CN110747221A - Host aspergillus oryzae knockout system and construction method and application thereof - Google Patents

Abstract

The invention relates to a host aspergillus oryzae expression system and a construction method and application thereof. The method for constructing the host aspergillus oryzae expression system comprises the following steps: (i) constructing a knockout homologous arm on a multiple cloning site of the recombinant plasmid pBluescript-hph-rfp by a restriction enzyme digestion connection method; (ii) adding the activated aspergillus hyphae into a cell wall lyase solution to prepare a competent protoplast; then adding recombinant plasmid containing knockout homology arm to prepare transformed protoplast; (iii) and screening and culturing the transformed protoplast, and selecting a transformant to obtain a host aspergillus oryzae expression system. The RFP red fluorescent protein is applied to the gene knockout process of aspergillus oryzae for the first time, so that a large number of false positive transformants can be quickly and effectively eliminated.

Description

Host aspergillus oryzae knockout system and construction method and application thereof

Technical Field

The invention relates to a host aspergillus oryzae expression system, a construction method and application thereof, in particular to an aspergillus oryzae gene knockout system which is constructed by degrading the cell wall of fungi by using various wall-breaking enzymes, using double-screening plasmids with hygromycin resistance and RFP red fluorescent protein as mediation and by a protoplast transformation method, and belongs to the technical field of molecular biology.

Background

Aspergillus oryzae is widely used in industry and food industry because of its strong extracellular protein secretion capacity. Aspergillus oryzae grows faster, presents yellow or yellow green colony in the initial stage, changes into yellow brown along with the later stage of strain growth, and can produce a large amount of conidia. Aspergillus oryzae has a rich enzyme system and can produce protease, amylase, pectinase and the like. Due to its high protein secretion capacity, the selection and study of superior strains have become important in the study of Aspergillus oryzae.

With the development of scientific technology, the genetic modification method is widely applied to aspergillus oryzae through a genome engineering technology, and compared with the traditional methods such as chemical mutagenesis, physical mutagenesis, protoplast fusion and the like, the method has stronger purposiveness and higher efficiency. In the existing patents, an agrobacterium-mediated transformation mode is mostly used for transformation, so that the operation steps are relatively more, the operation is relatively complex, the culture time of agrobacterium is relatively longer, and the experiment time is increased. The existing transformation method is improved so as to obtain simpler operation, and the saving of transformation time and workload is an important content of research. Preparation of protoplasts for transformation is a transformation method used in filamentous fungi, and for example, in patents CN105463009A and CN103865948A, protoplasts are prepared in different filamentous fungi. The cell wall components of filamentous fungi are mainly chitin, glucan and mannan. The composition and proportion of the cell wall of different fungi are greatly different. Therefore, corresponding cell wall enzymolysis schemes are made for different strains so as to improve the preparation efficiency and quality of the protoplast.

In the genetic modification of Aspergillus oryzae, the commonly used transformation screening method comprises an auxotrophic marker and a resistance gene marker screening method. The auxotrophy of Aspergillus oryzae is difficult to obtain and complicated to manipulate, thus limiting the scope of application of this selectable marker. After the drug resistance gene is transferred, the strain can grow under the drug with a certain concentration, and the dominant screening marker is relatively widely applied. The commonly used antibiotics include hygromycin, bleomycin, phleomycin, huangan urea and the like. The use of drug resistance genes is therefore a frequently used screening method in the transformation of Aspergillus oryzae. However, aspergillus oryzae has resistance to various drugs, and the types of usable resistance markers are few, so that a false positive phenomenon (a non-transformant in which growth is not completely inhibited by antibiotics) is often observed in a process of screening by using a resistance gene, the selection and screening of positive transformants are influenced, and the workload in an experiment is increased.

Compared with green fluorescent protein, red fluorescent protein is reported for the first time in 1999, the longer excitation and emission wavelength of the red fluorescent protein can cover the wavelength band which cannot be related by the green fluorescent protein, and more importantly, the background of the red fluorescent protein is lower when the red fluorescent protein is observed in cells, so that the red fluorescent protein is more suitable for biological research. Therefore, the application of the red fluorescent protein to the Aspergillus oryzae transformation system is of great significance.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a host aspergillus oryzae knockout system, a construction method and application thereof, wherein a plasmid for double screening of hygromycin resistance and RFP fluorescent protein is used as a medium, and transformation is carried out in a protoplast preparation mode, so that the problems of complicated transformation operation and over-high false positive existing in the prior system are solved.

The technical problem solved by the invention is realized by adopting the following scheme:

a recombinant plasmid pBluescript-hph-rfp is prepared by the following method:

(1) taking the pCSR1 as a template, and carrying out PCR amplification to obtain a hygromycin resistance gene fragment;

the nucleotide sequence of the specific primer for PCR amplification is shown as SEQ ID NO.1 and SEQ ID NO. 2:

HPH-F：ATAAGCTTGATATCGAATTCGGAGGTCAACACATCAATGC；SEQ ID NO.1

HPH-R：ACGTCCTCGGAGGAGGCCATCTCTATTCCTTTGCCCTCGG；SEQ ID NO.2

(2) carrying out PCR amplification by using the plasmid pDB790 to obtain a red fluorescent protein expression gene segment;

the nucleotide sequence of the specific primer for PCR amplification is shown as SEQ ID NO.3 and SEQ ID NO. 4:

RFP-F：CCGAGGGCAAAGGAATAGAGATGGCCTCCTCCGAGGACGT；SEQ ID NO.3

RFP-R：GCTCTAGAACTAGTGGATCCTTAGGCGCCGGTGGAGTGGC；SEQ ID NO.4

(3) taking the hygromycin resistance gene fragment (HPH) prepared in the step (1) and the red fluorescent egg expression gene fragment (RFP) prepared in the step (2) as templates, and adopting primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.4 to perform overlap PCR amplification to prepare an HPH + RFP expression element;

(4) and (3) carrying out double digestion on the vector pBluescript and the HPH + RFP expression element prepared in the step (3) by restriction enzymes EcoR I and BamH I, and then carrying out ligation to prepare the recombinant plasmid pBluescript-HPH-RFP.

Preferably, in step (1), the PCR amplification system is as follows:

the PCR amplification procedure was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, and 32 cycles; extension at 72 ℃ for 5 min.

Preferably, in step (2), the PCR amplification system is as follows:

the PCR amplification procedure was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; extension at 72 ℃ for 5 min.

Preferably, in step (3), the overlap PCR amplification system is as follows:

the Overlap PCR amplification program was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 2min, and 32 cycles; extension at 72 ℃ for 5 min.

Preferably, in the step (4), the ligation condition is T4 ligase at 16 ℃ for 3 h.

A host Aspergillus oryzae expression system contains the recombinant plasmid pBluescript-hph-rfp.

The construction method of the host aspergillus oryzae expression system comprises the following steps:

(i) constructing a knockout homologous arm on a multiple cloning site of the recombinant plasmid pBluescript-hph-rfp by a restriction enzyme digestion connection method;

(ii) adding the activated aspergillus hyphae into a cell wall lyase solution, carrying out enzymolysis for 2.5 hours at 30 ℃, filtering and centrifuging, and suspending an STC solution to obtain a competent protoplast; then adding the recombinant plasmid containing the knockout homology arm prepared in the step (i), and standing for 25min at room temperature in a PEG4000 solution environment with the mass percent of 60% to prepare a transformed protoplast;

the cell wall lyase solution comprises the following components in percentage by mass:

1% cellulase (cellulose), 1% lyase (lysing), 0.15% Snailase (Snailase), and the balance of NaCl aqueous solution with concentration of 0.7M;

(iii) and (3) screening and culturing the transformed protoplast prepared in the step (ii) in a complete culture medium containing hygromycin at the temperature of 26-29 ℃ for 70-75 h, selecting transformants, and carrying out gene verification to obtain a host aspergillus oryzae expression system.

Preferably, in step (ii), the STC solution has the following components:

sorbitol 0.8M, Tris-HCl 50mM, CaCl₂50mM，pH8.0。

Preferably, according to the invention, in step (iii), the concentration of hygromycin is 600 mg/ml.

Preferably, in step (iii), the complete medium has the following composition per liter:

50ml of nitrogen salt solution, 10g of glucose, 2g/L of peptone, 1g/L of yeast extract, 1g/L of hydrolyzed casein and 15g/L of agar powder; the nitrogen salt solution comprises the following components per liter:

NaNO₃120g、KCl 10.4g、MgSO₄·7H₂O 10.4g、KH₂PO₄30.4g。

the host Aspergillus oryzae expression system is applied to expressing foreign protein extracellularly.

According to a preferred embodiment of the present invention, the steps of the application are as follows:

inserting the foreign protein expression gene into a polyclonal site in a recombinant plasmid pBluescript-hph-rfp, preparing an Aspergillus oryzae knockout system containing a knockout homologous arm, performing culture verification to obtain an Aspergillus oryzae knockout mutant, and performing fermentation culture to obtain the recombinant Aspergillus oryzae mutant.

Advantageous effects

The RFP red fluorescent protein is applied to the gene knockout process of aspergillus oryzae for the first time, the transformation effect is directly observed, a large number of false positive transformants can be quickly and effectively eliminated, the workload caused by extracting a large number of DNA in the experiment is reduced, and the experimental deficiency caused by the fact that a large number of false positive transformants of the resistance gene are singly used due to the strong resistance of aspergillus oryzae in the gene modification process is made up.

Drawings

FIG. 1 is a schematic diagram of the construction structure of the recombinant plasmid pBluescript-hph-rfp of the present invention;

FIG. 2 is a photograph showing the results of electrophoresis of recombinant plasmid and single enzyme digestion detection result in the present invention;

wherein: lanes 1, 4 and 6 are Marker, lane 2 is HPH gene, lane 3 is RFP gene, lane 5 is HPH gene and RFP gene overleap PCR fragment; lane 7 is the EcoR I single enzyme digestion verification pBluescript-hph-rfp recombinant vector;

FIG. 3 is a schematic diagram of the construction of a knockout vector of the present invention;

FIG. 4 is a photograph showing the results of the transformants obtained by the present invention;

FIG. 5 is a photograph showing the results of fluorescence observation of the transformant obtained in the present invention;

FIG. 6 is a photograph showing the results of verifying hygromycin resistance of protoplasts obtained by the different methods in the comparative example.

Detailed Description

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to be understood and clear, the invention is further described by combining the specific embodiments.

Source of vector

The vector of pBluescript in the examples can be obtained according to the references M.A. typing-Mees and J.M.Short.pBluescript II gene mapping vectors, nucleic Acids Res.1989Nov 25; 17(22) 9494. the content disclosed in the above-mentioned publication is obtained by means of construction;

the pCSR1 refers to hph vector such as cyclosporine A-resistance based gene placement system for Neurospora crassa. Fungal Genet biol.2007 May; (44) (5) 307-14.Epub2007Jan 12. obtaining the vector information;

the pDB790 vector can refer to Efficient diagnosis of Zebraphis genes using a Gal 4-ligation gene trap. BMC genes.2013Sep 14; 14:619.doi: 10.1186/1471. 2164-14-619. the carrier information is obtained.

Cellulase was purchased from Sigma-Aldrich;

lyase was purchased from Sigma-Aldrich;

the snailase is purchased from Beijing Soilebao science and technology Limited;

examples

A method for constructing an Aspergillus oryzae gene knockout system mediated by hygromycin resistance and RFP fluorescent protein plasmids comprises the following steps:

1) construction of HPH + RFP expression elements

① cloning hygromycin resistance gene, the sequence is shown in SEQ ID NO. 5, and the nucleotide sequence of the used primer is as follows:

HPH-F：ATAAGCTTGATATCGAATTCGGAGGTCAACACATCAATGC；SEQ ID NO.1

HPH-R：ACGTCCTCGGAGGAGGCCATCTCTATTCCTTTGCCCTCGG；SEQ ID NO.2

the size of the obtained fragment was 1.4kb, and 20bp sequences of the backbone fragment and 20bp sequences of RFP initiation (underlined) were added to both ends of the fragment; the RFP sequence is amplified, and the tail 20bp sequence of the HPH sequence and the 20bp base (underlined) on the skeleton are added to the two ends of the same primer respectively, and the nucleotide sequences of the primers are as follows:

RFP-F:CCGAGGGCAAAGGAATAGAGATGGCCTCCTCCGAGGACGT；SEQ ID NO.3

RFP-R：GCTCTAGAACTAGTGGATCCTTAGGCGCCGGTGGAGTGGC；SEQ ID NO.4

the size of the amplified fragment is 0.7kb, and the sequence is shown in SEQ ID NO. 6; when designing the primers, 20bp repeat sequences (20 bp underlined in the primers) were added to the positions where the two fragments need to be ligated, and the primers were used as homology arms, and the two fragments were amplified by overlap PCR using HPH-F and RFP-R as primers as templates, to form an HPH + RFP expression element of 2.1kb (the result is shown in FIG. 2).

② As shown in FIG. 1, the vector pBluescript and the vector HPH + RFP expression elements are subjected to double enzyme digestion at 37 ℃ by using EcoR I and BamH I, and the enzyme digestion is carried out for 5 hours, so that the same sticky ends are formed at both ends of the vector skeleton and the fragment, the enzyme digestion products are recovered, and then the two enzyme digestion products are connected by using T4 ligase, so as to obtain the expression vector (shown in FIG. 1) capable of expressing hygromycin and red fluorescent protein in Aspergillus oryzae, the size of the recombinant expression vector is 5.2kb, and the recombinant vector is verified by single enzyme digestion by using EcoR I (the result is shown in FIG. 2).

2) Construction of knockout vectors

Taking the pBluescript-HPH-RFP recombinant vector as a framework, carrying out PCR cloning on about 1000bp sequences at two ends of a gene to be knocked out, and respectively connecting the sequences at the upper end and the lower end of the knocked-out gene to two ends of an HPH + RFP expression element in the pBluescript-HPH-RFP recombinant vector by utilizing an enzyme digestion linking method to form a vector used for knocking out the gene finally (shown in figure 3). Finally, the constructed plasmid can directly enter the aspergillus oryzae cells by a protoplast transformation method, and gene recombination is carried out to complete the gene recombination process.

3) Preparation and transformation of Aspergillus oryzae competent cells

The Aspergillus oryzae mycelia obtained by the cultivation were cultured at 30 ℃ for 14 hours at 160rpm, filtered through 1 filter cloth (Miracloth), added to 30mL of a cell wall lysate (1% cellulose, 1% lysine and 0.15% Snail dissolved in 0.7M NaCl), enzymatically digested at 28 ℃ for 3 hours to obtain protoplasts, centrifuged, and then digested with 150ul of 1 XSSC (20% Sucrose, 50mM Tris. Cl (pH 8.0), 50mM CaCl₂) And (5) suspending to obtain competent cells. 10ug of plasmid was transformed and added to competent cells, and 1mL of 60% PEG4000 was added simultaneously, pipetted and mixed well and left at room temperature for 25 min.

4) Plate culture and transformant screening

Adding the complete culture medium, cooling to 45 ℃, uniformly mixing the product obtained in the previous step, pouring the mixture into a culture dish, and blow-drying and solidifying to form a first layer of culture medium; then pouring the complete culture medium added with 600ug/ml hygromycin onto the first layer of culture medium, solidifying to form the upper layer of drug-containing culture medium, and carrying out resistance screening on the transformants. The resulting transformant colonies were observed by placing the above petri dish upside down and culturing at 28 ℃ for 3 days in the dark (the results are shown in FIG. 4).

A small amount of hyphae of the grown transformant was directly picked up and placed on a slide glass, and the expression of the red fluorescent protein was directly observed by a fluorescence microscope under excitation light of 561nm to confirm the gene transfer results (the fluorescence observation results are shown in FIG. 5). And extracting DNA from the hyphae of the observed red fluorescent colony for PCR amplification, and verifying whether the gene is successfully knocked out. The result proves that the invention can effectively reduce the false positive rate of the transformant, reduce the screening workload and overcome the problem of insufficient resistance screening markers in the existing system.

Comparative example

Three different enzymolysis solutions are adopted to prepare protoplasts, hygromycin resistance screening is carried out, the sensitivity of the protoplasts prepared by different methods to hygromycin resistance is observed, and culture on a hygromycin-free culture medium is adopted as a control.

A: hygromycin resistance was verified by the method of protoplast preparation in the examples.

B: the protoplasts were prepared as described in the examples, except that cell wall enzymolysis was performed with 2.5% driselase (purchased from Sigma-Aldrich) and 0.5% lysine for 3 hours at 30 ℃ and then the prepared protoplasts were subjected to hygromycin resistance verification.

C: the method for preparing protoplasts was as described in the examples, except that the protoplasts were prepared using 0.5% lysine configured enzymatic hydrolysate, subjected to enzymatic hydrolysis at 30 ℃ for 3 hours, and then subjected to hygromycin resistance verification.

As shown in Table 1 and FIG. 1, the protoplasts prepared by the method of the present invention are more sensitive to hygromycin, which can also reduce the effect of strong resistance of Aspergillus oryzae and reduce the number of false positive colonies in the subsequent screening process.

TABLE 1

Sequence listing

<110> university of Qilu Industrial science

Institute of biological research of Shandong province academy of sciences

<120> host aspergillus oryzae knockout system, and construction method and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>40

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

ataagcttga tatcgaattc ggaggtcaac acatcaatgc 40

<210>2

<211>40

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

acgtcctcgg aggaggccat ctctattcct ttgccctcgg 40

<210>3

<211>40

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

ccgagggcaa aggaatagag atggcctcct ccgaggacgt 40

<210>4

<211>40

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

gctctagaac tagtggatcc ttaggcgccg gtggagtggc 40

<210>5

<211>1346

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

ggaggtcaac acatcaatgc ctattttggt ttagtcgtcc aggcggtgag cacaaaattt 60

gtgtcgtttg acaagatggt tcatttaggc aactggtcag atcagcccca cttgtagcag 120

tagcggcggc gctcgaagtg tgactcttat tagcagacag gaacgaggac attattatca 180

tctgctgctt ggtgcacgat aacttggtgc gtttgtcaag caaggtaagt ggacgacccg 240

gtcatacctt cttaagttcg cccttcctcc ctttatttca gattcaatct gacttaccta 300

ttctacccaa gcatccaaat gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt 360

ctgatcgaaa agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct 420

cgtgctttca gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc 480

gatggtttct acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt 540

ccggaagtgc ttgacattgg ggagttcagc gagagcctga cctattgcat ctcccgccgt 600

gcacagggtg tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctccagccg 660

gtcgcggagg ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc 720

ccattcggac cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt 780

gctgatcccc atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc 840

gcgcaggctc tcgatgagct gatgctttgg gccgaggact gccccgaagt ccggcacctc 900

gtgcatgcgg atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc 960

attgactgga gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcctcttc 1020

tggaggccgt ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg 1080

gagcttgcag gatcgccgcg cctccgggcg tatatgctcc gcattggtct tgaccaactc 1140

tatcagagct tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac 1200

gcaatcgtcc gatccggagc cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg 1260

gccgtctgga ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc 1320

actcgtccga gggcaaagga atagag 1346

<210>6

<211>678

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

atggcctcct ccgaggacgt catcaaggag ttcatgcgct tcaaggtgcg catggagggc 60

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

acccagaccg ccaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc180

ctgtcccctc agttccagta cggctccaag gcctacgtga agcaccccgc cgacatcccc 240

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 360

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 420

atgggctggg aggcctccac cgagcggatg taccccgagg acggcgccct gaagggcgag 480

atcaagatga ggctgaagct gaaggacggc ggccactacg acgccgaggt caagaccacc 540

tacatggcca agaagcccgt gcagctgccc ggcgcctaca agaccgacat caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggaacagt acgagcgcgc cgagggccgc 660

cactccaccg gcgcctaa 678

Claims (10)

1. A recombinant plasmid pBluescript-hph-rfp is characterized by being prepared by the following method:

(1) taking the pCSR1 as a template, and carrying out PCR amplification to obtain a hygromycin resistance gene fragment;

the nucleotide sequence of the specific primer for PCR amplification is shown as SEQ ID NO.1 and SEQ ID NO. 2:

(2) performing PCR amplification by using pDB790 to obtain a red fluorescent protein expression gene segment;

the nucleotide sequence of the specific primer for PCR amplification is shown as SEQ ID NO.3 and SEQ ID NO. 4:

(3) taking the hygromycin resistance gene fragment prepared in the step (1) and the red fluorescent egg expression gene fragment prepared in the step (2) as templates, and performing overlap PCR amplification by using primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.4 to prepare an HPH + RFP expression element;

(4) and (3) carrying out double digestion on the vector pBluescript and the HPH + RFP expression element prepared in the step (3) by restriction enzymes EcoR I and BamH I, and then carrying out ligation to prepare the recombinant plasmid pBluescript-HPH-RFP.

2. The recombinant plasmid pBluescript-hph-rfp according to claim 1, wherein in step (1), the PCR amplification system is as follows:

the PCR amplification procedure was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, and 32 cycles; extension at 72 ℃ for 5 min.

3. The recombinant plasmid pBluescript-hph-rfp according to claim 1, wherein in step (2),

the PCR amplification system is as follows:

the PCR amplification procedure was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; extension at 72 ℃ for 5 min.

4. The recombinant plasmid pBluescript-hph-rfp according to claim 1, wherein in step (3),

the overlap PCR amplification system is as follows:

the Overlap PCR amplification program was as follows:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 2min, and 32 cycles; extension at 72 ℃ for 5 min.

5. The recombinant plasmid pBluescript-hph-rfp according to claim 1, wherein in step (4), the ligation is performed under T4 ligase at 16 ℃ for 3 h.

6. A host Aspergillus oryzae expression system comprising the recombinant plasmid pBluescript-hph-rfp of claim 1.

7. The method of constructing an Aspergillus oryzae expression system of claim 6, comprising the steps of:

(i) constructing a knockout homologous arm on a multiple cloning site of the recombinant plasmid pBluescript-hph-rfp by a restriction enzyme digestion connection method;

(ii) adding the activated aspergillus hyphae into a cell wall lyase solution, carrying out enzymolysis for 2.5 hours at 30 ℃, filtering and centrifuging, and suspending an STC solution to obtain a competent protoplast; then adding the recombinant plasmid containing the knockout homology arm prepared in the step (i), and standing for 25min at room temperature in a PEG4000 solution environment with the mass percent of 60% to prepare a transformed protoplast;

the cell wall lyase solution comprises the following components in percentage by mass:

1% cellulase (cellulose), 1% lyase (lysing), 0.15% Snailase (Snailase), and the balance of NaCl aqueous solution with concentration of 0.7M;

(iii) and (3) screening and culturing the transformed protoplast prepared in the step (ii) in a complete culture medium containing hygromycin at the temperature of 26-29 ℃ for 70-75 h, selecting transformants, and carrying out gene verification to obtain a host aspergillus oryzae expression system.

8. The method of claim 7, wherein in step (ii), the STC solution has the following composition:

sorbitol 0.8M, Tris-HCl 50mM, CaCl₂50mM，pH8.0；

Preferably, in step (iii), the concentration of hygromycin is 600 mg/ml;

preferably, in step (iii), the complete medium has the following composition per liter:

50ml of nitrogen salt solution, 10g of glucose, 2g/L of peptone, 1g/L of yeast extract, 1g/L of hydrolyzed casein and 15g/L of agar powder; the nitrogen salt solution comprises the following components per liter:

NaNO₃120g、KCl 10.4g、MgSO₄·7H₂O 10.4g、KH₂PO₄30.4g。

9. use of the host A.oryzae expression system of claim 6 to express a foreign protein extracellularly.

10. Use according to claim 9, characterized by the steps of:

inserting the foreign protein expression gene into a polyclonal site in a recombinant plasmid pBluescript-hph-rfp, preparing an Aspergillus oryzae knockout system containing a knockout homologous arm, performing culture verification to obtain an Aspergillus oryzae knockout mutant, and performing fermentation culture to obtain the recombinant Aspergillus oryzae mutant.

Images