer being KRAS mutant colorectal cancer.

The KRAS mutant colorectal cancer does not limit the type of KRAS mutation, and the current experimental data support common mutations of codon 12.13.

Since MEK and AKT are important signal pathways for regulating cell proliferation in the downstream of KRAS, MEK inhibitor or AKT inhibitor alone fails in phase II experiments, and metformin inhibits MEK and AKT signal pathways at the same time, KRAS mutant colorectal cancer cell proliferation can be effectively inhibited.

The invention is therefore further claimed as follows:

use of a combination of a MEK signaling pathway, and an AKT signaling pathway, as a target for colorectal cancer therapy;

use of an inhibitor of the MEK signaling pathway in combination with an inhibitor of the AKT signaling pathway in the preparation of a medicament for the treatment of KRAS mutant colorectal cancer;

a pharmaceutical composition for treating KRAS mutant colorectal cancer comprising an inhibitor of the MEK signaling pathway and an inhibitor of the AKT signaling pathway.

Preferably, the above-described treatment of colorectal cancer is to promote the arrest phase of colorectal cancer cells G1, inhibit intestinal cancer cell proliferation, inhibit tumor enlargement, inhibit tumor weight gain, prolong the overall survival time of the patient and/or prolong the progression-free time of chemotherapy.

More preferably, the extended time to no progression of chemotherapy is an extended time to no progression of first-line chemotherapy.

The inhibitor is any substance capable of reducing the corresponding protein, gene or signaling pathway.

Compared with the prior art, the invention has the following beneficial effects:

the invention firstly confirms that the benefit of using metformin for KRAS mutant colorectal cancer patients is more remarkable, further confirms that the expression of MATE1 in a metformin discharge channel is reduced, is a key mechanism of sensitivity of KRAS mutant colorectal cancer cells to metformin, and enhances the action of inhibiting the proliferation of tumor cells by metformin by reducing the transcription level of MATE1 and increasing the concentration of metformin in the tumor cells. The invention provides a new thought and method for treating the colorectal cancer, has profound significance and is worthy of vigorous popularization.

Drawings

Figure 1 is a schematic diagram of a clinical patient inclusion group.

Figure 2 is a graph of the use of metformin to improve overall survival in diabetic colorectal cancer patients.

Figure 3 is a graph of metformin increasing overall survival time and progression-free survival time during first-line chemotherapy in KRAS mutant colorectal cancer patients.

FIG. 4 shows the intracellular gene modification pattern of SW48KRAS (G13D) cell line.

FIG. 5 is an alignment chart of KRAS exon2 GGC > GAC mutant positive clones.

Figure 6 shows that metformin inhibits KRAS mutant colorectal cancer cell growth.

Figure 7 shows that metformin inhibits KRAS mutant PDX tumor growth.

FIG. 8 shows that metformin promotes KRAS mutant colorectal cancer cell G1 phase arrest to inhibit tumor cell proliferation.

FIG. 9 shows the mechanism of metformin promoting KRAS mutant colorectal cancer cell G1 phase arrest inhibiting tumor cell proliferation.

Figure 10 shows that KRAS mutant colon cancer cells are more sensitive to metformin than KRAS wild-type colon cancer cells.

Figure 11 is the accumulation of metformin concentration in KRAS mutant colorectal cancer cells and PDX tumor tissue.

Figure 12 is a graph of the effect of KRAS mutation in down-regulating MATE1, thereby increasing metformin intracellular concentration and enhancing metformin's proliferation against colorectal cancer cells.

Figure 13 shows that KRAS mutations regulate MATE1 methylation and thereby down-regulate MATE1 expression.

FIG. 14 shows the sequence and primers of amplification of the MATE1 promoter CpG island after bisulfite modification of genomic DNA samples.

FIG. 15 shows the expression of DNMT/TET in SW48KRAS (G13D) cells and KRAS-knocked-down Lovo cells

FIG. 16 shows that KRAS mutation down-regulates MATE1 expression by modulating DMNT 1/TET.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

First, experimental material

Fresh tumor tissue

After the operation of removing the tumor in situ, the colorectal cancer patients diagnosed and treated by the center of tumor prevention and treatment of Zhongshan university are treated by taking cancer tissues of about 5X 5 mm. The collection of cases strictly follows the operation flow of the center for tumor prevention and treatment of Zhongshan university, and the patients themselves and their family members agree after the approval of hospitals.

Laboratory animal

Male nude mice (BALB/c nude mice) of 4-6 weeks old, weighing 14-18 g, purchased from experimental animal technology ltd, viton, beijing, production license number: SCXK (jing) 2016-: SYXK (Yue) 2017-. And (5) performing an experiment after the quarantine is qualified. In the process of feeding animals, five basic welfare of experimental animals are ensured, and the experimental process follows the 3R principle of Relacement, Reduction and Refinement.

Cell line

SW48 was purchased from Shenzhen Huatuo Biotech Co., Ltd, CaCO2, HCT-116 and LoVo were benefited by the gastroenterology institute of the sixth Hospital, affiliated to Zhongshan university, and SW480 and SW620 cells were laboratory-preserved cell lines. The STR identification of the 6 colorectal cancer cell strains is completed by Guangzhou Seiku Biotechnology limited, 100 percent of the STR identification is matched with information provided by ATCC, and no other cell pollution and STR change exist. The KRAS genotype of the above cells was queried from the ATCC official website and verified by PCR sequencing.

Second, Experimental methods

1. Photography, tumor pathological grading and proliferation cell quantification

1) Full tissue samples were photographed (10 x and 20 x) using a fully automated digital slide scanning system (Axio Scan Z1);

2) after the images are exported, pathologically grading the tumors by a pathologist, wherein the tumors are divided into high differentiation, medium differentiation, low differentiation and undifferentiated;

3) ki67 stained tumor tissue image the cell nucleus of Ki67(+) was quantitatively analyzed using IHC Profiler plug-in of ImageJ and recorded as proliferating cells;

2. cell activity assay (CCK-8 method)

Cells were plated at a concentration of 5000 cells/well (48 well plates, 200. mu.l per well volume). The cells were treated in different ways according to the experimental requirements and after a certain time 10. mu.l of CCK8 solution was added. Incubating for 1h in an incubator, sucking 200 mul of supernatant to a 96-hole enzyme label plate, and measuring OD by an enzyme label instrument₄₅₀。

Example 1 Effect of metformin on prognosis of patients with metastatic colorectal cancer

First, metastatic colorectal cancer patients with type 2diabetes mellitus and clinical characteristics among groups

1. Experimental sample

Of 4751 patients with metastatic colorectal cancer (mCRC) collected from the center for tumor prevention and treatment at the university of zhongshan in 2004-2016, 282 patients with type 2diabetes (T2 DM) who had been diagnosed before, were divided into a metformin (n ═ 109) group, an insulin or insulin-secretagogue (n ═ 141) group, and an untreated-diabetes (n ═ 32) group, and other sugar-lowering drugs (n ═ 22) group. Patient inclusion groups are shown in figure 1.

2. Experimental methods

Collecting general clinical characteristics of the patient, such as sex, age, Body Mass Index (BMI); and clinical features that have been reported to affect the outcome of mCRC (such as tumor primary site, pathological grade, metastatic site, first-line chemotherapy regimen and KRAS genotype) are used to exclude confounding factors, and thus to define the effect of metformin on Overall Survival (OS) and Progression Free Survival (PFS) of colorectal cancer patients with type 2 diabetes. The basic clinical profile information of the patients is shown in table 1.

Table 1 basic clinical information of colorectal cancer patients with incorporated type 2 diabetes:

and (4) counting whether the distribution of the individual clinical characteristics in the metformin group and the non-metformin group is different. Continuous variables (age, BMI) were analyzed using a one-way method, and categorical variables (sex, tumor primary site, pathological grade, KRAS genotype, metastatic site, first-line chemotherapy regimen, and age group, BMI group) were tested using chi-square test.

3. Results of the experiment

Statistical analysis of the 180 patients showed no statistical differences in sex, age, BMI, tumor primary site, pathological grade, metastatic site, KRAS genotype between the metformin and non-metformin groups (P > 0.05), see table 2.

TABLE 2 clear 180 patients with metastatic colorectal cancer with type 2diabetes mellitus with well-defined Kras genotype distribution profile in metformin and other hypoglycemic drugs

Bis, metformin increases overall survival and progression-free survival of first-line chemotherapy in patients with metastatic colorectal cancer complicated by type 2diabetes

Using Kaplan-Meier survival curve analysis, it was determined whether metformin improved the prognosis for patients with metastatic colorectal cancer with this central combined type 2diabetes, compared to the group taking other hypoglycemic drugs.

1. Experimental methods

Using GraphPad Prism 7 as a Kaplan-Meier survival curve, and carrying out Log-rank (Mantel-Cox) statistical analysis; additionally, the effect of different hypoglycemic agents on OS and PFS compared to the non-hypoglycemic treatment group was counted using the corrected risk ratio (stritified HR).

2. Results of the experiment

As shown in fig. 2, the median survival time was reduced by 11.2 months (P ═ 0.007) in the diabetes-complicated untreated group, and the median survival time was extended by 11.3 months (P ═ 0.022) in the metformin group, compared to the diabetes-complicated group, and no significant improvement was observed in the other hypoglycemic agents. The results show that the metformin can remarkably prolong the overall survival time of 282 patients with metastatic colorectal cancer combined with type 2diabetes mellitus diagnosed in 2004-2016 of the tumor prevention center of Zhongshan university. Additionally using corrected risk ratio statistics (see table 3), the blood glucose lowering treatment improved prognosis (HR ═ 0.547, 95% CI: 0.327-0.913); the single use or the combined use of the metformin can improve the prognosis of the mRC patient, but the effects of other hypoglycemic drugs have no statistical difference, so that the improvement effect of the metformin on the mRC prognosis can be related to other factors besides the reduction of blood sugar.

Table 3 effect of different hypoglycemic agents on OS and PFS compared to the non-hypoglycemic treatment group.

The effects of metformin on patient mortality or tumor progression fit the equal proportional risk hypothesis

1. Experimental methods

The proportionality risk assumption (pro-proportional hazard assessment) is made that the effect of metformin on patient death or tumor progression is not expected to change over time and should be a fixed value. We performed hypothesis testing using Kolmogorov-Smirnov test and Cramer von Mises test.

2. Results of the experiment

The results in Table 4 show that the effect of metformin on patient death or tumor progression fit an equal proportional risk hypothesis (P > 0.05).

TABLE 4 Equipmental Risk hypothesis for Effect of metformin on patient mortality or tumor progression

Fourth, the benefit of the KRAS mutant metastatic colorectal cancer patient using metformin is more remarkable

And (3) layering the collected clinical characteristics by adopting a layered Cox proportional risk model, and exploring individual factors influencing the effectiveness of the metformin.

1. Experimental methods

After the equal proportional risk hypothesis, we further hypothesized that gender, age, BMI, tumor primary site, pathological grade, metastatic site, and KRAS genotype may have an effect on the anti-tumor effect of metformin as a confounding factor. Therefore, we performed a hierarchical regression analysis (hierarchical regression analysis) on the above clinical features to determine the individual differences in interaction with metformin.

2. Results of the experiment

As shown in table 5, after the clinical characteristics are included as confounders in the equation of the proportional risk regression model, we can find that the risk ratio (HR) of the metformin to the death reduction is 0.746, the 95% Confidence Interval (CI) is 0.496 to 1.121, the interval spans 1, and there is no statistical difference (P > 0.05) compared to the use of other hypoglycemic drugs; HR to reduce tumor progression during first-line chemotherapy was 0.737, 95% CI was 0.501-1.086, and there was no statistical difference (P > 0.05), suggesting that there was an individual difference in whether using metformin could benefit metastatic colorectal cancer patients compared to other hypoglycemic agents.

Further stratification regression analysis of the above clinical characteristics showed that metformin, compared to other hypoglycemic agents, reduced the risk of death (HR 0.272, 95% CI 0.120-0.617) in KRAS mutant metastatic colorectal cancer patients, and also reduced the risk of tumor progression during first-line chemotherapy (HR 0.405, 95% CI 0.212-0.774). Furthermore, using the R language based EmpowerStats software for interaction testing, we found that KRAS mutations significantly potentiated the death risk reducing effects of metformin (P)_interaction<0.001) and reducing the risk of tumor progression during first-line chemotherapy (P)_{interaction＝}0.02). In addition, by analyzing the KRAS wild-type and KRAS mutant mCRC patients with the Kaplan-Meier survival curves, metformin significantly extended the overall survival time (P) of KRAS mutant mCRC patients<0.001) and progression-free survival time (P) of first-line chemotherapy<0.01) (fig. 3A-B), but not in KRAS wild-type mCRC patients (fig. 3C-D).

Table 5 analysis using a proportional risk regression model of metformin to overall and progression-free survival and its interaction with various clinical features:

penta-metformin inhibits KRAS mutant colorectal cancer cell proliferation

The effect of this clinical profile on metformin antitumor therapy was verified from immunohistochemical and cytological experiments on colorectal cancer tissue sections.

1. Experimental methods

(1) To further clarify the effect of metformin on KRAS mutant colorectal cancer cells, pathological sections (including primary and metastatic foci) of 28 patients who had been diagnosed with metformin prior to metastatic colorectal cancer concurrent tumor resection were collected, and paraffin tissue DNA was extracted for KRAS genotyping.

Tumor cell location (nuclear profusion, heterogeneity, glandular epithelial structure destruction) was judged by hematoxylin-eosin stain (H & E) and cells at proliferative stage were labeled with Ki67 stain.

① hematoxylin-eosin staining

1) Making the fixed tumor tissue into paraffin sections;

2) dewaxing the slices with xylene;

3) placing slices into methanol for fixation for 2 min;

4) staining with hematoxylin for 3 min;

5) color separation liquid: 70% alcohol + glacial acetic acid 10ml (several minutes, until the color is appropriate)

6) Returning the running water to blue for 5 min;

7) staining with eosin for 1 min;

8) 75%, 80%, 90%, 95% absolute ethanol for 30sec each;

9) 2-3 cylinders of 100% alcohol, 30sec per cylinder;

10) 3 cylinders of 100 percent dimethylbenzene, the first cylinder for 10min, and the second cylinder and the third cylinder for 5 minutes respectively.

11) And (5) sealing the neutral gum.

② Ki67 staining

1) Baking slices: at 65 ℃ for 2 h;

2) xylene dewaxing: 30min × 3 times, room temperature;

3) anhydrous ethanol: 10min × 1 time, room temperature;

4) hydration: 100%, 95%, 90%, 80%, 70% ethanol each for 5 min;

5)dH₂and (4) O washing: 5min × 1 time;

6) PBST washing: 5min × 3 times;

7) antigen retrieval: boiling 10mmol/L citrate buffer solution (pH 6.0)1L in pressure cooker, placing the slicing frame in the pressure cooker, completely immersing, covering the pot cover, controlling time for 2min after air is discharged, naturally cooling the buffer solution to room temperature, and taking out the slices;

8)dH₂and (4) O washing: 2min × 2 times;

9) PBST washing: 5min × 3 times;

10) blocking: drawing circles with immunohistochemical pen, adding 3% H2O2, and standing at room temperature for 30 min;

11) PBST washing: 5min × 3 times;

12) and (3) sealing: goat serum, room temperature 1h, then PBST washing 5min x 3 times;

13) primary antibody incubation: diluting Ki67 with antibody diluent at 1:400, covering the tissue, placing the slices in a wet box to prevent the slices from being dried, and keeping the temperature at 4 ℃ overnight;

14) PBST washing: 5min × 3 times;

15) secondary antibody: incubating the solution A of the immunohistochemical rat-rabbit universal detection kit for 30min at room temperature;

16) PBST washing: 5min × 3 times;

17) DAB color development: diluting the solution C with a 1:50 ratio by using the solution B of the immunohistochemical rat-rabbit universal detection kit, and continuously washing for 30min after the reaction of tap water is stopped;

18) hematoxylin counterstaining: 1min, differentiating with hydrochloric acid ethanol (1:1000) for 10s, and removing non-specific coloring; continuing washing for 20min after the tap water stops reacting;

19) and (3) dehydrating: 70%, 80%, 90%, 95%, 100% ethanol each for 5 min;

20) dehydrating and transparentizing xylene: 5min × 2 times, and sealing with neutral gum.

(2) The KRAS wild-type colorectal cancer cell lines SW48 and CaCO2, as well as the KRAS G13D mutant colorectal cancer cell lines HCT-116 and LoVo, and KRAS G12V mutant colorectal cancer cell lines SW480 and SW620 were treated in vitro with graded concentrations of metformin. In addition, KRAS wild-type colorectal cancer cell line SW48 transfected with KRAS G12V, KRAS G13D and KRAS G12D plasmids was treated with a gradient of metformin concentrations.

(3) In vitro, KRAS (G13D) mutant SW48 cell lines constructed by a CRISPR/Cas9 system are treated by metformin with gradient concentration, and the inhibition of KRAS mutant colorectal cancer cell activity by metformin is positively verified.

① KRAS G13D point mutation CRISPR/Cas9 plasmid construction

1) sgrna (sequence of guide rna) design: base of 250bp before the start code ATG of the No. 2 exon of KRAS gene on the No. 12 chromosome is designed on a website http:// criprpr.mit.edu provided by Zhang Lab, MIT. And (3) selecting sgRNAs with low off-target efficiency with the score of more than 85 points, setting the number of mismatched bases to be less than or equal to 2 by using an CRISPR RGEN tool Cas-OFFinder website http:// www.rgenome.net/Cas-offfinder/, and avoiding the occurrence of nonspecific cutting by not using the sgRNAs with mismatched bases. sgRNA we selected: 5'-GCATTTTTCTTAAGCGTCGA-3' are provided.

2) gRNA synthesis and ligation with recombinant vectors:

A. the gRNA oligo (PAGE purified) was chemically synthesized, the BbsI cleavage ligation site is underlined, and a cytosine base was added to the reverse sequence at the 3' -end instead of cytosine as follows:

Target sequence(PAM):GCATTTTTCTTAAGCGTCGA(TGG)；

Forward:CACCGCATTTTTCTTAAGCGTCGA；

Reverse:AAACTCGACGCTTAAGAAAAATGC；

B. oligo per OD Using ddH₂O (10. mu.L/1 nmol) was dissolved at a final concentration of 100. mu.M. The oligo was synthesized into double-stranded nucleotides according to the following reaction:

C. enzyme digestion: the plasmid pSpCas9(BB) -2A-puro (PX459) V2.0 was digested with Bbs I restriction enzyme, subjected to agarose electrophoresis, and recovered and purified by gel. The enzyme digestion conditions were as follows:

D. connecting: using T4 ligase to connect PX459 and gRNA, then carrying out agarose electrophoresis identification and gel recovery and purification, and marking as PX459/hKRAS gRNA. The connection conditions were as follows:

3) construction of KRAS G13D point mutation donor plasmid:

A. gene calling: firstly, extracting the genomic DNA of LoVo by using a genomic DNA extraction kit, then amplifying a DNA sequence of about 3000bp containing sgRNA and exon2 by a high-fidelity PCR method, identifying by running electrophoresis, recovering and purifying by glue. The PCR reaction system and conditions were as follows:

B. constructing a T vector: and (3) adding A into the purified DNA in the last step for reaction, connecting the DNA to a pGM-T vector, transferring the DNA to an allelochemical bacterium for amplification, and selecting a single clone for sequencing verification. The sequence was verified to be correct and was designated pGM-T/KRAS-homology. The addition of A and ligation reaction conditions were as follows:

C. TGG > TGA point mutation on PAM of sgRNA: amplifying sequences before sgRNA PAM TGG by using a high-fidelity PCR method, wherein primers are hKRAS-Left arm-F and hKRAS-TGG mut-Left arm-R, 15bp of sequences homologous with pGM-T3 'broken ends are introduced into the upstream, and a point mutation sequence CCA > TCA is introduced into the 5' end of a downstream primer; the primers of the other DNA fragment are hKRAS-TGG mut-Right arm-F and hKRAS-Right arm-R, the 5 'end of the upstream primer is introduced with a homologous sequence (including ACC > ACT) 15bp from the 3' end of the previous DNA fragment, and the 3 'end is introduced with a sequence homologous to the 5' end of pGM-T. PrimeSTAR Max Premix, the same as above, the reaction conditions were changed to 15s for extension time. And (3) after the 2 PCR products are recovered and purified by glue, connecting the PCR products with a pGM-T vector by using seamless cloning, and then performing glue recovery and purification, transformation, amplification and monoclonal sequencing. The seamless cloning reaction system and the reaction conditions are as follows:

D. the sequences for homologous recombination were ligated to the donor vector pDONR 221: by primer design, attB1 was introduced at the 5 'and 3' ends, respectively, and the fragment was ligated to pDONR 221 by BP reaction to form an Entry Clone, designated pDONR 221/hKRAS-homology plasmid. Primer design is shown in Table 6.

The primers used in table 6 were self-named and the corresponding sequences:

the pDONR 221 connection reaction system and conditions are as follows:

② construction of SW48KRAS (G13D) cell line

1) Passage of SW48 to 3cm³In the dish, when the cell fusion degree reaches 80% -90%, the fresh culture solution is replaced 2h ahead of time. Adding 1.5. mu.g PX459/hKRAS gRNA and 1.5. mu.g pDONR 221/hKRAS-homology plasmid into 150. mu.L opti-MEM, and adding 9. mu. L P3000; separately, 3.5. mu.L of Lipo3000 was added to 150. mu.L of opti-MEM, and the mixture was incubated at room temperature for 5 min. The plasmid premix was then added to the Lipo3000 premix, incubated at room temperature for 15min, and added dropwise to the SW48 cell culture.

2) 12h after transfection, the culture medium was replaced with fresh medium, and 1. mu.M of Scr7 was added to inhibit NHEJ reaction, thereby increasing the efficiency of homologous recombination (reported to be 4-5 times higher). After 24h of transfection, 1. mu.M puromycin was added and cells positive for transfection were selected.

3) After 72h of transfection, the culture medium was replaced with fresh medium to completely remove puromycin. If the cell fusion degree is 70% -90%, and the activity is better, the cells are passaged.

4) After passage, 1X 10 of the cells were sampled⁶Extracting genome DNA from each cell, performing PCR amplification by using hKRAS-Homology-F and hKRAS-Homology-R under the same steps and reaction conditions as above, connecting pGM-T only, converting into DH5 α for amplification, plating to pick about 30 clones for sequencing, and if the sequencing result has sgRNA PAM TGG>TGA and KRAS exon2 GGC>GAC mutation indicates successful homologous recombination. The intracellular gene modification pattern is shown in FIG. 4.

5) In the case of ensuring the cell viability of the SW48 mixed cell line, the cells were digested and resuspended, 200 cells were counted and the concentration was adjusted to 1/200. mu.L, and the cells were seeded into a 96-well plate at about 1 cell per 200. mu.L of culture medium.

6) Observing every other day, paying attention to the humidity of the incubator and preventing the culture solution in the 96-well plate from evaporating. After the single cell grows into clone, picking 20-50 clones for passage.

7) After the monoclonal cell lines were amplified, one bacterial clone was taken for each cell clone and sequenced as described above. The presence of KRAS exon2 GGC > GAC mutant was a positive clone. The stock preservation was designated as SW48KRAS (G13D) cell line. The positive sequence alignment is shown in FIG. 5.

(4) And (3) treating the lentivirus shRNA by using metformin with gradient concentration in vitro to construct a KRAS-reduced LoVo cell strain, and reversely verifying that the metformin inhibits the KRAS mutant colorectal cancer cell activity.

① construction of KRAS-stably knocked-down LoVo cell line

1) The KRAS interfering lentivirus (sh-KRAS) was constructed and packaged by Shanghai Jikai Gene Inc. and 2 targets were designed in total, as detailed in Table 7.

Table 7 sh-KRAS target sequence information:

2) passage of LoVo into 6-well plates (approx. 1X 10)⁵Hole), when the cell fusion degree does not exceed 50% after the adherence, the fresh culture solution is replaced 2h in advance, and 10 mug/mL polybrene of the lentivirus infection enhancer is added. LoVo has a Multiplicity of viral infection (MOI) of about 20, according to the formula: the amount of virus (μ l) per well-MOI × cell number/titer (TU/ml) × 1000 lentivirus addition. And changing the solution for 16-18 h, and conventionally adding 1 mu M puromycin to screen cell strains with stable KRAS interfering RNA expression.

2. Results of the experiment

Immunohistochemistry results show that there are 18 cases of KRAS wild type mCRC and 10 cases of KRAS mutant mCRC. As shown in fig. 3C, the proportion of Ki67(+) cells of KRAS mutant colorectal cancer tissue was significantly lower than KRAS wild type with significant statistical differences (P < 0.01).

Cell experiment results show that metformin has cell activity inhibition effect on KRAS G13D, G12D and G12V mutant colorectal cancer cells, but has no effect on KRAS wild type colon cancer cells (fig. 6).

Taken together, the results show that overall survival and progression-free survival of KRAS mutant colorectal cancer patients using metformin is longer compared to KRAS wild-type, and the same results were validated on tumor tissue sections and cell viability experiments.

Example 2 demonstration of the therapeutic Effect of metformin on KRAS mutant tumors in an animal model of tumors

Construction of PDX model

Using the PDX model: tumor tissues of clinical KRAS wild type and mutant colorectal cancer patients are taken, tumor cells are cultured by a digestion method, and the tumor cells are planted in axillary regions of nude mice after the KRAS mutation is identified.

1. Experimental methods

1) Collecting tumor specimens of patients: taking the cancer tissue with the necrotic edge from the excised specimen, soaking the cancer tissue in 5 percent fetal calf serum and PRMI1640 culture solution containing 1 Xpenicillin and streptomycin double antibody, and transporting the tissue at 4 ℃;

2) cutting tumor tissue into small pieces of 2 × 2 × 2mm in a clean bench, washing with the above culture solution for 3 times, and removing blood stasis;

3) anaesthetizing a BALB/C nude mouse of 4-6 weeks old by using 4.8% chloral hydrate, cutting a small opening of about 3mm on the underarm skin after anaesthetizing, carrying out blunt separation by using a forceps, burying the trimmed tumor tissue under the skin, suturing the incision by using a 6-0 suture, and preventing wound infection by using a double antibody;

4) taking 50mg tumor tissue to extract genome DNA for KRAS genotype identification, and storing the rest tissue at-80 ℃ for later use;

5) the tumor part after about 4 to 6 weeks is transplanted with small bump of about 1cm³Size, tumor tissue was removed and trimmed to 2X 2mm tissue blocks for passage. The passage operation was the same as above;

6) after about 2-3 generations, nude mice were divided into 4 groups: 10 KRAS wild type tumor control groups, KRAS wild type tumor metformin groups, KRAS mutant tumor control groups and KRAS mutant tumor metformin groups respectively;

7) when the transplanted tumor grows to 100-200mm³Thereafter, gavage was performed for 28 consecutive days at 9 am. The control group was intragastrically administered with physiological saline, and the metformin group was intragastrically administered with a metformin solution (100 mg/kg body weight of nude mice per day, physiological saline was dissolved). During the period, the size of the transplanted tumor, volume (mm) was measured daily³)＝[length×width²]/2；

8) Nude mice were sacrificed after 30 days, tumor tissues were taken for photographing, measurement, embedding and sectioning.

Therapeutic effect of metformin on KRAS mutant tumors

1. Experimental methods

Metformin 200mg/kg (equivalent to 1000mg in humans) was dissolved in water and drunk separately to KRAS wild type and mutant tumor animals, tumor size was measured, and tumor tissues were sacrificed 30 days later and weighed.

2. Results of the experiment

Compared with a KRAS wild type tumor model, the metformin can obviously inhibit the size and weight of KRAS mutant tumors. Metformin has a better treatment effect on KRAS mutant colorectal cancer, and the suggestion that patients with KRAS mutant can select metformin for clinical use, so that a basis is provided for drug development of KRAS mutant patients (figure 7).

Example 3 Effect of metformin on inhibition of KRAS mutant colorectal cancer cell proliferation

Action of metformin on colorectal cancer cell apoptosis

The effect of metformin on colorectal cancer cell apoptosis was examined on KRAS wild type cells SW48 and KRAS (G13D) mutant cells LoVo using Annexin V/PI double staining.

1. Experimental methods

1) Cells were seeded in 6-well plates, allowed to adhere for 12h, starved overnight, dosed for 24h, cells digested with EDTA-free trypsin, washed once with PBS and without fixation.

2) Adding 300. mu.l Binding Buffer to resuspend the cells, adding 3. mu.l Annexin V-FITC and 3. mu.l Propidium Iodide (PI), mixing, incubating at room temperature for 30min in the dark, and measuring on a machine by a flow cytometer.

3) Flow detection of antibodies: apoptosis kit (A211-02) was purchased from Kyoto; cell cycle PI single stain detection kit (558662) was purchased from BD.

2. Results of the experiment

Apoptosis was detected by Annexin V/PI double staining, and the results show that 2.5mM, 5mM and 10mM of metformin do not promote apoptosis of KRAS wild-type colorectal cancer cell SW48 and KRAS mutant colorectal cancer cell LoVo.

Action of bis-metformin on colorectal cancer cell proliferation

Edu is used for detecting the proportion of the proliferation cells, a plate clone formation experiment and PI/RNase single staining for detecting the cell cycle distribution condition, so that the effect of the metformin on the proliferation of the colorectal cancer cells is determined.

1. Experimental methods

(1) Proliferation assay (Edu method)

1) EdU treated cells: the cells were seeded in a petri dish (with a sterile cover glass placed), 12h after adherence, starved overnight, dosed for the appropriate time, and EdU (final concentration 10 μ M) was added for the last 2-6h (EdU treatment time depends on cell growth rate).

2) Fixing: 4% paraformaldehyde was added at 1 mL/well and fixed at room temperature for 15 minutes.

3) And (3) film washing: wash 2 times with 1 mL/well of 3% BSA (dissolved in PBS).

4) Membrane breaking: 0.5% TritonX-100, 1 mL/well, room temperature for 20 min.

5) And (3) film washing: the same as step 3.

6) Add ClickiT reaction mixture: 50 μ L/sheet, protected from light, 30min at room temperature.

7) And (3) film washing: 1 mL/well of 3% BSA (dissolved in PBS), washed 2 times and once again with PBS.

8) Dyeing the core: 50 μ L of DAPI (1: 3000, PBS configuration) were stained for 10min in the dark.

9) And (3) film washing: PBS wash 2 times.

10) Drying in dark, adding anti-quenching agent, and sealing with nail polish.

11) The analysis results were observed under a fully automatic upright fluorescence microscope and recorded by photography (100 ×, 200 ×, 400 ×, original image saved).

(2) Plate clone formation

1) Cell inoculation: removing culture solution, collecting cells, suspending the cells in the culture solution under treatment conditions, counting for 3 times, averaging, and adjusting cell suspension concentration to 1 × 10³And/ml. The 6-well plate was filled with 2.5ml of conditioned medium per well, and 0.5ml of cell suspension per well (i.e., 500 cells per well) for a final volume of 3 ml. During inoculation, the culture plate is shaken in the cross direction for many times, so that the cells are uniformly distributed as much as possible.

2) Cell culture: the cells were cultured under standard conditions for 2-3 weeks, the colony formation was observed, and the conditioned medium was changed approximately every 3 days.

3) Cloning and staining: the culture is terminated when the cells form macroscopic colonies (the number of colonies per well is around 50-150). Discarding the culture medium, carefully washing with PBS for 2 times, adding 4% paraformaldehyde 1.5ml per well, and fixing at room temperature for 15 min; removing the stationary liquid, washing with flowing water slowly, adding 1.5ml crystal violet solution into each well, standing at room temperature for dyeing for 30min, washing with flowing water slowly, and drying in fume hood.

4) And (3) clone counting: the plates were placed in a gel imaging system under visible light conditions with random software to count the number of clones, scan and store the images. The colony formation ratio (%) — the number of clones/number of seeded cells × 100%. Each group of cell samples was inoculated into 3 replicate wells and the experiment was repeated 3 times independently.

(3) Cell cycle assay

1) Cells were seeded in 6-well plates, allowed to adhere for 12h, starved overnight, treated with medication for 24h, digested and washed 3 times with PBS, centrifuged to remove supernatant, added dropwise with 70% ethanol pre-cooled at-20 ℃, vortexed to mix the cells, and fixed overnight at-20 ℃.

2) The mixture was centrifuged horizontally at 2000rpm for 10min, the supernatant was discarded and washed with PBS 2-3 times to remove residual ethanol, and each time was centrifuged for 5 min.

3) The cells were resuspended with 500. mu.L PI/RNase stain, incubated for 15min in the dark, detected by an up-flow cytometer within 2h, excitation wavelength 488 nm.

4) Mapping analysis was performed using FlowJo 7.6 software.

2. Results of the experiment

Metformin reduced the proportion of EdU-positive proliferating cells in KRAS mutant colorectal cancer cells LoVo, inhibited LoVo clonogenic capacity, while having no significant effect on KRAS wild-type colorectal cancer cells SW48 (fig. 8 a-b).

Flow-through results of the cell cycle showed that metformin concentration dependently increased the proportion of KRAS mutant colorectal cancer cell LoVo G1 phase cells, decreased the proportion of S phase cells, but had no significant effect on KRAS wild-type colorectal cancer cell SW48 (fig. 8 c).

The construction of the LoVo cell strain with the KRAS protein knocked down by using the lentivirus shRNA shows that the interference of the expression of the KRAS (G13D) can reduce the inhibition effect of metformin on the activity of LoVo cells and the inhibition effect of metformin on the transformation from the G1 phase to the S phase of the LoVo cells (figure 8d), and the KRAS (G13D) mutation constructed by using the CRISPR/Cas9 system can enhance the proliferation effect of metformin on anti-tumor cells and the cell cycle (figure 8 e).

Mechanism for inhibiting KRAS mutant colorectal cancer cell proliferation by metformin

Western blot is used for detecting the change of metformin on MEK/ERK/cyclin D1/RB and PI3K/AKT/mTOR/4E-BP1 related molecules of proliferation signal pathways, and a mechanism that metformin inhibits KRAS mutation to influence the proliferation of colorectal cancer cells is elucidated.

1. Experimental methods

① in vitro cell assay

1) Cells were seeded in petri dishes, cultured to 60% confluence, and dosed for 24 h.

2) After collecting the protein, the cell lysate was viscous by washing 3 times with PBS and adding 100. mu.l of 1 XSDS buffer (100mmol/l Tris-Cl pH6.8, 2% SDS, 10% glycerol).

3) Collect the cell lysate in a 0.5ml centrifuge tube with a cell scraper and cook for 30min at 100 ℃.

4) Protein quantification was performed on the total cell protein extract by BCA kit method (BIO-RAD Co.).

5) The sample was treated with 9. mu.l of denatured protein sample, 1. mu.l of denatured buffer (β -mercaptoethanol, 0.4% bromophenol blue), and boiled at 100 ℃ for 30min for further use.

6) The filled SDS-PAGE gel (10% separation gel and 5% concentrated gel) is added into the sample at 40 ug/well, and the electrophoresis is carried out at 80V for 30min and at 120V for 90 min.

7) The membrane was rotated at a constant current of 300mA for 180min, and the proteins on the gel were transferred to a PVDF membrane.

8) The membrane was blocked with 7% skim milk for 90min and added with the corresponding primary antibody and shaken overnight at 4 ℃.

9) The next day, the membrane was washed 3 times with TBST for 10min each time, and then the corresponding secondary antibody was added and incubated at 4 ℃ for 4 h.

10) After washing the membrane 3 times with TBST, ECL was added for exposure.

② PDX animal tumor tissue is homogenized to extract protein, and WB is performed.

2. Results of the experiment

After 24h of metformin treatment, the phosphorylation levels of ERK, RB, AMPK, AKT, mTOR and 4E-BP1 were inhibited in KRAS mutant colorectal cancer cells LoVo, and were not significantly changed in KRAS wild-type colorectal cancer cells SW48 (FIGS. 9A-C). Indicating that metformin can inhibit KRAS mutant colorectal cancer cell proliferation by simultaneously inhibiting ERK and AKT signaling pathways.

Changes in the KRAS (G13D) mutant SW48 cell lines, cyclinD1/RB and AKT/mTOR/4E-BP1 signaling pathways, constructed using the CRISPR/Cas9 system (fig. 9D) were consistent with KRAS mutant colorectal cancer cells LoVo. Construction of KRAS protein-knockdown LoVo cell lines using lentiviral shRNA, showed that interfering with KRAS (G13D) expression down-regulated the effect of metformin on inhibiting the phosphorylation of LoVo RB protein and 4E-BP1 (fig. 9E).

In PDX tumor tissues, metformin inhibited ERK and AKT signaling pathways in KRAS mutant colorectal cancer tissues (fig. 9F).

In conclusion, metformin promotes G1 phase arrest of KRAS mutant colorectal cancer cells, inhibits proliferation of tumor cells, and does not induce apoptosis; metformin can inhibit ERK and AKT simultaneously, and can reduce phosphorylation of RB and 4E-BP1 to inhibit KRAS mutant colorectal cancer cells.

The effect and mechanism of metformin on KRAS mutant colorectal cancer cells are verified for the first time, and simultaneously, evidence is provided for the effect of enhancing the treatment of KRAS mutant colorectal cancer cells by jointly inhibiting two pathways of ERK/cyclin D1/RB and AKT/mTOR/4E-BP 1.

Example 4 KRAS mutations enhance the sensitivity of colorectal cancer cells to metformin

The action of metformin for inhibiting colorectal cancer cell proliferation is related to intracellular concentration

The lansoprazole is used for inhibiting the absorption of metformin by cells, the activity of the cells is detected through CCK8, and the effect of metformin on inhibiting the proliferation of colorectal cancer cells is clearly related to the intracellular concentration.

The increase in concentration of metformin in KRAS mutant cells was confirmed using KRAS (G13D) mutant cells and KRAS stably knockdown LoVo cell lines constructed using the CRISPR/Cas9 system.

1. Experimental methods

HCT-116 and LoVo were treated simultaneously with 5. mu.M and 10. mu.M lansoprazole (lansoprazole), while the cells were treated with metformin for 48h, and the cell activity was examined with CCK 8.

Treating KRAS (G13D) mutant cells constructed by a CRISPR/Cas9 system and a LoVo cell strain with stably knocked-down KRAS by using metformin, collecting cell lysates at different time points, and detecting the concentration of metformin in cells by mass spectrometry.

The PDX model uses mass spectrometry to detect metformin concentrations in KRAS wild-type and mutant tumor tissues.

2. Results of the experiment

The CCK8 results showed that metformin had an IC50 of 90.83mM (95% confidence interval of 68.60-127.60), CaCO2 of 88.12mM (95% confidence interval of 74.71-106.92) for KRAS wild-type colorectal cancer cell SW48, and an IC50 of 23.71mM (95% confidence interval of 17.22-33.54) and LoVo of 8.18mM (95% confidence interval of 6.52-10.13) for KRAS mutant colorectal cancer cell HCT-116 (FIG. 10). IC of HCT-116 and LoVo after inhibition of metformin uptake by cells with lansoprazole₅₀Increased by more than 1.2-2.5 times (FIG. 11 a-b).

The mass spectrum result shows that compared with a control cell, the intracellular concentration of metformin is obviously increased in a KRAS (G13D) mutant cell constructed by the CRISPR/Cas9 system (FIG. 11 c); whereas the intracellular metformin concentration of the KRAS-stabilized knockdown LoVo cell line was significantly reduced relative to LoVo (fig. 11 d).

Mass spectrometry results showed that metformin treatment increased metformin concentration in KRAS mutant tumor tissues compared to KRAS wild-type tumor tissues (fig. 11 f).

II, RNA level of metformin channel protein in cells

The RNA level of the metformin channel protein in the cells was detected by analyzing the TCGA-COAD database, and differential expression between KRAS mutant colorectal cancer cell lines HCT-116 and LoVo, and KRAS wild-type colorectal cancer cells SW48 and CaCO2 was screened.

1. Experimental methods

(1) Real-time fluorescent quantitative PCR (RT-qPCR)

1) Extraction of RNA

The concrete steps are shown in the specification of an RNA extraction kit (CW0581) of biological science and technology limited Kangji of century.

2) Reverse transcription

The RNA concentration was measured with a Nanodrop UV spectrophotometer. 500ng of NA was reverse transcribed to cDNA as follows:

3)RT-qPCR

the instrument is a lighting cycler fluorescent quantitative PCR instrument or a CFX 96 fluorescent quantitative PCR instrument of BIO-RAD. The reagent is Takara corporation

Green I dye. The primers were synthesized using the primer-blast program design of PubMed, synthesized by Lifetechnology, with the primer sequences as follows:

the fluorescent quantitative PCR reaction procedure was as follows:

1) three-step method (high efficiency, but poor specificity):

① Pre-denaturation, 30s at 95 ℃, 1 cycle;

② PCR reaction, denaturation at 95 ℃ for 5s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 45s, 35 cycles;

③ melting curve analysis, 95 ℃ 0s, 65 ℃ 15s, 95 ℃ 0s, 1 cycle.

2) Two-step method (high specificity, but low efficiency):

① Pre-denaturation, 30s at 95 ℃, 1 cycle;

② PCR reaction, denaturation at 95 ℃ for 5s, annealing at 60 ℃ and extension for 30s, 40 cycles;

③ melting curve analysis, 95 ℃ 0s, 65 ℃ 20s, 95 ℃ 0s, 1 cycle.

(from

Premix Ex Taq II reagent Specification).

After PCR is finished, the specificity of the primers is judged by referring to a dissolution curve, and the Cp values obtained by reaction are corrected by using standard curves and internal references of different genes, and a control group is set as 1, and the images are analyzed and combined.

2. Results of the experiment

Analysis in the TCGA-COAD database and screening of RNA levels for the metformin channel of the cell line revealed reduced expression of KRAS mutant colorectal cancer cells (HCT-116 and LoVo) MATE1(SLC47a1) compared to KRAS wild-type colorectal cancer cells (fig. 12A). KRAS (G13D) mutant SW48 cell line MATE1(SLC47A1) was reduced in expression (FIG. 12B), and sh-KRAS-LoVo MATE1(SLC47A1) was increased in expression (FIG. 12C).

Expression level of MATE1

The differentially expressed MATE1 was screened and then verified on clinical specimens by immunohistochemistry and verified by intracellular gene overexpression or knock-down experiments.

1. Experimental methods

Immunohistochemistry (p-RB labelling) was as in example 1.

2. Results of the experiment

Immunohistochemistry results of clinical specimens showed that KRAS mutant colorectal cancer MATE1 protein levels were reduced compared to KRAS wild-type colorectal cancer; furthermore, in clinical specimens of patients with metastatic colorectal cancer taking metformin, the expression of MATE1 was proportional to the expression of the cell proliferation index p-RB (fig. 12D).

The positive experiment of over-expressing MATE1 on LoVo or the reverse experiment of interfering MATE1 on SW48 proves that the expression of MATE1 is down-regulated, and the effect of metformin on inhibiting the proliferation of colorectal cancer cells is promoted (FIG. 12E-F).

The expression of MATE1 and a transcription factor Sp1 is detected by Western blot, and the result shows that the expression of MATE1 of colorectal cancer cells is not related to the expression of Sp 1.

Fourthly, verifying the function of MATE1 with low expression in the tumor inhibiting effect of metformin in vivo

The role of MATE1 in the tumor-inhibiting effect of metformin was verified by a cell-derived xenograft model (CDX) experiment.

1. Experimental methods

In cell-derived xenograft model (CDX) experiments, we first established KRAS using CRISPR/Cas9^G13DSW48 cell line; MATE1 is knocked out through shRNA lentivirus transduction in SW48 to construct an sh-MATE1-SW48 cell strain; KRAS^G13DLentivirus infection in SW48 cells overexpresses MATE 1. 1X 10⁶Individual cells were suspended in basement membrane matrix (100 μ l high concentration basement membrane matrix and 100 μ l PBS)) and injected subcutaneously into BALB/c nude mice. CDX mice were randomly divided into metformin-treated and control groups. Metformin 200mg/kg (equivalent to 1000mg in humans) was dissolved in water and administered to four groups of animals, respectively, and the tumor size was measured, and tumor tissues were sacrificed 30 days later and weighed.

2. Results of the experiment

The results show that metformin therapy in the SW48 xenograft model has no obvious antitumor effect compared with the control, but after MATE1 is knocked down, the metformin therapy obviously inhibits SW48+ sh-MATE1 tumor growth. In contrast, and KRAS^G13DSW48 tumor compared with metformin in KRAS after MATE1 overexpression^G13DSW48 was not effective in xenografts (FIGS. 12G-L).

Fifthly, the difference of the methylation level of CpG islands of MATE1 gene promoters

Analysis and related statistics by mRNA-seq and Methylarray 450K data in the TCGA-COAD database suggest that MATE1 expression is inversely correlated with MATE1 promoter methylation in colorectal cancer cells (FIG. 13A).

Differences in methylation levels of the MATE1 gene promoter CpG island between KRAS mutant colorectal cancer cell lines HCT-116 and LoVo, and KRAS wild-type colorectal cancer cells SW48 and CaCO2 were detected using bisulfite sequencing.

1. Experimental methods

(1) DNA bisulfite sequencing (bisulfate sequencing PCR, BSP)

1) DNA sodium bisulfite modification:

A. extracting genome DNA, and then carrying out sodium bisulfite reaction of 5mC > U according to the following reaction system and reaction conditions:

B. DNA purification after bisulfite treatment is described in the DNA bisulfite conversion kit (DP215) product Specification.

2) PCR amplification and T-vector ligation:

A. after the genomic DNA sample was modified with bisulfite, mat 1 promoter CpG islands were amplified, and the sequences and amplification primers are labeled as shown in fig. 14 (boxed primer sequences, underlined CpG sites).

The PCR reaction system and conditions were as follows:

B. and (3) recovering and purifying the glue, then carrying out blunt-end PCR product and A reaction, connecting the mixture to a T vector pGM-T, transforming the mixture into competent bacteria, amplifying the competent bacteria, and selecting 5 monoclonals for sequencing, wherein the specific steps are the same as those in example 3.

3) Analysis of methylation sites and methylation levels: the sequencing results were analyzed directly using the website http:// quma.cdb.riken.jp/QUantification tool for Methylation Analysis (QUMA), dot plots were selected, each dot representing 1 CpG site, white for unmethylated and black for methylated, for a total of 34 CpG sites.

(2) Hydroxymethylated DNA quantitation

1) Hydroxymethylated DNA immunoprecipitation (Hydroxymethylated DNA immunoprecipitation, hMeDIP):

A. the genomic DNA was extracted and fragmented into about 400bp fragments by ultrasonication using a sonic ultrasonicator at 25% energy at a frequency of 10s/pulse × 4 pulses at intervals of 40 s.

B. The DNA fragment containing 5hmC was enriched using the hMeDIP ChIP kit from Abcam. The concrete steps refer to the specification of hMeDIP ChIP Kit (ab117134) of Abcam company.

2) Semi-quantitative analysis by RT-qPCR: RT-qPCR primers are as follows, and RT-qPCR reaction systems and conditions are as described above. Unenriched DNA was used as a correction.

2. Results of the experiment

Through bisulfite sequencing PCR, methylation levels of the MATE1 promoter were found to be higher in KRAS mutant colorectal cancer cells HCT-116 and LoVo compared to KRAS wild-type colorectal cancer cells SW48 and CaCO2 (fig. 13B).

Sixthly, KRAS mutation regulates and controls MATE1 expression by regulating and controlling methylation level of MATE1 promoter

And (3) constructing a KRAS-knocked LoVo cell strain and a KRAS (G13D) mutant SW48 cell strain constructed by a CRISPR/Cas9 system by using lentivirus shRNA, and verifying the KRAS mutation in a forward and reverse direction to regulate the methylation level of a MATE1 promoter so as to regulate the expression of MATE 1. The methylation level of MATE1 was detected in PDX KRAS mutant and wild type tumor tissues.

1. Experimental methods

Methylation level was determined as above.

2. Results of the experiment

The KRAS (G13D) mutant SW48 cell strain constructed using CRISPR/Cas9 system has increased methylation level of MATE1 promoter (fig. 13C); construction of KRAS-knockdown LoVo cell lines using lentiviral shRNA, reduced methylation levels of MATE1 promoter (FIGS. 13D-E); methylation levels of MATE1 were significantly increased in PDX KRAS mutant tumor tissues compared to wild-type (fig. 13F).

Hepta, differential expression and validation of methyltransferases and demethylases

And detecting the RNA level of the cell line, screening the differentially expressed methyltransferase and demethylase, and verifying the construction of a KRAS-knocked LoVo cell strain and a KRAS (G13D) mutant SW48 cell strain constructed by a CRISPR/Cas9 system in clinical samples and lentiviral shRNA.

1. Experimental methods

The RNA detection method is as above, and the primers are as follows

2. Results of the experiment

Differential expression of cell lines methyltransferases and demethylases was examined, suggesting that methyltransferases DNMT1, DNMT3A were up-regulated in KRAS mutant colorectal cancer cells and demethylase TET1/2 was down-regulated in KRAS mutant colorectal cancer cells (fig. 15 a). TET1/2 was upregulated in the construction of KRAS-knockdown LoVo cell lines using lentiviral shRNAs (FIG. 15 b).

Meanwhile, the expression of DNMT1 and TET1 was verified in 59 colon cancer samples using histochemical staining, and the proportion of the number of cells strongly positive for nuclear staining was calculated using ImageJ software. The results show that DNMT1 protein levels were higher in KRAS mutant colon cancer tissues than KRAS wild-type (P ═ 0.0003), whereas expression of TET1 was not significantly different between the two groups (P ═ 0.2989). The results of the Spearman rank correlation analysis showed that there was a significant negative correlation between the proportion of strongly positive cells for DNMT1 and the expression of MATE1 (r ═ -0.66P <0.0001, n ═ 59) (fig. 16A). Increased DNMT1 expression and decreased TET1 expression in KRAS-mutated PDX tumor tissue (FIG. 16B)

The results of KRAS (G13D) mutant SW48 cell lines constructed by the CRISPR/Cas9 system show that DNMT1 expression is increased, TET1/2 expression is reduced (FIG. 16C), and DNMT1 expression and TET1/2 expression are increased in LoVo cell lines with KRAS knocked-down constructed by lentiviral shRNA (FIG. 16D).

The methylase inhibitor azacitidine was used in LoVo cells and KRAS (G13D) mutant SW48 cell lines to up-regulate the expression of MATE1 in KRAS mutant colorectal cancer cells, thereby inhibiting the effect of metformin on anti-tumor proliferation (fig. 16E-F). Interference with TET1/2 in KRAS-knocked-down LoVo cell lines re-downregulated the expression of MATE1, promoting the effect of metformin on inhibiting tumor cell proliferation (fig. 16G).

In conclusion, the KRAS mutation down-regulates MATE1, so that the concentration of metformin in cells is increased, and the effect of metformin on inhibiting the proliferation of colorectal cancer cells is enhanced. Clinically, the colorectal cancer can be treated by selectively using metformin through detecting the KRAS 2 exon genotype.

Claims

1. A marker for determining a treatment regimen for colorectal cancer, wherein said marker is KRAS gene and/or protein.

Use of KRAS gene and/or protein as a marker for determining a colorectal cancer treatment regimen.

Use of a reagent for detecting a mutation in the KRAS gene in the manufacture of a kit for determining a treatment for colorectal cancer.

Use of a reagent for detecting KRAS protein in the manufacture of a kit for determining a treatment for colorectal cancer.

5. A kit for determining a treatment regimen for colorectal cancer, the kit comprising KRAS mutant detection reagents, wherein the KRAS mutant colorectal cancer is treated with metformin.

6. Use of metformin in the treatment of colorectal cancer or in the manufacture of a medicament for the treatment of colorectal cancer, wherein the colorectal cancer is KRAS mutant colorectal cancer.

Use of a combination of the MEK signaling pathway and the AKT signaling pathway as a target for the treatment of colorectal cancer.

Treating KRAS mutant colorectal cancer with an inhibitor of the MEK signaling pathway in combination with an inhibitor of the AKT signaling pathway.

9. A pharmaceutical composition for treating KRAS mutant colorectal cancer comprising an inhibitor of the MEK signaling pathway and an inhibitor of the AKT signaling pathway.