CN110760001B

CN110760001B - Construction and application of chimeric antigen receptor T cell secreted by GM-CSF knockdown and neutralizing single-chain antibody thereof

Info

Publication number: CN110760001B
Application number: CN201910686302.1A
Authority: CN
Inventors: 请求不公布姓名
Original assignee: Zhejiang Kai Xin Biotechnology Co ltd
Current assignee: Zhejiang Kai Xin Biotechnology Co ltd
Priority date: 2019-07-29
Filing date: 2019-07-29
Publication date: 2023-03-24
Anticipated expiration: 2039-07-29
Also published as: CN110760001A

Abstract

The invention discloses an anti-GM-CSF scFv secreting neutralizing GM-CSF, and construction and application of a fourth generation Chimeric Antigen Receptor (CAR) -T cell with a knocked-down GM-CSF gene. According to the invention, the anti-GM-CSF scFv for neutralizing GM-CSF is secreted and GM-CSF gene in CAR-T cells is combined for knock-down, so that the generation and development of cytokine release syndrome and neurotoxicity are prevented or slowed down, and the overall safety of CAR-T therapy is improved. In addition, the nucleotide sequence encoding microRNA is inserted into the EF1 alpha promoter, so that the packaging titer of the lentiviral vector is not influenced.

Description

Construction and application of chimeric antigen receptor T cell secreted by GM-CSF knockdown and neutralizing single-chain antibody thereof

1. Field of the invention

The patent belongs to the field of biotechnology engineering, and particularly relates to construction and application of anti-GM-CSF scFv secreting neutralizing GM-CSF and fourth-generation Chimeric Antigen Receptor (CAR) -T cells combining GM-CSF gene knockdown.

2. Technical background:

CAR-T therapy is a cellular immunotherapy based on chimeric antigen receptors. By in vitro gene transfer techniques, gene sequences encoding Chimeric Antigen Receptors (CARs) are transferred into T cells, generating tumor-specific T cells that can bind to a target antigen. In recent years CAR-T has shown surprising efficacy in the treatment of hematological malignancies, but the use of this therapy has been limited by its associated toxic side effects, including primarily cytokine release syndrome and neurotoxicity. The cytokine release syndrome refers to the process of action of immune cells and tumor cells, which releases a large amount of cytokines, and these cytokines trigger further chain reactions, such as excessive inflammatory reactions (e.g. high fever and chill, low blood pressure, dyspnea, blood coagulation disorder, etc.), thereby causing organ damage and brain swelling, and finally endangering life. The clinical manifestations of CAR-T neurotoxicity include headache, confusion, cognitive changes, hallucinations, speech disorders, ataxia, apraxia, facial nerve paralysis, tremor, dysdiscrimination and epilepsy. Recent studies have shown that: because the monocyte and the macrophage participate in the generation and development of cytokine release syndrome and neurotoxicity after CAR-T cell treatment, the neutralization of GM-CSF or GM-CSF gene knockout by a Lenzilumab antibody can prevent or delay the generation of the cytokine release syndrome and the neurotoxicity, and the function of the CAR-T cell can be obviously enhanced.

The invention utilizes the RNA interference technology to efficiently knock down GM-CSF expression in CAR-T cells, combines and secretes anti-GM-CSF scFv for expressing and neutralizing GM-CSF, prevents or slows down cytokine release syndrome and neurotoxicity, and improves the overall safety of CAR-T therapy.

In addition, if the nucleotide sequence coding microRNA is positioned at the downstream of an EF1 alpha promoter of the lentiviral vector, the transport and processing of 293T cell endogenous microRNA are interfered, and the packaging titer of the lentiviral vector is obviously reduced, so that the nucleotide sequence coding microRNA is inserted into the EF1 alpha promoter.

3. The invention content is as follows:

aiming at the great toxic and side effects (cytokine release syndrome and neurotoxicity) of CAR-T therapy, a CAR-T cell secreting anti-GM-CSF scFv and MIRCRORNA targeting GM-CSF is invented (taking the fourth generation CAR-T targeting CD19 as an example), so as to improve the overall safety of CAR-T therapy.

The method comprises the steps of constructing a plenti-CD19 (microRNA # GM-CSF) -anti-GM-CSF scFv plasmid vector by a genetic engineering technology, then packaging a lentiviral vector by a high-titer and high-purity lentivirus large-scale production process to transduce T cells, respectively detecting the expression rate of anti-CD19CAR by flow type after five days of culture, and verifying the in-vitro killing effect of the CAR-T cells on CD 19-expressing positive cells in vitro. Compared with the prior art, the invention relates to the following advantages:

1. according to the invention, by knocking down GM-CSF gene in CAR-T cells and combining anti-GM-CSFscFv secreting and neutralizing GM-CSF, the generation and development of cytokine release syndrome and neurotoxicity are prevented or slowed down, so that the overall safety of CAR-T therapy is improved.

2. In order not to affect the packaging titer of the lentiviral vector, the nucleotide sequence encoding the microRNA is inserted into the EF1 alpha promoter.

4. Description of the drawings:

FIG. 1 is a schematic diagram of the plenti-anti-CD19-anti-GM-CSF scFv plasmid.

FIG. 2 is a schematic diagram of the plenti-anti-CD19 (GM-CSF knockdown) -anti-GM-CSF scFv plasmid.

FIG. 3 shows the inhibition efficiency of anti-CD19 (GM-CSF knockdown) -anti-GM-CSF scFv against GM-CSF, which was measured by ELISA for the GM-CSF content in cell supernatants.

FIG. 4 shows that flow cytometry analysis of GM-CSF targeting microRNA significantly inhibited the production of GM-CSF in CAR-T cells.

FIG. 5 is a graph showing the killing activity of anti-CD19CAR, anti-CD19 (GM-CSF knockdown) -anti-GM-CSF scFv fourth generation CAR-T cells on target cells Raji expressing luciferase, measured by luciferase assay under various effect-target ratio conditions.

5. Detailed description of the preferred embodiments

The main experimental materials: ecoR V-HF, mluI-HF, ndeI restriction enzymes (NEB), seamless cloning enzymes (and metabiol), high fidelity Prime GXL STAR enzyme (TAKARA), transStbl3 competent cells (Takara, inc.), plasmid Mini Kit I (OMEGA),

plasmid Maxi Kit (QIAGEN), DMEM, RPMI-1640, opti-MEM medium, gibco FBS (Thermo Fisher Scientific), sanger sequencing (Shanghai Sangnie Biotech Co., ltd.), naCl, yeast powder, peptone, EDTA, naOH (Shanghai Biotechnology Co., ltd.), primers (Jiangsu jin Zhi Biotechnology Co., ltd.).

1. Construction of recombinant plasmids

(1) Construction of the plenti-CD19-anti-GM-CSF scFv recombinant plasmid:

the anti-GM-CSF scFv (SEQ ID NO. 5) was synthesized by Jin Weizhi Biotechnology Ltd, suzhou, using Ndel and MluI-HF double digestion plenti-EF1a-anti-CD19CAR vector and the synthesized anti-GM-CSF scFv gene, so that both of them had Ndel and MluI cohesive ends, the reaction conditions were 37 ℃ for 3h and 65 ℃ for 20min, and the digestion system was as shown in Table 5. The enzyme digestion product is subjected to 1% agarose gel electrophoresis to obtain a carrier fragment, and then a XYGENE gel recovery kit is used for recovering the Plenti carrier fragment and the anti-GM-CSF scFv (the operation steps are shown in the following table 3), and the concentration and the purity are detected. The vector fragment and the target fragment are subjected to T4 cloning (the system is shown in Table 4), 16-24h at 16 ℃ and 10min at 65 ℃, and then plasmid transformation is carried out (after a T4 clone product is placed on ice for 5min, the T4 clone product is transferred into 50ul TransStbl3 competence, is placed on ice for 30min, is placed at 42 ℃ for 45s, is placed on ice for 5min, is added with 500ul LB, is activated in a shaker at 37 ℃ and 225rpm/min for 1h, is centrifuged at 5000rpm/min for 5min at 20 ℃, is discarded, and the rest bacterial liquid is uniformly mixed and plated and is cultured at 37 ℃ for 12-14 h). Selecting a monoclonal colony, carrying out bacterial liquid amplification at 37 ℃,250rpm/min for 12-14h, extracting plasmids, carrying out enzyme digestion identification by AFLII-HF restriction enzyme, and finally carrying out Sanger sequencing. The plasmid scheme is shown in figure 1:

(1) constructing a plenti-CD19 (GM-CSF gene knock-down) -anti-GM-CSF scFv recombinant plasmid:

the GM-CSF targeting microRNA (SEQ ID NO.3, SEQ ID NO. 4) was synthesized by Jin Weizhi Biotech, suzhou, using EcoR V-HF single enzyme digestion of plasmid plenti-CD19-anti-GM-CSF scFv at 37 ℃ for 3h and 65 ℃ for 20min, and the enzyme digestion system is shown in Table 3. The enzyme digestion product is subjected to 1% agarose gel electrophoresis to obtain a vector fragment, and then a XYGENE gel recovery kit is used for recovering the Plenti vector fragment (the operation steps are shown in the following table 3), and the concentration and the purity are detected. The microRNA targeting GM-CSF is amplified by PCR, primers are shown in the following table 1, the system is shown in the following table 2, the temperature is 98 ℃ for 10 seconds, the temperature is 60 ℃ for 15 seconds, the temperature is 68 ℃ for 30 seconds, 35 cycles are carried out, a carrier fragment is obtained by carrying out electrophoresis on a PCR product through 1% agarose gel, and then the PCR product is recovered by using a XYGENE gel recovery kit. The vector fragment and the target fragment were subjected to seamless cloning (system shown in Table 6), at 37 ℃ for 1 hour, and then plasmid transformation (seamless cloning product was placed on ice for 5 minutes, transferred to 50ul TransStbl3 competence, placed on ice for 30min, at 42 ℃ for 45s, then on ice for 5 minutes, added with 500ul LB, activated in a shaker at 37 ℃ and 225rpm/min for 1 hour, then centrifuged at 5000rpm/min for 20 minutes at 20 ℃ for 5 minutes, the supernatant was discarded, the remaining bacterial solution was mixed well and plated, and cultured at 37 ℃ for 12-14 hours). Selecting a monoclonal colony, carrying out bacterial liquid amplification at 37 ℃,250rpm/min for 12-14h, extracting plasmids, carrying out enzyme digestion identification by AFLII-HF restriction enzyme, and finally carrying out Sanger sequencing. The plasmid scheme is shown in figure 2:

TABLE 1 primer sequences

primer1(SEQ ID NO.1)	ATGCGGGCCAAGATCTGAT
		primer2(SEQ ID NO.2)	ACCAGTGTGCAGATCTGATAT

TABLE 2 PCR System

TABLE 3 recovery of gums

TABLE 4 T4 cloning System

TABLE 5 restriction enzyme cleavage System

TABLE 6 seamless cloning System

2. 293T cells were transduced with the Plenti vector plasmid and helper plasmid to package lentiviruses, and the packaged lentiviruses were transfected into Jurkat Cell to calculate virus titers.

(1) Culturing 293T cells in a 15cm cell dish, and after the 293T cells are fully grown to 70% of the full field of view, re-suspending 60ugPEI with 1.5ml PBS, and re-suspending Plunti vector plasmid and helper plasmid with the total mass of 20ug with 1.5ml PBS;

(2) Standing at room temperature for 5min, adding the PBS-PEI mixed solution into the PBS-DNA mixed solution, and standing at room temperature for 20min;

(3) Preparing OPTI-DMEM full culture in an incubator at 37 ℃ for rewarming, sucking out a DMEM original culture medium in 293T cells, and adding the OPTI-DMEM into the 293T cells along the dish wall;

(4) Adding the PEI-DNA-PBS mixed solution into a culture dish, and culturing for 48h at 37 ℃;

(5) Collecting the lentivirus in the supernatant in a 50ml centrifuge tube, adding 20ml of culture medium, and incubating for 24h to collect the virus within 72 h;

(6) Centrifuging at 1500rpm for 5min to remove cell debris, or filtering with 0.45um filter, centrifuging at 3000 Xg for 12-14h at 4 deg.C to concentrate virus;

(7) Removing supernatant by aspiration, adding Vivo whole culture or AIM-V Quan Pei (preferably plus 1% HEPES) at a ratio of 1: 200 to 1: 400, and resuspending the virus;

(8) The virus is subpackaged in 1.5ml Ep tubes, the Ep tubes are preserved at the temperature of-80 ℃, repeated freeze thawing is avoided (the titer is reduced by one order of magnitude by freeze thawing), and a little virus is used for the next virus titer detection experiment;

(9) Centrifuging Jurkat cells at 1500rpm for 5min, discarding the supernatant, resuspending in 1ml 1640 culture medium, and counting;

(10) Adding 0.5x10 to 96-well plate ⁶ Jurkat cells, adding viruses in gradient proportion of 1: 50, 1: 500, 1: 1000, 1: 2000 and the like, and supplementing a culture medium until the total volume of each hole is 200ul;

(11) 0.1ul polybrene B protein per well for promoting transduction (0.1 ul/200ul system);

(12) Centrifuging a 96-well plate at 1200g and 90min at 32 ℃, and incubating for 4 hours in an incubator at 37 ℃;

(13) Blowing and uniformly mixing Jurkat cell suspension of each well of a 96-well plate, transferring the mixture to a 1.5ml Ep tube, centrifuging the mixture at 1500rpm for 5min, discarding supernatant, carrying out whole-culture and heavy suspension by using 1ml 1640, transferring the mixture to a 24-well plate, carrying out enlarged culture for 48h, and carrying out 37 ℃.

3. Separating Peripheral Blood Mononuclear Cells (PBMC) of healthy people by density gradient centrifugation, transfecting T cells with lentiviruses and detecting the expression condition of CAR on the surface of the T cells

(1) Taking 10ml of peripheral blood of a healthy person to an EDTA-Na2 anticoagulation tube, and uniformly mixing the anticoagulation tube with the DPBS according to the ratio of 1: 1;

(2) Taking four 15ml sterile centrifuge tubes, respectively adding 5ml of Ficoll separating medium, slowly adding the mixed solution of peripheral blood and DPBS onto the surface of the Ficoll separating medium, and paying attention not to damage the liquid surface;

(3) Horizontally centrifuging at 800g,20min,25 deg.C, and adjusting the acceleration and deceleration to "0";

(4) After centrifugation, sucking out the white flocculent layer, namely the PBMC layer, in the centrifuge tube by using a Pasteur pipette, placing the centrifuge tube in a new sterile centrifuge tube, adding PBS, and centrifugally washing the PBMC twice;

(5) Centrifugation at 1500rpm/min for 5min, discarding supernatant, adding 1ml Buffer1 (DPBS 5% FBS) to resuspend and count PBMC;

(6) The proportion of CD3 positive cells in PBMCs was determined by flow cytometry. CD3/CD28beads (106 CD3 positive cells plus 30ul beads) are added into the cell suspension at the ratio of CD3/CD28dynabeads to CD3 positive cells = 3: 1, and the magnetic strain is rotated and shaken at the speed of 1rpm for 30min at 4 ℃ to be fully contacted and combined with the cells;

(7) After 30 minutes, adding enough Buffer1 (more than 1 ml) into the test tube, then placing the test tube on a magnetic frame, rotating left and right for 1-2 minutes, and absorbing and removing supernatant;

(8) Preparing a Vivo complete culture medium: vivo air culture +5 FBS +1% HEPES +1% sodium pyruvate +1% nonessential amino acids + 1: 30 Glutamine + 1: 10000 IL-2+1: 2000 IL-7+1: 2000IL-15, and resuspend the cells and magnetic beads with Vivo full culture, counting;

(9) The media was added to give a concentration of CD3 positive cells between 0.5 and 1X 106/ml. The concentration of the plated cells is 0.5 to 1.0 multiplied by 106/ml, and the plated cells are cultured in an incubator at 37 ℃;

(10) T cell culture 24-36h,5% CO2, 37 ℃;

(11) CAR lentiviral vectors were transduced at MOI values =5, 20, 40, 80 over 24-36h, MOI (number of viral infections) = [ viral titer x viral volume (ml) ]/cell number;

(12) 1200Xg,90min, after centrifugation at 4 ℃, the cells were incubated in an incubator at 37 ℃ until the 96-well plate was full of cells, and then transferred to a 24-well plate, and CAR transduction rate was measured 5 to 7 days later.

4. ELISA confirmed that anti-GM-CSFscfv could neutralize GM-CSF produced by T cells.

(1) Supernatant of the plenti-CD19-anti-GM-CSF scFv CAR-T cell-secreting cells was retained and ready for detection.

(2) Reagents and standards were prepared.

(3) Soaking the enzyme label plate: adding 300ul of lotion, soaking for 30s, and patting the microporous plate on absorbent paper.

(4) Adding a standard substance: no wells were added with 100ul of 2-fold diluted standards and blank wells were added with 100ul of medium supernatant.

(5) Adding a sample: 100ul of cell supernatant was added to each well.

(6) Adding a detection antibody: 50ul of diluted antibody was added to each well.

(7) And (3) incubation: sealing films are pasted and incubated for 90min at room temperature.

(8) Washing: the liquid was discarded and 300ul of wash solution was added to each well and washed 6 times, each wash having to be patted dry with absorbent paper.

(9) Adding enzyme for incubation: 100ul of horseradish peroxidase-labeled streptavidin was added to each well.

(10) And (3) incubation: xinxin sealing membrane is used, 300 r/min and the incubation is carried out for 30min at room temperature.

(11) Washing: repeat step 8

(12) Adding a substrate for color development: 100ul of chromogenic substrate TMB was added to each well, protected from light, for 5 to 30 minutes.

(13) Adding a stop solution: 100ul of stop solution was added to each well and the color blue changed to yellow.

(14) And (3) detection reading: the maximum absorption wavelength at 450nm is determined within 30 minutes using a microplate reader. The results are shown in FIG. 3

5. Intracellular flow-type staining verifies that GM-CSF-targeting microRNA can knock down GM-CSF in CAR-T cells.

(1) And taking T cells after virus transduction, removing magnetic beads, and carrying out surface staining on the expression condition of the anti-CD19 CAR.

(2) Fixing T cells with 200ul BFA at 20min,4 deg.C

(3) Centrifuge at 2500rpm for 3min, and discard the supernatant.

(4) Adding 200ul BD wash buffer to rupture the membrane, keeping out of the sun, and incubating for 40min

(5) Centrifuge at 2500rpm for 3min, and discard the supernatant.

(6) Adding a flow antibody. Incubating in dark for 40min

(7) Washed twice with FACS and analyzed on a flow machine. The results are shown in FIG. 4

6. Detection of killing effect of CAR-T cells on target cells by luciferase assay

(1) Culturing Raji-Luc-GFP cells to logarithmic growth state, taking a certain number of cells, centrifuging, precipitating and counting;

(2) Adding 104 Raji-Luc-GFP cells into a 96-hole flat-bottom opaque white plate, and supplementing a culture medium to 100uL;

(3) Setting the cell ratio of anti-CD19CAR, anti-CD19 (microRNA # GM-CSF) -IL7-CCL19-anti-GM-CSF scFv fourth generation CAR-T cells to Raji-Luc-GFP cells as 5: 1, 10: 1 and 20: 1, and adding the corresponding CAR-T cells into each well for mixed culture;

(4) Setting a Mock cell group, wherein the number of T cells is the same as that of the CAR-T cells in the (3);

(5) Two controls are arranged at the same time, and the negative control is that Nectin4-Luc-HT1376 cells are cultured in a culture medium; the positive control was the addition of 2.5% Triton-X100 to the culture medium, neither Mock cells nor CAR-T cells, as the minimum and maximum background values for cell killing, i.e., kmin and Kmax.

(6) After 4 hours of culture, the 96-well plate was centrifuged at 1500rpm for 5min, the supernatant was discarded, and the cells were resuspended after washing once with the medium

(7) Adding 0.5mM D-fluorescein into each hole, standing for 10min in a dark place, and detecting the fluorescence intensity in an enzyme labeling instrument by using a chemiluminescence mode (Luminometric Measurement), wherein the detection time of each hole is 1000ms;

(8) And (3) counting the fluorescence intensity value K of each hole, and comparing the killing efficiency of the CAR-T and Mock cells to Raji-Luc-GFP cells, wherein the calculation formula is as follows: the killing efficiency% = (Kmin-K)/(Kmin-Kmax) x100%, and the results are shown in fig. 5.

Claims

1. A vector comprising a nucleic acid encoding a fourth generation Chimeric Antigen Receptor (CAR), wherein the nucleic acid comprises a nucleic acid encoding an antigen binding domain, a transmembrane domain, an intracellular transduction domain, and an anti-GM-CSF scfv that neutralizes GM-CSF, and a microRNA that targets GM-CSF; wherein, the nucleotide sequence of the microRNA targeting GM-CSF is shown as SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence of anti-GM-CSF neutralizing GM-CSF is shown as SEQ ID NO. 5.