CN109790518A

CN109790518A - Modified T cell, preparation method and the usage

Info

Publication number: CN109790518A
Application number: CN201880002752.8A
Authority: CN
Inventors: 王皓毅; 张永平; 刘晓娟; 程晨; 张兴颖; 李娜
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2017-05-08
Filing date: 2018-05-08
Publication date: 2019-05-21
Also published as: CN109797171A; WO2018205926A1

Abstract

Provide a kind of method that modified T cell is prepared by gene editing, and the modified T cell and application thereof prepared by this method.

Description

Modified T cell, preparation method and the usage

Technical field

The present invention relates to gene editings and tumour immunotherapy field.Specifically, the present invention relates to the methods for preparing modified T cell such as CAR-T cell by gene editing, and the modified T cell and application thereof prepared by the method.

Background technique

T cell plays a significant role in antineoplastic immune.However, local specificity cell toxicity T lymphocyte (CTL) content is seldom in tumor patient body, obtains and amplification in vitro is relatively difficult, and the affinity of CTL is low, limits its application in the clinical treatment of tumour.

T cell adoptive transfer is the specificity for obtaining higher concern in recent years, the anti-tumor method of hypotoxicity, is the most common method for generating tumor specific T cells including for example carrying out genetic modification to T cell with T cell receptor (TCR) or Chimeric antigen receptor (CAR).

Tcr gene transfer techniques are α the and β chains that TCR is cloned from tumor-reactive T cells, pass through technique for gene engineering, using retrovirus or slow virus as carrier, antigen specific T CR modification is carried out to T cells, to assign the ability of T cell specific recognition and killing tumor cell, and improve the affinity of T cell and tumour.Tcr gene modification is carried out using T cell of the tcr gene transfer techniques to autologous patient source, through amplification in vitro, obtains T cell largely with specifical and efficient recognition capability, after after feeding back to tumor patient, is allowed to play antitumor action in vivo.

CAR is made of extracellular domain, hinge, transmembrane domain and intracellular domain, the extracellular domain is typically derived from single chain variable fragment (scFv), the intracellular domain has one, two or three (corresponding respectively to the first, second and third generation CAR) derived from CD3Z and/or costimulatory molecules signal transduction structural domain (Kakarla and Gottschalk, 2014).Although CAR-T cell therapy succeed in the early clinic of the Hematological malignancies for the treatment of CD19 positive is studied (Daviala et al, 2014；Lee et al,2015；Maude et al, 2014), however it is very limited with the clinical response of CAR-T cell-targeting entity tumor antigen.

Therefore, there is still a need for obtaining the T cell that can effectively inhibit or kill tumour especially solid tumor.

Invention summary

On the one hand, the present invention provides a kind of method for preparing modified T cell, includes the steps that reducing or eliminating repressible protein in T cell and expresses.

In some embodiments, the T cell is the T cell comprising exogenous T-cell receptor (TCR) or Chimeric antigen receptor (CAR).

In some embodiments, the repressible protein being reduced or eliminated of expressing is selected from PD1, LAG-3, CTLA-4, Foxp3, Tim3 and combinations thereof.

In some embodiments, the combination expressed the repressible protein being reduced or eliminated and be selected from PD1 and TIM3, the combination of PD1 and CTLA-4, the combination of PD1 and LAG3, the combination of CTLA-4 and TIM3, the combination of the combination of CTLA-4 and LAG3, TIM3 and LAG3, the combination of PD1, TIM3 and CTLA-4, the combination of PD1, CTLA-4 and LAG3, the combination of CTLA-4, TIM3 and LAG3, the combination of PD1, TIM3 and LAG3 or the combination of PD1, CTLA-4, TIM3 and LAG3.

In some embodiments, by being reduced or eliminated described in the implementation of antisense RNA, antagomir, siRNA, shRNA, meganuclease, Zinc finger nuclease, activating transcription factor sample effector nuclease or CRISPR system.

In some embodiments, the CRISPR system is CRISPR/Cas9 system.

In some embodiments, the CRISPR/Cas9 system targets one or more the nucleotide sequence in SEQ ID NO:5,6,13,17,22-26 into the cell.

In some embodiments, the TCR or CAR includes the antigen-binding domains for tumor associated antigen.

In some embodiments, the tumor associated antigen is selected from CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinomebryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), EGF-R ELISA (EGFR), EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40, bifunctional sialyltransferase gangliosides GD2, ductal epithelium mucoprotein, gp36, TAG-72, glycosyl sphingolipid, the relevant antigen of glioma, β-human chorionic gonadotrophin, alpha Fetoprotein (AFP), external source agglutination Plain reactivity AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestines Carboxylesterase, mut hsp70-2, M-CSF, prostate enzyme (prostase), prostate enzyme spcificity antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and Telomerase, prostate cancer antigen -1 (PCTA-1), MAGE, ELF2M, Neutrophil elastase, ephrin B2, CD22, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, mesothelin, present the Main Tissues phase of tumour-specific peptide epitopes Capacitive complex (MHC) molecule, 5T4, ROR1, Nkp30, NKG2D, tumor stroma antigen, the extra domain A (EDA) and extra domain B (EDB) of fibronectin, the A1 structural domain (TnC A1) of tenascin-C, fibroblast GAP-associated protein GAP (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptor, endothelial factor, major histocompatibility complex (MHC) molecule, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPROT Q 02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8).

In some embodiments, the antigen-binding domains are selected from monoclonal antibody, the antibody of synthesis, human antibody, humanized antibody, single domain antibody, single chain antibody variable region and its antigen-binding fragment.

In some embodiments, the CAR includes scFv (P4), CD8 hinge area, CD28 transmembrane domain, CD28 costimulation structural domain and the CD3 ζ signal transduction structural domain for mesothelin.

In some embodiments, the CAR includes amino acid sequence shown in SEQ ID NO:32.

On the other hand, the present invention provides a kind of modified T cell prepared by the method for the present invention.

On the other hand, the present invention provides a kind of T cell of modification, wherein the expression of the repressible protein in the T cell is reduced or eliminated compared with unmodified T cell.

On the other hand, the present invention provides the purposes of modified T cell of the invention in the preparation of medicament for cancer treatment.

On the other hand, the present invention provides a kind of pharmaceutical composition for treating cancer, includes modified T cell of the invention and pharmaceutically acceptable carrier.

In the embodiment of various aspects of the present invention, the cancer is selected from lung cancer, oophoroma, colon and rectum carcinoma, melanoma, kidney, bladder cancer, breast cancer, liver cancer, lymthoma, malignant hematologic disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal carcinoma, laryngocarcinoma, cervical carcinoma, corpus uteri tumor and osteosarcoma.It can include: osteocarcinoma with the example of other cancers of method or medicine composite for curing of the invention, cancer of pancreas, cutaneum carcinoma, prostate cancer, skin or intraocular malignant melanoma, uterine cancer, cancer of the anal region, carcinoma of testis, carcinoma of fallopian tube, carcinoma of endometrium, carcinoma of vagina, vaginal orifice cancer, Hodgkin's disease, non_hodgkin lymphoma, cancer of the esophagus, carcinoma of small intestine, internal system cancer, thyroid cancer, parathyroid carcinoma, adrenal, soft tissue sarcoma, carcinoma of urethra, carcinoma of penis, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), childhood solid tumor, lymphocytic lymphoma, bladder cancer, kidney or carcinoma of ureter, carcinoma of renal pelvis, central nervous system (CNS) tumour, primary CNS lymphoma, it is swollen Tumor angiogenesis, tumor of spine, brain stem glioma, pituitary adenoma, Kaposi sarcoma, epidermis shape cancer, squamous cell carcinoma, t cell lymphoma, ambient induced cancer, the combination of cancer and the cancer including Induced by Asbestos.

On the other hand, it the present invention also provides kit, is used to prepare modified T cell by means of the present invention.

Detailed description of the invention

The design and screening of the sgRNA of Fig. 1 display targeting LAG-3.

Fig. 2 display knocks out influence of the LAG-3 to T cell, and wherein T-CTRL-UE and T-CTRL-E indicates the T cell for not being subjected to or being subjected to electroporation, and LAG-3-KO indicates the T cell of RNP processing.

Fig. 3 is shown in the result that LAG-3 is knocked out in CAR-T cell.

Fig. 4 shows that evaluating in vitro knocks out influence of the LAG-3 to CAR-T cell, and wherein CAR-T-CTRL-UE and CAR-T-CTRL-E indicates the cell for not being subjected to or being subjected to electroporation, and LAG-3-KO-CAR-T indicates the cell of RNP processing.

Fig. 5 display knocks out the Anticancer effect in vivo of the CAR-T cell of LAG-3.

The design and screening of the sgRNA of Fig. 6 display targeting CTLA-4.

Fig. 7 display knocks out influence of the CTLA-4 to T cell, and wherein T-CTRL-UE and T-CTRL-E indicates the T cell for not being subjected to or being subjected to electroporation, and CTLA-4-KO indicates the T cell of RNP processing.

Fig. 8 is shown in the result that CTLA-4 is knocked out in CAR-T cell.

Fig. 9 shows that evaluating in vitro knocks out influence of the CTLA-4 to CAR-T cell, and wherein CAR-T-CTRL-UE and CAR-T-CTRL-E indicates the cell for not being subjected to or being subjected to electroporation, and CTLA-4-KO-CAR-T indicates the cell of RNP processing.

Figure 10 display knocks out the Anticancer effect in vivo of the CAR-T cell of CTLA-4.

The design and screening of the sgRNA of Figure 11 display targeting Foxp3.

Figure 12 display knocks out influence of the Foxp3 to T cell, and wherein T-CTRL-UE and T-CTRL-E indicates the T cell for not being subjected to or being subjected to electroporation, and Foxp3-KO indicates the T cell of RNP processing.

Figure 13 is shown in the result that Foxp3 is knocked out in CAR-T cell.

Figure 14 shows that evaluating in vitro knocks out influence of the Foxp3 to CAR-T cell, and wherein CAR-T-CTRL-UE and CAR-T-CTRL-E indicates the cell for not being subjected to or being subjected to electroporation, and Foxp3-KO-CAR-T indicates the cell of RNP processing.

Figure 15 display knocks out the Anticancer effect in vivo of the CAR-T cell of Foxp3.

The design and screening of the sgRNA of Figure 16 display targeting Tim3.

Figure 17 display knocks out influence of the Tim3 to T cell, and wherein T-CTRL-UE and T-CTRL-E indicates the T cell for not being subjected to or being subjected to electroporation, and Tim3-KO indicates the T cell of RNP processing.

Figure 18 display knocks out influence of the Tim3 to CAR-T cell, and wherein CAR-T-CTRL-UE and CAR-T-CTRL-E indicates the cell for not being subjected to or being subjected to electroporation, and Tim-3-KO-CAR-T indicates the cell of RNP processing.

Figure 19 is shown in CAR-T cell and knocks out PD1.

The anti-Meso CART cell that Figure 20 shows that PD1 is knocked out can execute effector function in vivo.

The anti-Meso CART cell that Figure 21 shows that PD1 is knocked out can execute effector function in vitro.

Figure 22 shows different CAR structures.

Figure 23 shows the CAR-T cell with different CAR structures.

The knockout efficiency of Figure 24 display detection PD-1, LAG-3 and/or TIM3 gene.

Figure 25 shows effect of the P4 CAR-T cell of PD-1, LAG-3 and/or TIM3 gene knockout to target cell (H226-PDL1-luci).

Figure 26 shows effect of the P4 CAR-T cell of PD-1, LAG-3 and/or TIM3 gene knockout to target cell (CRL5826-PDL1), efficient target ratio (4:1).

Figure 27 shows that the P4 CAR-T cell high-efficient target of PD-1, LAG-3 and/or TIM3 gene knockout compares the effect of target cell (CRL5826-PDL1), inefficient target ratio (0.1:1).

Effect of the P4 CAR-T cell of Figure 28 display display PD-1, LAG-3 and/or TIM3 gene knockout to target cell (CRL5826-PDL1), inefficient target ratio (0.02:1).

Figure 29 display knocks out effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (CRL5826), imitates target ratio 1:1.

Figure 30 display knocks out effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (CRL5826-PDL1), imitates target ratio 1:1.

Figure 31 display knocks out effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (OVCAR3 or OVCAR3-PDL1), imitates target ratio 1:1.

After Figure 32 display culture 24 hours, effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (HCT116 or HCT116-PDL1) is knocked out, target ratio 1:1 is imitated.

After Figure 33 display culture 48 hours, effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (HCT116 or HCT116-PDL1) is knocked out, target ratio 1:1 is imitated.

After Figure 34 display culture 4 days, effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (CRL5826 or CRL5826-PDL1) is knocked out, target ratio 0.1:1 is imitated.

After Figure 35 display culture 48 hours, effect of the CAR-T cell of one or more of PD-1, TIM3, CTLA4 and LAG3 to target cell (OVCAR3 or OVCAR3-PDL1) is knocked out, target ratio 0.1:1 is imitated.

Detailed description of the invention

One, it defines

In the present invention, unless otherwise stated, Science and Technology noun used herein has the normally understood meaning of those skilled in the art institute.Also, protein used herein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology relational language and laboratory operation step are widely used term and conventional steps in corresponding field.For example, standard recombinant dna and molecule clone technology used in the present invention is known to those skilled in the art, and it is more fully described below in the following literature: Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning:A Laboratory Manual；Cold Spring Harbor Laboratory Press:Cold Spring Harbor, 1989 (hereinafter referred to as " Sambrook ").Meanwhile for a better understanding of the present invention, the definition and explanation of relational language is provided below.

" genome " not only covers the chromosomal DNA being present in nucleus, but also the organelle DNA in the subcellular components including being present in cell (such as mitochondria, plastid) when for eukaryocyte.

" external source " for sequence means the sequence from alien species, or if coming from same species, refers to and is made up of premeditated human intervention from its native form and/or the sequence of locus significantly changed.

" polynucleotides ", " nucleic acid sequence ", " nucleotide sequence " or " nucleic acid fragment " are used interchangeably and are single-stranded or double-stranded RNA or DNA polymer, optionally containing nucleotide base that is synthesis, non-natural or changing.Nucleotide is referred to by they following single letter title: " A " be adenosine or desoxyadenossine (respectively corresponding RNA or DNA), " C " indicates cytidine or deoxycytidine, " G " indicates that guanosine or deoxyguanosine, " U " indicate that uridine, " T " indicate deoxythymidine, " R " indicates purine (A or G), " Y " indicates pyrimidine (C or T), and " K " indicates that G or T, " H " indicate A or C or T, " I " indicates inosine, and " N " indicates any nucleotide.

" polypeptide ", " peptide " and " protein " is used interchangeably in the present invention, refers to the polymer of amino acid residue.The term is suitable for the amino acid polymer that wherein one or more amino acid residues are the artificial chemical analogues of corresponding naturally occurring amino acid, and is suitable for naturally occurring amino acid polymer.Term " polypeptide ", " peptide ", " amino acid sequence " and " protein " may also include modified forms, including but not limited to glycosylation, lipid connection, sulfation, the γ carboxylation of glutaminic acid residue, hydroxylation and ADP- ribosylation.

As used in the present invention, " expression construct ", which refers to, is listed in the carrier expressed in cell such as recombinant vector suitable for interested nucleotides sequence." expression " refers to the generation of function product.For example, the expression of nucleotide sequence can refer to the transcription (as transcription generates mRNA or function RNA) of nucleotide sequence and/or RNA translates into precursor or mature protein.

" expression construct " of the invention can be linear nucleic acid fragment, cyclic plasmid, viral vectors, alternatively, in some embodiments, can be the RNA (such as mRNA) that can be translated.

" expression construct " of the invention may include separate sources regulating and controlling sequence and interested nucleotide sequence or identical source but by be different from it is usually naturally occurring in a manner of the regulating and controlling sequence and interested nucleotide sequence that arrange.

" regulating and controlling sequence " and " controlling element " is used interchangeably, refer to the upstream (5' non-coding sequence) for being located at coded sequence, intermediate or downstream (3' non-coding sequence), and influences the transcription of related coding sequences, RNA processing or stability or the nucleotide sequence of translation.Expression regulation element refers to that interested nucleotide sequence transcription, RNA processing or stability or the nucleotide sequence of translation can be controlled.

Regulating and controlling sequence may include but be not limited to promoter, translation leader sequence, introne, enhancer and polyadenylation identification sequence.

" promoter " refers to control the nucleic acid fragment of another nucleic acid fragment transcription.In certain embodiments of the present invention, promoter is can to control the promoter of genetic transcription in cell, whether is it deriving from the cell.

As used herein, term " being operably connected " refers to controlling element (such as, but not limited to, promoter sequence, transcription terminator etc.) and nucleic acid sequence (such as, coded sequence or opening code-reading frame) connection, so that the transcription of nucleotide sequence is controlled and is adjusted by the transcriptional regulatory element.Technology for controlling element region to be operably connected to nucleic acid molecules is known in the art.

" gene editing ", also referred to as genome editor carry out DNA insertion, missing or replacement using the nuclease or " molecular scissors " of engineering in organism genome.Gene editing leads to locus specificity double-strand break (DSB) by position desired in genome, and desired DNA insertion, deletion or substitution are then introduced during repairing DSB.Gene editing is usually using meganuclease, Zinc finger nuclease (ZFN), activating transcription factor sample effector nuclease (TALEN) and CRISPR system.

" meganuclease " is a kind of endodeoxyribonuclease with huge recognition site (double chain DNA sequence of 12-40bp), and recognition site usually only occurs primary in any given genome.For example, the 18bp sequence average needs that I-SceI meganuclease is identified just can accidentally occur once in 20 times of genome bigger than human genome.

" Zinc finger nuclease " is the artificial restriction enzymes prepared and merging zinc finger dna binding structural domain with DNA cutting domain.The zinc finger dna binding structural domain of single ZFN usually contains 3-6, and individually zinc finger repetitive sequence, each zinc finger repetitive sequence can identify such as 3bp.

" activating transcription factor sample effector nuclease " is the restriction enzyme that specific dna sequence can be cut through engineering, is usually prepared and merging the DNA binding structural domain of activating transcription factor sample effector (TALE) with DNA cutting domain.TALE can combine substantially any desired DNA sequence dna after being engineered.

" the short palindrome repetitive sequences (CRISPR) of the regular intervals of cluster " are the procaryotic DNA sections containing short repetitive sequence.CRISPR system is protokaryon immune system, assigns the resistance that external genetic elements are such as present in the element of plasmid and bacteriophage, and this resistance provides acquired immunity.Cas albumen or albuminoid cut external nucleic acid under the guidance of RNA in such a system.

As used herein, term " CRISPR nuclease " is often referred to the nuclease present in naturally occurring CRISPR system and its modified forms, its variant (including notch enzyme mutant) or its catalytic activity segment.CRISPR nuclease can identify and/or cut target nucleic acid structure by interacting together with guide RNA (such as crRNA and optional tracrRNA or artificial gRNA (such as sgRNA)).The term covers any nuclease that can realize gene editing in the cell based on CRISPR system.

" Cas9 nuclease " and " Cas9 " are used interchangeably herein, refer to include the RNA guidance of Cas9 albumen or its segment (such as albumen of the gRNA binding structural domain of the active dna cutting domain and/or Cas9 comprising Cas9) nuclease.Cas9 is the component of CRISPR/Cas (the short palindrome repetitive sequences and its related system of the regular intervals of cluster) genome editing system, can target under the guidance of guide RNA and cutting DNA target sequence forms DNA double chain fracture (DSB).

" guide RNA " and " gRNA " are used interchangeably herein, it is usually made of crRNA the and tracrRNA molecule that partial complementarity forms compound, wherein crRNA includes to have enough complementarity with target sequence to hybridize with the target sequence and to instruct sequence of the CRISPR compound (Cas9+crRNA+tracrRNA) in conjunction with the target sequence sequence-specific.However, known in the art can design unidirectionally leads RNA (sgRNA), it simultaneously include the feature of crRNA and tracrRNA.

" T cell receptor (TCR) " is also known as T cell antigen receptor, is T cell specific recognition and combination Antigenic Peptide-MHC molecule molecular structure, is usually present in T cell surface in composite form with CD3 molecule.The TCR of most of T cells is made of α and β peptide chain, and the TCR of a small number of T cells is made of γ and δ peptide chain.

" mosaic type antigen receptor (CAR) " is also known as artificial T-cell's receptor, mosaic type T cell receptor, mosaic type immunity receptor, is the receptor of engineer a kind of, can assign immune effector cell a certain species specificity.For universal, this technology be used to assign the characteristic of T cell specific recognition tumor surface antigen.By this method, it can produce a large amount of target killing tumor cell.

" object ", which refers to, as used herein suffers from or is easy to can by means of the present invention or the organism of the disease of medicine composite for curing (such as cancer).Non-limitative example includes people, ox, rat, mouse, dog, monkey, goat, sheep, cow, deer and other nonmammalians.In preferred embodiments, object is people.

Two, the method through modifying T cell is prepared

In a first aspect, the present invention provides a kind of method for preparing modified T cell, including the steps that reducing or eliminating the repressible protein expression in T cell.

T cell of the invention can be through expansion of antigen specific T-cells or the T cell for Adoptive immunotherapy generated by genetically engineered redirection T cell.The T cell can also be the primary T cells for being isolated from object.In some embodiments, the T cell is the T cell comprising exogenous T-cell receptor (TCR).In other embodiments, the T cell is the T cell comprising Chimeric antigen receptor (CAR).

In some embodiments, the method also includes providing the step of being isolated from the unmodified T cell of object, and the step of importing TCR or CAR to the unmodified T cell.In some embodiments, the step of importing TCR or CAR to the unmodified T cell carries out before or after reducing or eliminating the step of repressible protein in T cell is expressed or simultaneously.

In some embodiments, the TCR or CAR includes the antigen-binding domains for tumor associated antigen, such as extracellular antigen-binding domains.

The tumor associated antigen includes but is not limited to CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinomebryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), EGF-R ELISA (EGFR), EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40, bifunctional sialyltransferase gangliosides GD2, ductal epithelium mucoprotein, gp36, TAG-72, glycosyl sphingolipid, the relevant antigen of glioma, β-human chorionic gonadotrophin, alpha Fetoprotein (AFP), lectin reactivity A FP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestines Carboxylesterase, mut hsp70-2, M-CSF, prostate enzyme (prostase), prostate enzyme spcificity antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and Telomerase, prostate cancer antigen -1 (PCTA-1), MAGE, ELF2M, Neutrophil elastase, ephrin B2, CD22, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, mesothelin, present the major histocompatibility complex of tumour-specific peptide epitopes (MHC) molecule, 5T4, ROR1, Nkp30, NKG2D, tumor stroma antigen, the extra domain A (EDA) and extra domain B (EDB) of fibronectin, the A1 structural domain (TnC A1) of tenascin-C, fibroblast GAP-associated protein GAP (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptor, endothelial factor, major histocompatibility complex (MHC) molecule, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPROT Q02223 ), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8).In a preferred embodiment, the antigen is mesothelin.

In the present invention, the antigen-binding domains for example can be monoclonal antibody, the antibody of synthesis, human antibody, humanized antibody, single domain antibody, single chain antibody variable region and its antigen-binding fragment.

In a preferred embodiment, the antigen-binding domains are the monoclonal antibodies for mesothelin.In a preferred embodiment, the antigen-binding domains are the scFv for mesothelin.In a preferred embodiment, the antigen-binding domains are the scFv (P4) for mesothelin, for example, its amino acid sequence is shown in SEQ ID NO:27.

In some embodiments, the CAR includes transmembrane domain, such as CD8 transmembrane domain or CD28 transmembrane domain, preferably CD28 transmembrane domain, such as amino acid sequence is shown in the CD28 transmembrane domain of SEQ ID NO:28.

In some embodiments, the CAR further comprises the hinge area between extracellular antigen-binding domains and the transmembrane domain, for example, the hinge area is CD8 hinge area, such as amino acid sequence is shown in the CD8 hinge area of SEQ ID NO:29.

In some embodiments, the CAR includes the signal transduction structural domain that can be used for T cell activation, such as the signal transduction structural domain selected from TCR ζ, FcR γ, FcR β, FcR ε, CD3 γ, CD3 δ, CD3 ε, CD3 ζ, CD5, CD22, CD79a, CD79b and CD66d.In some preferred embodiments, the CAR includes CD3 ζ signal transduction structural domain, such as amino acid sequence is shown in the CD3 ζ signal transduction structural domain of SEQ ID NO:30.

In some embodiments, the CAR also includes one or more costimulation structural domains for being selected from CD3, CD27, CD28, CD83, CD86, CD127,4-1BB and 4-1BBL.In some embodiments, the CAR includes CD28 costimulation structural domain, such as amino acid sequence is shown in the CD28 costimulation structural domain of SEQ ID NO:31.

In some embodiments, the CAR can also be comprising the reporter molecule for showing or tracking CAR expression, such as GFP albumen.

In some preferred embodiments of the present invention, the CAR includes scFv P4, CD8 hinge area, CD28 transmembrane domain, CD28 costimulation structural domain, CD3 ζ signal transduction structural domain and the optional GFP albumen for mesothelin.In some preferred embodiments of the present invention, the CAR includes amino acid sequence shown in SEQ ID NO:32.

As used in the present invention, T cell " repressible protein " refers to protein relevant to T cell activity suppression, such as inhibitive ability of immunity albumen.In some embodiments, the repressible protein is selected from PD1, LAG-3, CTLA-4, Foxp3, Tim3 and any combination thereof.In some specific embodiments, the repressible protein is selected from the combination of PD1 and TIM3, the combination of PD1 and CTLA-4, the combination of PD1 and LAG3, the combination of CTLA-4 and TIM3, the combination of the combination of CTLA-4 and LAG3, TIM3 and LAG3, the combination of PD1, TIM3 and CTLA-4, the combination of PD1, CTLA-4 and LAG3, the combination of CTLA-4, TIM3 and LAG3, the combination of PD1, TIM3 and LAG3 or the combination of PD1, CTLA-4, TIM3 and LAG3.In the present invention, reduce or eliminate amplification ability and its basic immunological characteristic that the repressible protein expression in T cell has no effect on T cell, and its biological activity, such as anti-tumor activity can be enhanced by releasing immunosupress, especially inhibit or kill the activity of solid tumor cell.

Several methods that protein expression is reduced or eliminated in cell known in the art.In some embodiments, the expression of repressible protein in T cell is reduced or eliminated by antisense RNA, antagomir, siRNA, shRNA.In other embodiments, by the method for gene editing, such as the expression of repressible protein in T cell is reduced or eliminated by meganuclease, Zinc finger nuclease, activating transcription factor sample effector nuclease or CRISPR system.In the method for the present invention preferred embodiment, the expression of repressible protein in T cell is reduced or eliminated using CRISPR system.

In some embodiments, the nuclease (CRISPR nuclease) that CRISPR system uses for example can the functional variant thereof selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3 or C2c2 albumen or these nucleases.

In some embodiments, the CRISPR system is CRISPR/Cas9 system.In some embodiments, the CRISPR system such as CRISPR/Cas9 system targets one or more nucleotide sequences in the cell in SEQ ID NO:5,6,13,17,22,23,24,25,26.

In some embodiments, the CRISPR system assembles in vitro, and is transferred to T cell.In some embodiments, the expression construct for encoding all elements of the CRIPSR system is transferred to T cell.In some embodiments, it by the expression construct for encoding the subelement of the CRIPSR system and other has transcribed or translated element is transferred to T cell.

The present invention also provides a kind of CRISPR gene editing system for being used to prepare modified T cell, it includes following i) at least one of v):

I) CRISPR nuclease, and at least one guide RNA；

Ii the expression construct of the nucleotide sequence) comprising coding CRISPR nuclease, and at least one guide RNA；

Iii) CRISPR nuclease, and the expression construct of the nucleotide sequence comprising encoding at least one guide RNA；

Iv the expression construct of the nucleotide sequence) comprising coding CRISPR nuclease, and the expression construct of the nucleotide sequence comprising encoding at least one guide RNA；

V) expression construct of the nucleotide sequence of nucleotide sequence and at least one guide RNA of coding comprising coding CRISPR nuclease；

Wherein repressible protein encoding gene such as PD1, LAG-3, CTLA-4, Foxp3 and/or the Tim3 of at least one guide RNA target into T cell.

In some specific embodiments, PD1 and TIM3 of at least one guide RNA target into T cell.In some specific embodiments, PD1 and CTLA-4 of at least one guide RNA target into T cell.In some specific embodiments, PD1 and LAG3 of at least one guide RNA target into T cell.In some specific embodiments, CTLA-4 and TIM3 of at least one guide RNA target into T cell.In some specific embodiments, CTLA-4 and LAG3 of at least one guide RNA target into T cell.In some specific embodiments, TIM3 and LAG3 of at least one guide RNA target into T cell.In some specific embodiments, PD1, TIM3 and the CTLA-4 of at least one guide RNA target into T cell.In some specific embodiments, PD1, CTLA-4 and the LAG3 of at least one guide RNA target into T cell.In some specific embodiments, CTLA-4, TIM3 and the LAG3 of at least one guide RNA target into T cell.In some specific embodiments, PD1, TIM3 and the LAG3 of at least one guide RNA target into T cell.In some specific embodiments, PD1, CTLA-4, TIM3 and the LAG3 of at least one guide RNA target into T cell.

In some embodiments, the CRISPR nuclease for example can the functional variant thereof selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3 or C2c2 albumen or these nucleases.In some embodiments, the CRISPR nuclease is Cas9 nuclease or its functional variant thereof.

In some embodiments, nucleotide sequence selected from SEQ ID NO:1-5 of the guide RNA target to LAG-3 gene.In some embodiments, nucleotide sequence selected from SEQ ID NO:6-10 of the guide RNA target to CTLA-4 gene.In some embodiments, nucleotide sequence selected from SEQ ID NO:11-16 of the guide RNA target to Foxp3 gene.In some embodiments, nucleotide sequence selected from SEQ ID NO:17-21 of the guide RNA target to Tim3 gene.In some embodiments, nucleotide sequence selected from SEQ ID NO:22 and 23 of the guide RNA target to PD-1 gene.In a preferred embodiment, the guide RNA target to be selected from SEQ ID NO:5,6,13,17,22 and 23 nucleotide sequence.In preferred embodiments, SEQ ID NO:24 (GCCAGGGGCTGAGGTCCCGG) from the guide RNA target to LAG-3 gene nucleotide sequence.In preferred embodiments, SEQ ID NO:25 (GTTGAGTAAGGGGTGTACA) from the guide RNA target to CTLA-4 gene nucleotide sequence.In preferred embodiments, SEQ ID NO:26 (CAGGGAACCTCGTGCCCGTC) from the guide RNA target to Tim3 gene nucleotide sequence.

In some embodiments of method of the invention, including by T cell described in CRISPR gene editing system introducing of the invention.In some embodiments, CRISPR gene editing system of the invention leads to the expression (strike low or knock out) for reducing or eliminating targeted albumen after importing the T cell.

CRISPR system of the invention can be transferred to T cell by methods known in the art, such as: calcium phosphate transfection, Protoplast fusion, electroporation, liposome transfection, microinjection, virus infection (such as baculoviral, vaccinia virus, adenovirus and other viruses).

Modified T cell of the invention can be activated and expand before or after any modification step.T cell can expand in vitro or in vivo.It is expanded in general, T cell of the invention can be contacted for example by generating the reagent of T cell activation signal with the costimulatory molecules on stimulation CD3 TCR compound and T cell surface.The activation signals of T cell are generated it is, for example, possible to use such as chemicals of calcium ion carrier A 23187, phorbol 12-myristate 13-acetate (PMA) or mitosis agglutinin such as phytohemagglutin phytolectin (PHA).In some embodiments, T cell group can be by contacting and being activated with such as anti-cd 3 antibodies or its antigen-binding fragment or fixed anti-CD2 antibody on the surface in vitro, or by being activated with protein kinase C activators (for example, bryostatin) together with the contact of Calcium ionophore.For example, T cell group can contact with anti-cd 3 antibodies and anti-CD28 antibody under conditions of being suitable for stimulates T cell to be proliferated.Condition suitable for T cell culture includes may be containing the suitable culture medium (such as Minimal Essential Media or RPMI Media 1640 or X-vivo 5, (Lonza)) of the factor necessary to proliferation and vigor; wherein the required factor includes the additive of serum (such as tire ox or human serum), proleulzin (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGFp and TNF or well known by persons skilled in the art for cell growth.Other additives for cell growth include but is not limited to surfactant, plasmanate and reducing agent such as N- acetyl-cysteine and 2- thioacetic acid.Culture medium may include RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 and X-Vivo 20, Optimizer, amino acid, Sodium Pyruvate and vitamin, serum-free or the serum (or blood plasma) or one group of specific hormone that supplement in right amount, and/or a certain amount of cell factor for being enough that T cell is made to grow and expand.Under the conditions of target cell may remain in necessary to support growth, such as temperature appropriate (such as 37 DEG C) and environment (for example, air adds 5%CO2).

Three, modified T cell

In another aspect of this invention, modified T cell is provided, wherein the expression of the repressible protein in the modified T cell is reduced or eliminated compared with unmodified T cell.In some embodiments, the modified T cell is prepared by means of the present invention.

In some embodiments, the expression is reduced or eliminated repressible protein and is selected from PD1, LAG-3, CTLA-4, Foxp3, Tim3 and any combination thereof.In some specific embodiments, the combination expressed the repressible protein being reduced or eliminated and be selected from PD1 and TIM3, the combination of PD1 and CTLA-4, the combination of PD1 and LAG3, the combination of CTLA-4 and TIM3, the combination of the combination of CTLA-4 and LAG3, TIM3 and LAG3, the combination of PD1, TIM3 and CTLA-4, the combination of PD1, CTLA-4 and LAG3, the combination of CTLA-4, TIM3 and LAG3, the combination of PD1, TIM3 and LAG3 or the combination of PD1, CTLA-4, TIM3 and LAG3.

In some embodiments, the gene that the repressible protein is encoded in the T cell is knocked, such as is knocked out by importing gene editing system of the invention.

In the present invention, the modified T cell has and the comparable amplification ability of unmodified T cell and similar immunological characteristic, and there is the biological activity enhanced since immunosupress is released from, such as anti-tumor activity, especially inhibit or kill the activity of solid tumor cell.

In the present invention, the T cell can be the T cell comprising exogenous T-cell receptor (TCR) or the T cell can be the T cell (CAR-T cell) comprising Chimeric antigen receptor (CAR).In some preferred embodiments of the present invention, the modified T cell is CAR-T cell.

In a preferred embodiment, the antigen-binding domains are the monoclonal antibodies for mesothelin.In a preferred embodiment, the antigen-binding domains are the scFv for mesothelin.In a preferred embodiment, the antigen-binding domains are the scFv (P4) for mesothelin, and amino acid sequence is shown in SEQ ID NO:27.

In the embodiment of the invention, the modified T cell is the CAR-T cell of the CAR comprising amino acid sequence shown in SEQ ID NO:32, wherein selected from the following inhibit albumen or the combined expression of albumen is inhibited to be reduced or eliminated:

i).PD1；

ii).LAG-3；

iii).CTLA-4；

iv).Foxp3；

v).Tim3；

Vi) .PD1 and TIM3；

Vii) .PD1 and CTLA-4；

Viii) .PD1 and LAG3；

Ix) .CTLA-4 and TIM3；

X) .CTLA-4 and LAG3；

Xi) .TIM3 and LAG3；

Xii) .PD1, TIM3 and CTLA-4；

Xiii) .PD1, CTLA-4 and LAG3；

Xiv) .CTLA-4, TIM3 and LAG3；

Xv) .PD1, TIM3 and LAG3；Or

Xvi) .PD1, CTLA-4, TIM3 and LAG3.

T cell of the invention can be obtained by various non-limiting methods from many non-limiting sources, including peripheral blood mononuclear cells, marrow, lymph node tissue, Cord blood, thymic tissue, ascites, pleural effusion, spleen tissue and tumour.In some embodiments, cell can be derived from healthy donors or from the patient for being diagnosed as cancer.In some embodiments, cell can be a part that the population mixture of cell of different phenotypic characteristics is presented.

In some embodiments of various aspects of the present invention, the T cell is derived from the autogenous cell of object.As used herein, " self " refers to that the cell for treatment object, cell line or cell mass are originated from the object.In some embodiments, the T cell is derived from variant cell, for example originating from the donor compatible with the object human leukocyte antigen (HLA).It is non-alloreactivity cell that standard scheme, which can be used, by the cell transformation from donor, and is replicated as needed, to generate the cell that can be applied to one or more patients.

CAR T cell or TCR T cell of the invention can be prepared by multiple means known in the art.For example, T cell can be transduceed with the expression construct comprising CAR or TCR coded sequence to obtain CAR-T cell or TCR-T cell.Those skilled in the art can easily construct the expression construct such as viral vectors for being suitable for protein expression.

Four, pharmaceutical composition and application

In another aspect of this invention, a kind of pharmaceutical composition for treating cancer is also provided, it includes modified T cell of the invention and pharmaceutically acceptable carriers.In addition, the purposes the present invention also provides modified T cell of the invention in the preparation of medicament for cancer treatment.

" pharmaceutically acceptable carrier " used herein includes any and all solvents, decentralized medium, coating, antibacterial agent and antifungal agent, isotonic agent and absorption delaying agent of physiological compatible etc..Preferably, which is suitable for intravenous, intramuscular, subcutaneous, parenteral, backbone or epidermis application (as by injection or infusion).

In another aspect of this invention, a kind of method for treating cancer is also provided, including the modified T cell of the invention or pharmaceutical composition of the invention to object in need application therapeutically effective amount.

In some embodiments, the method, which is still further comprised, applies radiotherapy and/or chemotherapy and/or other tumor-targeting drug (such as the monoclonal antibody or small molecule compound for targeting other antigens) to the object.

As used herein, " therapeutically effective amount " or " treatment effective dose " or " effective quantity " refer to that be applied to object is at least enough to generate the amount of the substance of curative effect, compound, material or cell later.Therefore, be prevent, cure, improving, blocking or the symptom of partial block disease or illness necessary to amount.

For example, the seriousness that the cell or pharmaceutical composition of the invention of " effective quantity " preferably results in disease symptoms reduces, the frequency of disease asymptomatic stage and duration increase, or prevent from damaging or disabling because of caused by disease pain.Such as, treatment for tumour, relative to the object for not receiving treatment, the cell or pharmaceutical composition of the invention of " effective quantity " is preferably by growth of tumour cell or Tumor growth inhibition at least about 10%, and preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%.Inhibiting the ability of tumour growth can evaluate in predicting the animal model system to the curative effect of human tumor.Alternatively, the ability of growth of tumour cell can also be inhibited to evaluate by checking, this inhibition can be by the way that well known to a person skilled in the art tests to measure in vitro.

In practical application, the dosage level of cell may change in pharmaceutical composition of the present invention, to obtain the required therapeutic response that can effectively realize to particular patient, composition and administration mode, and to the amount of the avirulent active constituent of patient.The dosage level of selection depends on a variety of pharmacokinetics factors, the activity of particular composition of the present invention including application, administration route, administration time, the discharge rate of the specific compound of application, the duration for the treatment of, other drugs, compound and/or material with the particular composition use in conjunction of application, well known similar factor in age, gender, weight, situation, general health and the medical history and medical domain of patient receiving treatment.

It is surprising that modified T cell of the invention can realize more preferably therapeutic effect relative to control T cell (expression of albumen is inhibited not to be reduced or eliminated) with lower dosage.This is particularly conducive to reduce preparation time and cost, while can reduce bring side effect when high dose is applied.

For example, the administration dosage of modified T cell of the invention is about 2 times low, about 3 times low, about 4 times low, about 5 times low, about 6 times low, about 7 times low, about 8 times low, about 9 times low, about 10 times low, about 15 times low, about 20 times low, about 30 times low, about 40 times low, about 50 times low, about 100 times low, about 150 times low, about 200 times or lower lower than the administration dosage for the control T cell that the expression for inhibiting albumen is not reduced or eliminated.

Can the unrestricted example of cancer of cell through the invention or medicine composite for curing include lung cancer, oophoroma, colon and rectum carcinoma, melanoma, kidney, bladder cancer, breast cancer, liver cancer, lymthoma, malignant hematologic disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal carcinoma, laryngocarcinoma, cervical carcinoma, corpus uteri tumor and osteosarcoma.It can include: osteocarcinoma with the example of other cancers of method or medicine composite for curing of the invention, cancer of pancreas, cutaneum carcinoma, prostate cancer, skin or intraocular malignant melanoma, uterine cancer, cancer of the anal region, carcinoma of testis, carcinoma of fallopian tube, carcinoma of endometrium, carcinoma of vagina, vaginal orifice cancer, Hodgkin's disease, non_hodgkin lymphoma, cancer of the esophagus, carcinoma of small intestine, internal system cancer, thyroid cancer, parathyroid carcinoma, adrenal, soft tissue sarcoma, carcinoma of urethra, carcinoma of penis, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), childhood solid tumor, lymphocytic lymphoma, bladder cancer, kidney or carcinoma of ureter, carcinoma of renal pelvis, central nervous system (CNS) tumour, primary CNS lymphoma, it is swollen Tumor angiogenesis, tumor of spine, brain stem glioma, pituitary adenoma, Kaposi sarcoma, epidermis shape cancer, squamous cell carcinoma, t cell lymphoma, ambient induced cancer, the combination of cancer and the cancer including Induced by Asbestos.Preferably, the cancer is solid tumor cancer.

Five, kit

The present invention also provides a kind of kits, it is used for the method for preparation of the invention through modifying T cell, the kit includes the CRISPR gene editing system as described herein for being used to prepare modified T cell, and suitably by the reagent in the gene editing system introducing cell.The kit can also be comprising for detecting T cell, separation T cell, activating T cell and/or the reagent for expanding T cell.The kit can also express the reality of the cell of the CAR or TCR comprising reagent, detection and the/separation for CAR or TCR to be imported to T cell.The kit can also include the explanation of implementation the method for the present invention.

Embodiment

It can get further understanding of the invention by reference to some specific embodiments given herein, these embodiments are merely to illustrate the present invention, have no intention to make any restrictions to the scope of the present invention.Obviously, a variety of modifications and changes can be made without departing from essence of the invention to the present invention, therefore, these modifications and changes equally this application claims in the range of.

Experimental material and method

The in-vitro transcription of 1.sgRNA

The forward primer comprising T7 promoter and 20bp target sequence (sgRNA) is synthesized by biotech firm first, is then pcr template amplification in vitro T7-sgRNA PCR product with pX330 plasmid (Addgene plasmid#4223) and utilizes PCR Purification Kit PCR product.Again using the T7-sgRNA PCR product of purifying as template, sgRNA is transcribed in vitro using MEGAshortscript T7 kit (Thermo Fisher Scientific), and sgRNA is recycled with MEGAclear columns (Thermo Fisher Scientific), with the deionized water dissolving sgRNA of no RNA enzyme, packing is frozen or spare.

2.Cas9 albumen and sgRNA's is compound

Suitable corresponding sgRNA is added in the EP pipe of no RNA enzyme first, is then slowly added into Cas9 albumen, it is light to mix, it is incubated at room temperature 15 minutes, it is spare to form RNP.

3. Electroporation Transformation method

1) P3 Primary Cell 4D-Nucleofector X Kit is used；

2) complete medium 37 degrees Celsius of preheating 30min or more in the hole 1.5ml/ are added into 12 orifice plates；A culture medium is preheated with 15ml centrifuge tube simultaneously；Preheat 50ml PBS

3) it is separately added into corresponding sgRNA into RNase-free EP pipe, is then slowly added into the Cas9 albumen of corresponding amount, mixes gently, be incubated at room temperature 20min, form RNP compound；

4) configuration electricity turns buffer: 100ul system: 82 μ l+18 μ l supplement of nuclepfector solution；

5) during sgRNA and cas9 albumen is incubated for, prepare the cell that electricity turns required:

6) T cell of activation 3 days is collected, and is counted, cell concentration (3e6 cell/sample) required for taking out；

7) 200g, room temperature are centrifuged 5min；

8) supernatant is abandoned, is washed cell once with preheated PBS, 200g, room temperature is centrifuged 5min；

9) supernatant is abandoned, as far as possible removal residual liquid；

10) turn buffer with the electricity prepared and cell is resuspended, it is soft to mix；

11) from being taken out in the RNP that the addition of 200 μ l/ samples (including multiple holes) has been incubated in the cell being resuspended, then electric revolving cup is added in 100 μ l/ sample of mixture by soft mixing；

12) electricity turns, and program is stimulated T cells (EO-115)；

13) preheated 500 μ l of culture medium is added in the electric revolving cup after turning to electricity rapidly, is gently mixed with pipette, cell is sucked out, is added in 12 preheated orifice plates, cell is put back into incubator culture, 37, DEG C 5%CO2；

14) 6 hours later half amounts of electricity turn change liquid, carefully take out cell from incubator, not shake, the hole 1ml/ culture medium is carefully sucked out along hole wall, and the preheated T cell culture medium of 1ml is then supplemented into culture hole；

15) it according to cell growth state after, passes on time, maintains cell density in 1e6 cell/ml.

4.TIDE analysis method

It collects cell and extracts experimental group and control group genomic DNA with cell pyrolysis liquid (100 μ g/ml mM EDTA, the 2.5%Tween-20 and of ProteinaseK, 10 mMTris-HCl, 2 2.5%Triton-X 100).PCR amplification in vitro target fragment, and be sequenced using sanger.Then online tool (http://tide.nki.nl) analyzing gene mutation efficiency is utilized.

5.T cell culture cultural method

T cell complete medium: X-VIVO15 medium+5%FBS (heat inactivation)+2mM L-Glutamine+1mM Sodium Pyruvate+300U/ml IL-2.Adjusting cell density with T cell complete medium after T cell separation is 1e6 cell/ml, is used Human T-Activator CD3/CD28 is activated with the ratio of 1:1.Then liquid passage was changed according to T cell growth conditions every 2-3 days.

6.T Immunophenotyping analysis method

The variation of cell subsets is analyzed by the method for flow cytometry, including CD4, CD8, T cells (CD45RO-/CD62L+, TN), central memory T cell (CD45RO+/CD62L+, TCM), Effector memory T cell (CD45RO+/CD62L-, TEM).Compared with the T cell for not carrying out gene editing.

7. fluidic cell method

1) FACS buffer is configured: 2%FBS+1mM EDTA+98%PBS；

2) 1e6 cell is taken, FACS buffer solution is washed twice；

3) it is resuspended, is mixed with FACS buffer solution 100ul, appropriate corresponding streaming antibody (dosage reference book) is added and mixes, room temperature is protected from light dyeing 10min；

4) FACS buffer solution is washed twice, then is resuspended with buffer 200-300 μ l, is mixed, upper machine testing within a hour；If machine cannot be gone up in time, need to be fixed with 4% paraformaldehyde.

8. cytokine measurements method

By the Raji cell of effector (T cell or CAR-T cell) and expression CD19, the K562 cell of CD19 is not expressed and is co-cultured with the K562 cell (referred to as K562-CD19 or K19) of CD19 modification or H226 cell and the H226 cell of expressing luciferase.Cell proportion is the 1:1 (effector and tumour cell each 10 in every hole ⁴It is a), it is carried out in 96 orifice plate of V-Bottom.Use complete RPM1640 culture medium, 200 μ L of final volume.After culture 24 hours, with the IL-2 and IFN-γ in ELISA kit detection supernatant.

9. tumor cell lysis is tested

Cytotoxicity is assessed according to the cytotoxicity assay based on flow cytometry.With 1 μM of Celltrace Violet labels targets tumour cell K19, then it is incubated 4 hours with effect daughter cell (the CAR-T cell of T cell, CAR-T cell and gene knockout).Then FITC-Annexin V and 7-AAD (Biolegend) is added to determine the ratio of dead target cell.

Alternatively, by tumour cell with 10 ⁴The density of/100ul is put into 96 orifice plates of micro-assay-plate (greiner bio-one).By CAR-T cell accurate metering, by different effector cells: target ration is diluted, and is added to 100ul in corresponding hole, and control group is the culture medium that 100ul is added.After arrival time, all holes are added Luciferase Assay System 10ul is read under microplate reader after five minutes.After obtaining reading, the percentage of killing is calculated: killing (%)=100- (experiment group number-reading/control group number-reading) * 100

LAG-3 gene in embodiment 1, knockout CAR-T cell

1, the most effective sgRNA of LAG-3 on targeting T-cells is screened

To eliminate the LAG-3 expression in T cell, five kinds of sgRNA are devised, the First Exon of LAG-3 is targeted.Figure 1A illustrates position of the sgRNA in LAG-3 locus by taking sgRNA5 as an example.

The targeting sequence of related sgRNA is as shown in table 1.

Table 1, the sgRNA for targeting LAG-3

sgRNA	Target sequence	SEQ ID NO
sgRNA1	ATGTGGGAGGCTCAGTTCCT	1
sgRNA2	GCTGCAGAAACAGCAAGCCC	2
sgRNA3	TGCTGTTTCTGCAGCCGCTT	3
sgRNA4	GCTGTTTCTGCAGCCGCTTT	4
sgRNA5	GTTTCTGCAGCCGCTTTGGG	5

Cas9 albumen (3 μ g) and the sgRNA (3 μ g) being transcribed in vitro progress are compound, and then electroporation enters primary CD3 ⁺In T cell.The gene editing efficiency of each sgRNA is quantitatively used with TIDE analysis, selection is used for the most effective sgRNA of further experiment, is as a result shown in Figure 1B.As shown, the knockout efficiency highest of sgRNA5.Determine that NHEJ repairs the appearance of caused insertion and missing (indel) by cloning and sequencing.The target region of sgRNA5 has been expanded, and has identified independent mutation.As shown in Figure 1 C, all mutation are accurate occurs in the region that sgRNA is targeted.These results explanation, has effectively knocked out LAG-3 by gene editing in primary T cells.

2, the effect of electroporation and gene editing to T cell proliferation and phenotype is assessed

In order to determine effect of the gene editing to T cell proliferation and phenotype, the proliferation of the T cell of LAG-3 knockout is tested.It is cultivated after electroporation.The 3rd day and the 7th day after electroporation, total cell number is counted, to measure the amplification times of the T cell of control T cell and LAG-3 knockout.As a result as shown in Figure 2 A, the T cell that LAG-3 is knocked out keeps the normal proliferation for relying on AntiCD3 McAb and anti-CD28 antibody stimulation.

Pass through CD4, CD8 expression and naive (CD45RO-/CD62L+, TN), (CD45RO+/CD62L+ is remembered at center, TCM) and effect memory (CD45RO+/CD62L-, TEM) T cell Asia collection characteristic evaluation gene editing T cell immunophenotype.The results show that showing the part CD4 and TCM somewhat higher in the T cell that LAG-3 is knocked out.However, this effect seems related to electroporation, because this feature also has display (Fig. 2 B) in T cell that is not editing but receiving electroporation.Generally speaking, the T cell that LAG-3 is knocked out shows phenotype similar with the T cell that do not edit.

3, the CAR-T cell of LAG-3 knockout is prepared

LAG-3 gene editing is carried out using anti-CD19 CAR-T cell.

In simple terms, there are IL-2 (50U/ml), with AntiCD3 McAb and anti-CD28 stimulation activation CD19 CAR-T cell three days.Then, the CRISPR-Cas9 system comprising sgRNA5 is transferred to the CAR-T cell using electroporation, the three days assessment gene editing efficiency after electroporation.LAG-3 knockout rate is had evaluated using three different donors, as a result as shown in Figure 3A, observes that knockout rate is 40-70%.

In addition, also having detected the expression of LAG-3 on the CAR-T cell after gene editing by flow cytometry confirmation, as a result as shown in Figure 3B.

4, the CAR-T cell that characterization LAG3 is knocked out

Firstly, having evaluated the proliferation of the CAR-T cell of LAG3 knockout.As shown in Figure 4 A, although gene editing method cell proliferation makes some difference, the CAR-T cell of these editors is proliferated good under AntiCD3 McAb and anti-CD28 stimulation.

14th day harvest CAR-T cell after transfection carries out Immunophenotype analysis.As shown in Figure 4 B, similar to unmodified T cell, the CAR-T cell that LAG3 is knocked out does not show any significant CD4 and CD8 expression and the change of memory T cell phenotype feature.That is, the LAG3 destruction that CRISPR-Cas9 is mediated does not interfere with T cell immunophenotype.

For the cytotoxicity function of the assessment LAG3 CAR-T cell knocked out, the CAR-T cell that measurement LAG3 is knocked out discharges the ability of IL-2 and IFN-γ, as a result as shown in Figure 4 C.The amount of the cell factor for the CAR-T cell release that LAG3 is knocked out is similar to the CAR-T cell that do not edit.

In addition, also having detected the ability of the CAR-T cell cracking tumour cell of LAG3 knockout.Effect daughter cell: the ratio of target cell is 16:1,8:1 and 4:1.As a result as shown in Figure 4 D, the CAR-T cell for illustrating that LAG3 is knocked out at least retains the anti-tumor activity equal with standard CAR-T cell.

5, the CAR-T cell that LAG-3 is knocked out tumor eradication in mouse xenograft model

At the 0th day, to injection 2 × 10 in NOD-Prkdc scid Il2rg null (NPG) mouse peritoneal of 6-12 week old ⁵Raji- luciferase cell.On day 3, mouse receives the 1 × 10 of intraperitoneal injection ⁷The CAR-T cell or PBS that T cell, CAR-T cell or LAG-3 are knocked out.

On day 3, the 10th day and the 31st day progress biodiversity resources detect the NPG mouse (n=4) of various processing, and imaging results are as shown in Figure 5A；Bioluminescence signal with the mouse of T cell, CAR-T cell or LAG-3 the CAR-T cell processing knocked out is as shown in Figure 5 B, and data are shown as average value ± SEM, n=4.These data illustrate that destroy Inhibit Genes LAG-3 leads to more effective antitumor response in mouse xenograft model.

The mouse of existence is monitored, until the 60th day.The mouse survival percentage of each group is as shown in Figure 5 C.

CTLA-4 gene in embodiment 2, knockout CAR-T cell

1, the sgRNA of screening targeting CTLA-4

SgRNA, the target sequence such as SEQ ID NO:6-10 (table 2) of five kinds of targeting 1 code areas of CTLA-4 locus Exon are designed, as shown in Figure 6A, the targeting sequence of sgRNA1 is green, and PAM sequence is blue.

Table 2, the sgRNA for targeting CTLA-4

sgRNA	CTLA-4 target sequence	SEQ ID NO
sgRNA1	CCTTGGATTTCAGCGGCACA	6
sgRNA2	CCTTGTGCCGCTGAAATCCA	7
sgRNA3	TGAACCTGGCTACCAGGACC	8
sgRNA4	CATAAAGCCATGGCTTGCCT	9
sgRNA5	CTCAGCTGAACCTGGCTACC	10

Cas9 albumen (3 μ g) and the sgRNA (3 μ g) being transcribed in vitro carry out being compounded to form Cas9-sgRNA ribonucleoprotein (RNP), and then electroporation enters primary 1 × 10 ⁶CD3+T cell (after activation three days).

The knockout efficiency of each sgRNA, and the insertion and deletion frequency in sequencing analysis CTLA-4 are quantitatively used with TIDE analysis.As a result as shown in Figure 6B, the knockout efficiency highest of sgRNA1, also, carry out gene editing with sgRNA1 in another donor (donor 2) and also obtain significant knockout effect.

It is subcloned the PCR product of each sample, the allele of each clone is sequenced；By the allele of mutation representative in the cell of RNP transfection compared with wild-type sequence.As a result as shown in Figure 6 C.The targeting sequence of sgRNA is green, and PAM sequence is blue, and mutant nucleotide sequence is red.N/N refers to the total clone's number of clone's number/sequencing of the allele containing mutation.

2, assessment knocks out effect of the CTLA-4 to T cell proliferation and phenotype

In order to determine effect of the gene editing to T cell proliferation and phenotype, the proliferation of the T cell of CTLA-4 knockout is tested.It is cultivated after electroporation.The 3rd day and the 7th day after electroporation, total cell number is counted, to measure the amplification times of the T cell of control T cell and CTLA-4 knockout.As a result as shown in Figure 7 A, the T cell that CTLA-4 is knocked out keeps the normal proliferation for relying on AntiCD3 McAb and anti-CD28 antibody stimulation.

Pass through CD4, CD8 expression and naive (CD45RO-/CD62L+, TN), (CD45RO+/CD62L+ is remembered at center, TCM) and effect memory (CD45RO+/CD62L-, TEM) T cell Asia collection characteristic evaluation gene editing T cell immunophenotype.Independent experiment twice is carried out, is as the result is shown average value ± SEM.As a result as shown in Figure 7 B.

3, the CAR-T cell of CTLA-4 knockout is prepared

CTLA-4 gene editing is carried out using anti-CD19 CAR-T cell.

Anti- CD19 CAR-T cell culture activates three days.Then, the RNP of CRISPR-Cas9 and sgRNA1 is transferred to by CAR-T cell by electroporation, the three days assessment gene editing efficiency after electroporation.CTLA-4 knockout rate is had evaluated using three different donors, as a result as shown in Figure 8 A.

It is subcloned the PCR product of each sample, the allele of each clone is sequenced；By the allele of mutation representative in the cell of RNP transfection compared with wild-type sequence.As a result as shown in Figure 8 B.The targeting sequence of sgRNA is green, and PAM sequence is blue, and mutant nucleotide sequence is red.N/N refers to the total clone's number of positive colony number/sequencing of the allele containing mutation.

In addition, the 3rd day after electroporation, with the CTLA-4 surface expression of the flow cytometry analysis CTLA-4 CAR-T cell knocked out, as a result as shown in Figure 8 C.

4, the CAR-T cell that characterization CTLA-4 is knocked out

In order to determine effect of the gene editing to CAR-T cell Proliferation and phenotype, the proliferation of the CAR-T cell of CTLA-4 knockout is tested in three donors.It is cultivated after electroporation.Different time points count total cell number after electroporation, to measure the amplification times for the CAR-T cell that control CAR-T cell and CTLA-4 are knocked out.It carries out independent experiment, data twice and is shown as average value ± SEM, as a result as shown in Figure 9 A.

For the anti-CD19 CAR-T cell that vitro characterization CTLA-4 is knocked out, cultivated after electroporation.Culture assessed the immunophenotype of the T cell of gene editing by CD4, CD8 expression and naive, center memory and effector memory T cell Asia collection to the 10th day after electroporation.It carries out independent experiment, data three times and is shown as average value ± SEM, as a result as shown in Figure 9 B.

Also representative IL-2 and IFN-γ are had detected in three independent donors.As a result as shown in Figure 12 B, data are shown as average value ± SEM, n=2.

In addition, determining its cytotoxicity by the ability of assessment T cell, CAR-T cell and CTLA-4 the CAR-T cell cracking tumour cell knocked out.As a result as shown in fig. 9d, effect daughter cell: the ratio of target cell is 10:1,5:1 and 2.5:1.

5, the anti-tumor capacity for the CAR-T cell that assessment CTLA-4 is knocked out in vivo

At the 0th day, to injection 2 × 10 in NOD-Prkdc scid Il2rg null (NPG) mouse peritoneal of 6-12 week old ⁵Raji- luciferase cell.On day 3, mouse receives the 1 × 10 of intraperitoneal injection ⁷The CAR-T cell or PBS that T cell, CAR-T cell or CTLA-4 are knocked out.

On day 3, the 10th day and the 31st day progress biodiversity resources detect the NPG mouse (n=4) of various processing, and imaging results are as shown in Figure 10 A；Bioluminescence signal with the mouse of T cell, CAR-T cell or CTLA-4 the CAR-T cell processing knocked out is as shown in Figure 10 B, and data are shown as average value ± SEM, n=4.

The mouse of existence is counted, until the 60th day.The mouse survival percentage of each group is as illustrated in figure 10 c.

Foxp3 gene in embodiment 3, knockout CAR-T cell

1, the sgRNA of screening targeting Foxp3

SgRNA, the sequence such as SEQ ID NO:11-15 (table 3) of six kinds of targeting 2 code areas of Foxp3 locus Exon are designed, as shown in Figure 11 A, the targeting sequence of sgRNA3 is green, and PAM sequence is blue.

Table 3, the sgRNA for targeting Foxp3

sgRNA	Foxp3 target sequence	SEQ ID NO
sgRNA1	GGGCCGAGATCTTCGAGGCG	11
sgRNA2	TCGAAGATCTCGGCCCTGGA	12
sgRNA3	GCAGCTGCGATGGTGGCATG	13
sgRNA4	AGGGCCGAGATCTTCGAGGC	14
sgRNA5	GGCCCTGGAAGGTTCCCCCT	15
sgRNA6	TTTGGGTGCAGCCCTCCAGC	16

Cas9 albumen (3 μ g) and the sgRNA (3 μ g) being transcribed in vitro carry out being compounded to form Cas9-sgRNA ribonucleoprotein (RNP), and then electroporation enters primary 1 × 10 ⁶In CD3+T cell (after activation three days).

The knockout efficiency of each sgRNA is quantitatively used with TIDE analysis, sequencing analysis Foxp3 insertion and deletion frequency, as a result as shown in Figure 11 B, the knockout efficiency highest of sgRNA3, and, gene editing is carried out with sgRNA3 in another two donor (D2 and D3), also achieves efficient gene knockout.

It is subcloned the PCR product of each sample, the allele of each clone is sequenced；By the allele of mutation representative in the cell of RNP transfection compared with wild-type sequence.As a result as shown in Figure 11 C.The targeting sequence of sgRNA is green, and PAM sequence is blue, and mutant nucleotide sequence is red.N/N refers to the total clone's number of clone's number/sequencing of the allele containing mutation.

In addition, the 3rd day after electroporation, with the Foxp3 surface expression of the flow cytometry analysis Foxp3 T cell knocked out, as a result as shown in Figure 11 D.

2, assessment knocks out effect of the Foxp3 to T cell proliferation and phenotype

In order to determine effect of the gene editing to T cell proliferation and phenotype, the proliferation of the T cell of Foxp3 knockout is tested.It is cultivated after electroporation.The 3rd day and the 7th day after electroporation, total cell number is counted, to measure the amplification times of the T cell of control T cell and Foxp3 knockout, as a result as illustrated in fig. 12.The T cell that Foxp3 is knocked out keeps the normal proliferation for relying on AntiCD3 McAb and anti-CD28 antibody stimulation.

Pass through CD4, CD8 expression and naive (CD45RO-/CD62L+, TN), (CD45RO+/CD62L+ is remembered at center, TCM) and effect memory (CD45RO+/CD62L-, TEM) T cell Asia collection characteristic evaluation gene editing T cell immunophenotype.Independent experiment twice is carried out, is as the result is shown average value ± SEM.As a result as shown in Figure 12 B.

3, the CAR-T cell of Foxp3 knockout is prepared

Foxp3 gene editing is carried out using anti-CD19 CAR-T cell.

In simple terms, culture CD19 CAR-T cell is activated for three days.Then, the RNP of CRISPR-Cas9 and sgRNA3 is transferred to by CAR-T cell by electroporation, the three days assessment gene editing efficiency after electroporation.Foxp3 knockout rate is had evaluated using three different donors, as a result as shown in FIG. 13A.

It is subcloned the PCR product of each sample, the allele of each clone is sequenced；By the allele of mutation representative in the cell of RNP transfection compared with wild-type sequence.As a result as shown in Figure 13 B.The targeting sequence of sgRNA is green, and PAM sequence is blue, and mutant nucleotide sequence is red.N/N refers to the total clone's number of positive colony number/sequencing of the allele containing mutation.

4, the CAR-T cell that characterization Foxp3 is knocked out

In order to determine effect of the gene editing to CAR-T cell Proliferation and phenotype, the proliferation of the CAR-T cell of Foxp3 knockout is tested in three donors.It is cultivated after electroporation.After electroporation, total cell number is counted, to measure the amplification times for the CAR-T cell that control CAR-T cell and Foxp3 are knocked out.It carries out independent experiment, data twice and is shown as average value ± SEM, as a result as shown in Figure 14 A.

For the anti-CD19 CAR-T cell that vitro characterization Foxp3 is knocked out, cultivated after electroporation.Culture assessed the immunophenotype of the T cell of gene editing by CD4, CD8 expression and naive, center memory and Effector memory T cell Asia collection to the 10th day after electroporation.It carries out independent experiment, data three times and is shown as average value ± SEM, as a result as shown in Figure 14B.

Also representative IL-2 and IFN-γ are had detected in three independent donors.As a result as shown in Figure 14 C, data are shown as average value ± SEM, n=2.

In addition, determining its cytotoxicity by the ability of assessment T cell, CAR-T cell and Foxp3 the CAR-T cell cracking cell knocked out.Effect daughter cell: the ratio of target cell is 10:1,5:1 and 2.5:1.As a result as shown in fig. 14d.

5, the anti-tumor capacity for the CAR-T cell that assessment Foxp3 is knocked out in vivo

At the 0th day, to injection 2 × 10 in NOD-Prkdc scid Il2rg null (NPG) mouse peritoneal of 6-12 week old ⁵Raji- luciferase cell.On day 3, mouse receives the 1 × 10 of intraperitoneal injection ⁷The CAR-T cell or PBS that T cell, CAR-T cell or Foxp3 are knocked out.

On day 3, the 10th day and the 31st day progress biodiversity resources detect the NPG mouse (n=4) of various processing, and imaging results are as shown in fig. 15；With T cell, CAR-T cell or Foxp3 knock out CAR-T cell processing mouse bioluminescence signal as shown in fig. 15b, data are shown as average value ± SEM, n=4.

The mouse of existence is counted, until the 60th day.The mouse survival percentage of each group is as shown in figure 15 c.

Tim3 gene in embodiment 4, knockout CAR-T cell

1, the most effective sgRNA of Tim3 on targeting T-cells is screened

Design the sgRNA, target sequence such as SEQ ID NO:17-21 (table 4) of five kinds of targeting 2 code areas of Tim3 locus Exon.As shown in Figure 16 A, the targeting sequence of sgRNA1 is green, and PAM sequence is blue.

Table 4, the sgRNA for targeting Tim3

sgRNA	Tim3 target sequence	SEQ ID NO
sgRNA1	CTGGTTTGATGACCAACTTC	17
sgRNA2	TGAAAAATTTAACCTGAAGT	18
sgRNA3	CTGAAGTTGGTCATCAAACC	19
sgRNA4	GAATGATGAAAAATTTAACC	20
sgRNA5	CCTGGTTTGATGACCAACTT	21

The knockout efficiency of each sgRNA is quantitatively used with TIDE analysis, sequencing analysis Tim3 insertion and deletion frequency, as a result as shown in fig 16b, the knockout efficiency highest of sgRNA1, also, gene editing is carried out with sgRNA1 in the T cell in other source donor (D2) and CAR-T cell and has also obtained effective knockout effect.

In addition, the 3rd day after electroporation, with the Tim3 surface expression of the flow cytometry analysis Tim3 T cell knocked out, as a result as shown in figure 16 c.

2, assessment knocks out effect of the Tim3 to T cell proliferation and phenotype

In order to determine effect of the gene editing to T cell proliferation and phenotype, the proliferation of the T cell of Tim3 knockout is tested.It is cultivated after electroporation.The 3rd day and the 7th day after electroporation, total cell number is counted, to measure the amplification times of the T cell of control T cell and Tim3 knockout, as a result as shown in Figure 17 A.

By CD4, CD8 expression and The immunophenotype of the T cell of the characteristic evaluation gene editing of (CD45RO+/CD62L+, TCM) and effect memory (CD45RO+/CD62L-, TEM) T cell Asia collection is remembered at (CD45RO-/CD62L+, TN), center.Independent experiment twice is carried out, is as the result is shown average value ± SEM.As a result as seen in this fig. 17b.

3, the CAR-T cell of Tim3 knockout is prepared

Tim3 gene editing is carried out using anti-CD19 CAR-T cell.

Culture CD19 CAR-T cell is activated for three days.Then, the RNP of CRISPR-Cas9 and sgRNA1 is transferred to by CAR-T cell by electroporation.

4, the CAR-T cell that vitro characterization Tim3 is knocked out

In order to determine effect of the gene editing to CAR-T cell Proliferation and phenotype, the proliferation of the CAR-T cell of Tim3 knockout is tested in three donors.It is cultivated after electroporation.After electroporation, total cell number is counted, to measure the amplification times for the CAR-T cell that control CAR-T cell and Tim3 are knocked out.It carries out independent experiment, data twice and is shown as average value ± SEM, as a result as shown in Figure 18 A.

For the anti-CD19 CAR-T cell that vitro characterization Tim3 is knocked out, cultivated after electroporation.Culture assessed the immunophenotype of the T cell of gene editing by CD4, CD8 expression and naive, center memory and Effector memory T cell Asia collection to the 10th day after electroporation.It carries out independent experiment, data three times and is shown as average value ± SEM, as a result as shown in figure 18b.

Also have detected representative IL-2 and IFN-γ.As a result as shown in figure 18 c, data are shown as average value ± SEM, n=2.

PD1 gene in embodiment 5, knockout CAR-T cell

1, the CAR-T cell of PD1 knockout is prepared

Devise the sgRNA of targeting PD1 exons 1.Wherein sgRNA1 targets sense strand and sgRNAp targets antisense strand (see Figure 19 A).

The PD1 gene order of sgRNA1 targeting are as follows: GTCTGGGCGGTGCTACAACT (SEQ ID NO:22)；The PD1 gene order of sgRNAp targeting are as follows: ACAGGCGCCCTGGCCAGTCG (SEQ ID NO:23).

Designed sgRNA and Cas9 albumen is passed through into the anti-Meso CART cell of electroporation corotation.Display PD1 gene editing efficiency, which is measured, by Surveyor reaches 27.9%.

2, the anti-Meso CART cell that PD1 is knocked out can execute effector function in vivo

By 2x 10 ⁶The H226 cell subcutaneous injection of height expression PDL1 and luciferase constructs people's lung squamous cancer mouse model into NPG mouse flank.The 27th day and the 32nd day 1 x 10 of intratumor injection ⁷PD1-KO anti-mesothelin (Meso) CART cell, anti-Meso CART cell and the PBS as untreated control.Tumour growth is detected by bioluminescence imaging, is shot weekly.

As a result as shown in Figure 20 A and Figure 20 B.Compared with untreated control, the H226 bioluminescence signal in the mouse of the anti-Meso CART cell processing of PD1-KO is rapidly reduced to close to background level after the injection of first time T cell and is always maintained at low signal level.Compared with untreated control, the H226 bioluminescence signal in the mouse of anti-Meso CART cell processing reduces rapidly after the injection of first time T cell, but bioluminescence signal slowly increases after second of T cell is injected.In addition, receive the mouse of anti-mesothelin CAR-T cell, the anti-mesothelin CAR-T cell for receiving PD1 knockout mouse and do not receive the survival rate of control mice for the treatment of and be shown in Figure 20 C.The mouse for receiving the anti-mesothelin CAR-T cell of PD1 knockout shows higher survival rate.

3, the anti-Meso CART cell that PD1 is knocked out can execute effector function in vitro

The H226 cell (H226-luci) and l cell 3T3 of expressing luciferase express the 3T3 cell (3T3-PDL1) of PDL1 respectively with the anti-Meso CART cell of PD1-KO, anti-Meso CART cell and common unmodified T cell with the effector cell of 1:1,1:2 or 1:4: target ration co-cultures 20 hours.Uciferase activity by measuring remaining tumour cell calculates the percentage of target cell lysis.

As illustrated in fig. 21, when H226-luci and 3T3 cell is co-cultured with the anti-Meso CART cell of PD1-KO, anti-Meso CART cell and T cell respectively, the anti-Meso CART cell of PD1-KO can more efficiently kill target H226 cell than anti-Meso CART cell.

As illustrated in fig. 21b, when H226-luci and 3T3-PDL1 cell is co-cultured with the anti-Meso CART cell of PD1-KO, anti-Meso CART cell and T cell respectively, the anti-Meso CART cell of PD1-KO can more efficiently kill target H226 cell than anti-Meso CART cell.

Embodiment 6, the CAR-T cell with different CAR structures

The CAR (P4-z, P4-BBz, P4-28z and P4-28BBz, structure is as shown in figure 22, and wherein P4 is anti-mesothelin scFv) of 4 kinds of structures is devised, and prepares CAR-T cell.

With the effector cell of 1:1: obtained CAR-T cell and H226 cell are co-cultured 20h, measure the release of IFN-γ and IL-2 by target ration.

With the effector cell of 2:1: target ration co-cultures obtained CAR-T cell and the H226 cell (H226-luci) of expressing luciferase 3 days, and the uciferase activity by measuring remaining tumour cell calculates the percentage of target cell lysis.

As shown in figure 23, compared with P4-z, P4-BBz and P4-28BBz, P4-28z shows release (Figure 23 A) and the higher Specific cell lysis of higher IFN-γ and IL-2 (Figure 23 B, * indicate that P < 0.05, * * * * indicate P < 0.0001).

Inhibit the several genes editor of albumen in embodiment 7, CAR-T cell

Knock out one or more in PD-1, TIM-3 and LAG-3 in anti-mesothelin CAR-T cell, wherein PD-1 is knocked out with the sgRNA of targeting SEQ ID NO:22 and/or SEQ ID NO:23, TIM-3 is knocked out with the sgRNA of targeting SEQ ID NO:26, CTLA-4 is knocked out with the sgRNA of targeting SEQ ID NO:25, and knocks out LAG-3 with the sgRNA of targeting SEQ ID NO:5 and/or 24.

1. generating the P4 CAR-T cell (PD1 KO) for knocking out PD-1 respectively, knock out the P4 CAR-T cell (TIM3 KO) of TIM3, knock out the P4 CAR-T cell (LAG3 KO) of LAG3, knock out the P4 CAR-T cell (PD1 TIM3 KO) of PD1 and TIM3, the P4 CAR-T cell (PD1 LAG3 KO) of PD1 and LAG3 is knocked out, and knocks out the P4 CAR-T cell (PD1 TIM3 LAG3 KO) of PD1, TIM3 and LAG3.The knockout efficiency of PD-1, LAG-3 and TIM3 gene is detected by Surveyor test and TIDE, as a result as shown in figure 24.

The cell of acquisition and P4 CAR-T cell without knockout and T cell are co-cultured with the H226 cell (H226-PDL1-luci) of expression PD-L1 and luciferase, CRL5826 cell (CRL5826-PDL1) respectively.

As shown in fig. 25 a, as effector cell: when the ratio of target cell (H226-PDL1-luci) is 4:1, after co-culturing 20h, in addition to P4 (TIM3 KO), other CAR-T cells through knocking out can hurt target cell with more more efficient than P4 killing；As shown in Figure 25 B, as effector cell: when the ratio of target cell (H226-PDL1-luci) is 0.1:1, after co-culturing 6 days, all CAR-T cells through knocking out can hurt target cell, *, P < 0.05.** with more more efficient than P4 killing, P < 0.01.***, P < 0.001.****, P < 0.0001.

Figure 26 is shown, as effector cell: when the ratio of target cell (CRL5826-PDL1) is 4:1, it co-cultures 24 hours (Figure 26 A) and after 48 hours (Figure 26 B), the CAR-T cells show through knocking out goes out to be not less than the tumor-killing effect of P4 CAR-T cell.

Figure 27 is shown, as effector cell: when the ratio of target cell (CRL5826-PDL1) is 0.1:1, it co-cultures 4 days (Figure 27 A) and after 6 days (Figure 27 B), the CAR-T cell through knocking out shows obviously tumor-killing effect more stronger than P4 CAR-T cell.

Figure 28 is shown, as effector cell: when the ratio of target cell (CRL5826-PDL1) is 0.02:1, it co-cultures 4 days (Figure 28 A) and after 6 days (Figure 28 B), the CAR-T cell through knocking out shows obviously tumor-killing effect more stronger than P4 CAR-T cell.

2. generating the CAR-T cell of one or more for knocking out PD-1, TIM3, CTLA4 and LAG3 respectively, knock out PD1 is indicated with P, and knock out TIM3 is indicated with T, and knock out CTLA4 is indicated with C, and knockout LAG3 indicates that knock out two or more genes is indicated with corresponding monogram with L.Such as PC indicates to knock out PD1 and CTLA4, and PCTL indicates that this four genes are all knocked.

By the CAR-T cell obtained through knocking out and P4 CAR-T cell and T cell respectively with the CRL5826 cell (CRL5826) of expressing luciferase, OVCAR3 cell (OVCAR3) and HCT116 cell (HCT116), the CRL5826 cell (CRL5826-PDL1), OVCAR3 cell (OVCAR3-PDL1) and HCT116 cell (HCT116-PDL1) for expressing PDL1 and luciferase are co-cultured.

Figure 29 is shown, as effector cell: when the ratio of target cell (CRL5826) is 1:1, it co-cultures 24 hours (Figure 29 A) and after 48 hours (Figure 29 B), the CAR-T cells show through knocking out goes out to be not less than the tumor-killing effect of P4 CAR-T cell.

Figure 30 is shown, as effector cell: when the ratio of target cell (CRL5826-PDL1) is 1:1, it co-cultures 24 hours (Figure 30 A) and after 48 hours (Figure 30 B), the CAR-T cells show through knocking out goes out to be not less than the tumor-killing effect of P4 CAR-T cell.

Figure 31 is shown, as effector cell: when the ratio of target cell is 1:1, after co-culturing 24 hours, the CAR-T cells show through knocking out goes out to be not less than the tumor-killing effect of P4 CAR-T cell.Target cell in Figure 31 A is the OVCAR3 cell (OVCAR3) of expressing luciferase, and the target cell in Figure 31 B is the OVCAR3 cell (OVCAR3-PDL1) for expressing PDL1 and luciferase.

Figure 32 is shown, as effector cell: when the ratio of target cell is 1:1, after co-culturing 24 hours, the CAR-T cells show through knocking out goes out to be not less than the tumor-killing effect of P4 CAR-T cell.Target cell in Figure 32 A is the HCT116 cell (HCT116) of expressing luciferase, and the target cell in Figure 32 B is the HCT116 cell (HCT116-PDL1) for expressing PDL1 and luciferase.

Figure 33 is shown, as effector cell: when the ratio of target cell is 1:1, after co-culturing 48 hours, the CAR-T cells show through knocking out goes out tumor-killing effect more stronger than P4 CAR-T cell.Target cell in Figure 33 A is the HCT116 cell (HCT116) of expressing luciferase, and the target cell in Figure 33 B is the HCT116 cell (HCT116-PDL1) for expressing PDL1 and luciferase.

Figure 34 is shown, as effector cell: when the ratio of target cell is 0.1:1, after co-culturing 4 days, the CAR-T cells show through knocking out goes out obviously tumor-killing effect more stronger than P4 CAR-T cell.Target cell in Figure 34 A is the CRL5826 cell (CRL5826) of expressing luciferase, and the target cell in Figure 34 B is the CRL5826 cell (CRL5826-PDL1) for expressing PDL1 and luciferase.

Figure 35 is shown, as effector cell: when the ratio of target cell is 0.1:1, after co-culturing 48 hours, the CAR-T cells show through knocking out goes out obviously tumor-killing effect more stronger than P4 CAR-T cell.Target cell in Figure 35 A is the OVCAR3 cell (OVCAR3) of expressing luciferase, and the target cell in Figure 35 B is the OVCAR3 cell (OVCAR3-PDL1) for expressing PDL1 and luciferase.

Experimental result explanation, the CAR-T cell that one or more repressible proteins of the invention are knocked is suitable with CAR-T cell effect is not knocked out under efficient target ratio, it is surprising that the CAR-T cell being knocked of the invention inefficient target ratio, under longer action time better than not knocking out CAR-T cell.This is particularly conducive to reduce cost, reduces preparation time, bring side effect when reducing high dose application.

Claims

A method of modified T cell is prepared, includes the steps that reducing or eliminating repressible protein in T cell and expresses.
The method of claim 1 wherein the T cell is the T cell comprising exogenous T-cell receptor (TCR) or Chimeric antigen receptor (CAR).
The method of claims 1 or 2, wherein the repressible protein being reduced or eliminated of expressing is selected from PD1, LAG-3, CTLA-4, Foxp3, Tim3 and combinations thereof.
The method of any one of claim 1-3, the wherein combination expressed the repressible protein being reduced or eliminated and be selected from PD1 and TIM3, the combination of PD1 and CTLA-4, the combination of PD1 and LAG3, the combination of CTLA-4 and TIM3, the combination of the combination of CTLA-4 and LAG3, TIM3 and LAG3, the combination of PD1, TIM3 and CTLA-4, the combination of PD1, CTLA-4 and LAG3, the combination of CTLA-4, TIM3 and LAG3, the combination of PD1, TIM3 and LAG3 or the combination of PD1, CTLA-4, TIM3 and LAG3.
The method of any one of claim 1-4, wherein by being reduced or eliminated described in antisense RNA, antagomir, siRNA, shRNA, meganuclease, Zinc finger nuclease, activating transcription factor sample effector nuclease or the implementation of CRISPR system.
Method for claim 5, wherein the CRISPR system is CRISPR/Cas9 system.
Method for claim 6, wherein the CRISPR/Cas9 system targets one or more the nucleotide sequence in SEQ ID NO:5,6,13,17,22-26 into the cell.
The method of any one of claim 2-7, wherein the TCR or CAR includes the antigen-binding domains for tumor associated antigen.
Method for claim 8, wherein the tumor associated antigen is selected from CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinomebryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), EGF-R ELISA (EGFR), EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40, bifunctional sialyltransferase gangliosides GD2, ductal epithelium mucoprotein, gp36, TAG-72, glycosyl sphingolipid, the relevant antigen of glioma, β-human chorionic gonadotrophin, alpha Fetoprotein (AFP), external source Agglutinin reactivity AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestines Carboxylesterase, mut hsp70-2, M-CSF, prostate enzyme (prostase), prostate enzyme spcificity antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and Telomerase, prostate cancer antigen -1 (PCTA-1), MAGE, ELF2M, Neutrophil elastase, ephrin B2, CD22, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, mesothelin, present main group of tumour-specific peptide epitopes Knit histocompatibility complex (MHC) molecule, 5T4, ROR1, Nkp30, NKG2D, tumor stroma antigen, the extra domain A (EDA) and extra domain B (EDB) of fibronectin, the A1 structural domain (TnC A1) of tenascin-C, fibroblast GAP-associated protein GAP (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptor, endothelial factor, major histocompatibility complex (MHC) molecule, BCMA (CD269, TNFRSF17), TNFRSF17 (UNIPRO T Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8).
The method of any one of claim 8-9, wherein the antigen-binding domains are selected from monoclonal antibody, the antibody of synthesis, human antibody, humanized antibody, single domain antibody, single chain antibody variable region and its antigen-binding fragment.
The method of any one of claim 2-10, wherein the CAR includes scFv (P4), CD8 hinge area, CD28 transmembrane domain, CD28 costimulation structural domain and the CD3 ζ signal transduction structural domain for mesothelin.
The method of claim 11, wherein the CAR includes amino acid sequence shown in SEQ ID NO:32.
The modified T cell prepared by the method for any one of claim 1-12.
The T cell of modification, wherein the expression of the repressible protein in the T cell is reduced or eliminated compared with unmodified T cell.
The modified T cell of claim 14, wherein the T cell is the T cell comprising exogenous T-cell receptor (TCR) or Chimeric antigen receptor (CAR).
The modified T cell of claims 14 or 15, wherein the repressible protein being reduced or eliminated of expressing is selected from PD1, LAG-3, CTLA-4, Foxp3, Tim3 and combinations thereof.
The modified T cell of any one of claim 14-16, the wherein combination expressed the repressible protein being reduced or eliminated and be selected from PD1 and TIM3, the combination of PD1 and CTLA-4, the combination of PD1 and LAG3, the combination of CTLA-4 and TIM3, the combination of CTLA-4 and LAG3, the combination of TIM3 and LAG3, the combination of PD1, TIM3 and CTLA-4, the combination of PD1, CTLA-4 and LAG3, the combination of CTLA-4, TIM3 and LAG3, the combination of PD1, TIM3 and LAG3 or the combination of PD1, CTLA-4, TIM3 and LAG3.
The modified T cell of any one of claim 14-17, wherein the TCR or CAR includes the antigen-binding domains for tumor associated antigen.
The modified T cell of claim 18, wherein the tumor associated antigen is selected from CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinomebryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), EGF-R ELISA (EGFR), EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40, bifunctional sialyltransferase gangliosides GD2, ductal epithelium mucoprotein, gp36, TAG-72, glycosyl sphingolipid, the relevant antigen of glioma, β-human chorionic gonadotrophin, alpha Fetoprotein (A FP), lectin reactivity AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestines Carboxylesterase, mut hsp70-2, M-CSF, prostate enzyme (prostase), prostate enzyme spcificity antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53, Prostein, PSMA, survival and Telomerase, prostate cancer antigen -1 (PCTA-1), MAGE, ELF2M, Neutrophil elastase, ephrin B2, CD22, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, mesothelin, present tumour-specific peptide Major histocompatibility complex (MHC) molecule of epitope, 5T4, ROR1, Nkp30, NKG2D, tumor stroma antigen, the extra domain A (EDA) and extra domain B (EDB) of fibronectin, the A1 structural domain (TnC A1) of tenascin-C, fibroblast GAP-associated protein GAP (fap), CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine receptor, endothelial factor, major histocompatibility complex (MHC) molecule, BCMA (CD269, TNFRSF17), TNFRSF17 ( UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1), FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708) and FCRL5 (UNIPROT Q68SN8).
The modified T cell of any one of claim 18-19, wherein the antigen-binding domains are selected from monoclonal antibody, the antibody of synthesis, human antibody, humanized antibody, single domain antibody, single chain antibody variable region and its antigen-binding fragment.
The modified T cell of any one of claim 15-20, wherein the CAR includes scFv (P4), CD8 hinge area, CD28 transmembrane domain, CD28 costimulation structural domain and the CD3 ζ signal transduction structural domain for mesothelin.
The modified T cell of claim 21, wherein the CAR includes amino acid sequence shown in SEQ ID NO:32.
The purposes of the modified T cell of any one of claim 13-22 in the preparation of medicament for cancer treatment.
For the pharmaceutical composition for the treatment of cancer, modified T cell and pharmaceutically acceptable carrier comprising any one of claim 13-23.
The purposes of claim 23 or the pharmaceutical composition of claim 24, wherein the cancer is selected from lung cancer, oophoroma, colon and rectum carcinoma, melanoma, kidney, bladder cancer, breast cancer, liver cancer, lymthoma, malignant hematologic disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal carcinoma, laryngocarcinoma, cervical carcinoma, corpus uteri tumor and osteosarcoma.It can include: osteocarcinoma with the example of other cancers of method or medicine composite for curing of the invention, cancer of pancreas, cutaneum carcinoma, prostate cancer, skin or intraocular malignant melanoma, uterine cancer, cancer of the anal region, carcinoma of testis, carcinoma of fallopian tube, carcinoma of endometrium, carcinoma of vagina, vaginal orifice cancer, Hodgkin's disease, non_hodgkin lymphoma, cancer of the esophagus, carcinoma of small intestine, internal system cancer, thyroid cancer, parathyroid carcinoma, adrenal, soft tissue sarcoma, carcinoma of urethra, carcinoma of penis, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), childhood solid tumor, lymphocytic lymphoma, bladder cancer, kidney or carcinoma of ureter, carcinoma of renal pelvis, central nervous system (CNS) tumour, primary CNS lymphoma, it is swollen Tumor angiogenesis, tumor of spine, brain stem glioma, pituitary adenoma, Kaposi sarcoma, epidermis shape cancer, squamous cell carcinoma, t cell lymphoma, ambient induced cancer, the combination of cancer and the cancer including Induced by Asbestos.
A kind of kit is used for method of the preparation through modifying T cell of any one of claim 1-12.