CN110747156A - Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin - Google Patents
Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin Download PDFInfo
- Publication number
- CN110747156A CN110747156A CN201911123113.XA CN201911123113A CN110747156A CN 110747156 A CN110747156 A CN 110747156A CN 201911123113 A CN201911123113 A CN 201911123113A CN 110747156 A CN110747156 A CN 110747156A
- Authority
- CN
- China
- Prior art keywords
- nanr
- bacillus amyloliquefaciens
- gene
- deoxynojirimycin
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/10—Nitrogen as only ring hetero atom
- C12P17/12—Nitrogen as only ring hetero atom containing a six-membered hetero ring
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the field of genetic engineering, and particularly relates to application of knocking out a nanR gene of bacillus amyloliquefaciens in improving the yield of 1-deoxynojirimycinnanRGene, successfully obtained deletionnanRGenetically modified Bacillus amyloliquefaciens LX-12 deltananR. Relative to Bacillus amyloliquefaciens LX-12, the engineering strain LX-12 delta constructed by the inventionnanRThe yield of the fermented 1-deoxynojirimycin is increased by at least 15 percent, and a new method is provided for increasing the yield of the 1-deoxynojirimycin.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to application of knocking out a nanR gene of bacillus amyloliquefaciens in improving the yield of 1-deoxynojirimycin.
Background
1-deoxynojirimycin (1-deoxynojirimycin) is called DNJ or 1-DNJ, is a polyhydroxy piperidine alkaloid and has strong α -glucosidase inhibition activity, 1-deoxynojirimycin and derivatives thereof are widely regarded as efficient glycosidase inhibitors in drug development.
The NanR is a transcription regulatory factor, and the regulation network and the regulation specific gene of the NanR in the Bacillus amyloliquefaciens are not related to reports. According to the bacillus amyloliquefaciens strain, the transcription regulation factor NanR in the bacillus amyloliquefaciens LX-12 is knocked out, so that the yield of the bacillus amyloliquefaciens 1-deoxynojirimycin is increased. The invention improves the yield of 1-deoxynojirimycin by knocking out the transcription factor gene nanR for the first time, and provides a new method for the high yield of 1-deoxynojirimycin.
Disclosure of Invention
The invention aims to provide application of knocking out a nanR gene of bacillus amyloliquefaciens in improving the yield of 1-deoxynojirimycin.
Another object of the present invention is to provide a method for knocking out the nanR gene of Bacillus amyloliquefaciens.
The last purpose of the invention is to provide the application of the bacillus amyloliquefaciens with the nanR gene knocked out in the high yield of the 1-deoxynojirimycin.
In order to achieve the purpose, the invention adopts the following technical measures:
the application of knocking out a nanR gene of bacillus amyloliquefaciens in improving the yield of 1-deoxynojirimycin comprises knocking out the nanR gene of the bacillus amyloliquefaciens by using the conventional technology of the invention, wherein the knocked-out strain can be used for fermentation production of the 1-deoxynojirimycin;
in the above application, preferably, the bacillus amyloliquefaciens is a strain for producing 1-deoxynojirimycin;
in the above application, preferably, the preservation number of the bacillus amyloliquefaciens is CCTCC NO: m2015234.
In the application, the method for knocking out the nanR of the gene of the bacillus amyloliquefaciens comprises the following steps:
(1) taking the genome DNA of bacillus amyloliquefaciens LX-12(CCTCC NO: M2015234) as a template, and carrying out PCR amplification to obtain an upstream homologous arm of the nanR gene and a downstream homologous arm of the nanR gene;
(2) connecting an upstream homology arm of the nanR gene and a downstream homology arm of the nanR gene together by overlap extension PCR to form a target gene segment;
(3) carrying out double enzyme digestion on the target gene fragment by adopting SacI and XbaI restriction endonucleases to obtain an enzyme digestion gene fragment;
(4) preparing plasmid T2(2) -ori, and performing double digestion on the plasmid T2(2) -ori by using SacI and XbaI restriction enzymes to obtain a linear plasmid fragment;
(5) connecting the enzyme-digested gene fragment obtained in the step (3) with the linear plasmid fragment obtained in the step (4) by using DNA ligase to obtain a knockout plasmid T2(2) -delta nanR;
(6) transferring the knockout plasmid T2(2) -delta nanR into Bacillus amyloliquefaciens LX-12, and screening by taking kanamycin as a screening marker to obtain a positive transformant;
(7) after the positive transformant is subjected to transfer culture for a plurality of times, colony PCR detection is carried out to obtain a positive single-exchange conjugant strain which generates single exchange between the upstream homologous arm of the nanR gene or the downstream homologous arm of the nanR gene and the genome DNA of the bacillus amyloliquefaciens LX-12;
(8) selecting an upstream homology arm of a nanR gene and a positive single-exchange binder strain which generates single exchange with the genomic DNA of the Bacillus amyloliquefaciens LX-12, mixing the downstream homology arm of the nanR gene and the positive single-exchange binder strain which generates single exchange with the genomic DNA of the Bacillus amyloliquefaciens LX-12, inoculating the mixture into a culture medium which does not contain kanatin, and performing transfer culture for several times, and screening by a PCR (polymerase chain reaction) method to obtain the Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LX-12 delta nanR of which the nanR gene is knocked out;
in the above application, preferably, when 1-deoxynojirimycin is produced by fermentation of a strain in which a nanR gene of bacillus amyloliquefaciens is knocked out in the application process, the formula of a fermentation medium is as follows:
60-100g/L of soybean meal; 50-80g/L corn starch; 0.5-1.0g/L KH2PO4;0.3-0.6g/L MgSO4·7H2O;0.1-0.3g/LFeSO4·7H2O;0.01-0.05g/L MnSO4·H2O and the balance of water.
Compared with the prior art, the invention has the following advantages:
compared with the Bacillus amyloliquefaciens LX-12, the yield of the 1-deoxynojirimycin of the Bacillus amyloliquefaciens LX-12 delta nanR constructed by the invention is improved by more than 15 percent. The research result of the invention shows that: the nanR in the genome DNA of the bacillus amyloliquefaciens LX-12 is knocked out, so that a novel method is provided for improving the yield of 1-deoxynojirimycin.
Drawings
FIG. 1 is an agarose gel of the upstream homology arm of the nanR gene and the downstream homology arm of the nanR gene obtained in step (1) of example 1;
wherein, Lane M is DNA marker, Lane 1 is the upstream homology arm of nanR gene, and Lane 2 is the downstream homology arm of nanR gene.
FIG. 2 is an agarose gel of the target gene fragment obtained in step (2) of example 1;
wherein, Lane M is DNA marker, Lane 1 is the target gene fragment obtained in step (2).
FIG. 3 is a diagram showing the confirmation of colony PCR of the knockout plasmid T2(2) - Δ nanR obtained in step (5) of example 1;
wherein, lane M is DNA marker, and lane 1 is the band of knockout plasmid T2(2) - Δ nanR for colony PCR verification.
FIG. 4 is a band for verifying Bacillus amyloliquefaciens LX-12. delta. nanR in which the nanR gene was knocked out, obtained in step (8) of example 1.
Wherein, Lane M is DNA marker, Lane 1 is the verification band of Bacillus amyloliquefaciens LX-12 delta nanR, and Lane 2 is the control band of Bacillus amyloliquefaciens LX-12.
Wherein, the corresponding molecular weights of the top to bottom bands in the DNA marker lane are as follows: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof. The technical scheme of the invention is a conventional scheme in the field if not specifically stated; the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
obtaining of NAnR gene-deleted Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LX-12 delta nanR:
the nucleotide sequence of the nanR gene is shown as SEQ ID NO. 1.
(1) Taking the genome DNA of the bacillus amyloliquefaciens LX-12 as a template, and carrying out PCR amplification to obtain an upstream homologous arm (primers are nanR-F1 and nanR-R1) of a nanR gene and a downstream homologous arm (primers are nanR-F2 and nanR-R2) of the nanR gene;
nanR-F1:GGGAGCTC GGATGACCCGATACTTGAA、
nanR-R1:TGTGGATCCGGATAGCAGGCCGAGAACACTGGATGA、
nanR-F2:TCATCCAGTGTTCTCGGCCTGCTATCCGGATCCACA、
nanR-R2:GCTCTAGAGCCGCACAGATTCATAGA;
(2) taking an upstream homologous arm of the nanR gene and a downstream homologous arm fragment of the nanR gene as templates, taking an upstream homologous arm primer nanR-F1 and a downstream homologous arm primer nanR-R2 as primers, and connecting the upstream homologous arm of the nanR gene and the downstream homologous arm of the nanR gene together through overlap extension PCR to obtain a target gene fragment 1079 bp;
(3) carrying out double enzyme digestion on the target gene fragment by adopting SacI and XbaI restriction endonucleases to obtain an enzyme digestion gene fragment;
(4) preparing plasmid T2(2) -ori, and performing double digestion on the plasmid T2(2) -ori by using SacI and XbaI restriction enzymes to obtain a linear plasmid fragment;
(5) transferring the ligation product into escherichia coli DH5 α by a calcium chloride conversion method, screening by a culture medium containing kanamycin resistance at 37 ℃ to obtain a transformant, and performing colony PCR verification on a transformant plasmid (the used primers are T2-F and T2-R), wherein if the PCR verification result of the transformant is that an electrophoresis band appears at 1379bp, the construction of the knockout vector is successful, and the transformant is a positive transformant and is named as the knockout vector T2(2) -delta nanR;
(6) the knockout vector T2(2) -delta nanR is transferred into Bacillus amyloliquefaciens HX-12, screened by a kanamycin-resistant culture medium at 37 ℃, screened to obtain a transformant, and subjected to colony PCR verification on a transformant plasmid (the used primers are T2-F and T2-R). If the PCR verification result of the transformant is as follows: the appearance of an electrophoretic band at 1379bp, which demonstrates that: the knockout vector T2(2) -delta nanR is successfully transferred into the bacillus amyloliquefaciens LX-12. At this time, the transformant was a positive transformant (i.e., Bacillus amyloliquefaciens LX-12 into which the knock-out vector T2(2) - Δ nanR had been transferred);
wherein the sequences of T2-F and T2-R are:
T2-F:ATGTGATAACTCGGCGTA、
T2-R:GCAAGCAGCAGATTACGC;
(7) transferring and culturing the positive transformant obtained in the step (6) on a kanamycin-resistant culture medium at the temperature of 45 ℃ for 3 times, culturing for 12 hours each time, carrying out colony PCR detection on a single-crossover strain by taking T2-F and delta nanR-KYR as primers (or taking T2-R and delta nanR-KYF as primers), and amplifying a band with the length of 1819bp or 2896bp to obtain a single-crossover strain;
wherein the sequence of delta nanR-KYF and delta nanR-KYR is as follows:
ΔnanR-KYF:TTATGTAGTGAGGCTCAGAATC、
ΔnanR-KYR:TGACGAACGCAATAAAAG;
(8) and (3) carrying out mixed inoculation culture on the single-exchange strain with the 1589bp band in the PCR detection obtained in the step (7) and the single-exchange strain with the 2285bp band in the PCR detection obtained in the step (7), carrying out transfer culture for a plurality of times in a culture medium without kanamycin at 37 ℃, and picking transformants for colony PCR verification (primers are delta nanR-KYF and delta nanR-KYR). If the PCR verification result of the transformant is as follows: when an electrophoresis band appears at 1711bp, the gene reversion is indicated, and the transformant is bacillus amyloliquefaciens LX-12; when an electrophoresis band appears at 1401bp, the successful knockout of the nanR gene on the genome of LX-12 is shown, and the transformant is a positive transformant. And then carrying out DNA sequencing further verification on the positive transformant to obtain a nanR knockout strain with successful double exchange, namely the Bacillus amyloliquefaciens LX-12 delta nanR.
Example 2:
application of NAnR gene-deleted Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LX-12 delta nanR in high yield of 1-deoxynojirimycin:
the fermentation medium used in this example was as follows:
TABLE 1 fermentation Medium formulation
The seed fermentation comprises the following specific steps: activating bacillus amyloliquefaciens (the bacillus amyloliquefaciens LX-12 or the bacillus amyloliquefaciens LX-12 delta nanR), namely inoculating 1 percent of glycerol pipe in volume percentage into an LB culture medium containing 5mL, culturing at 230r/min and 37 ℃ for 12 hours, and then inoculating the bacterial liquid after the bacterial activation to the culture medium of seed fermentation at 230r/min and 37 ℃ in volume percentage according to the inoculation amount of 3 percent for culturing for 10 hours to obtain the bacterial liquid of seed culture; (the formulation of the seed fermentation medium herein is LB medium (formulation: 10g/L peptone, 5g/L yeast powder, 10g/L NaCl, pH7.20))
The production and fermentation method comprises the following specific steps: 50mL of the fermentation medium shown in Table 1 was placed in a 500mL triangular flask, and the strain solution obtained by seed culture was inoculated in an amount of 2.5% (by volume), rotated at 230r/min and heated at 37 ℃ for fermentation for 72 hours to obtain a strain solution for production fermentation.
And (3) determining the yield of the 1-deoxynojirimycin in the fermented bacterial liquid by adopting a High Performance Liquid Chromatography (HPLC) method. The measurement conditions are specifically as follows: the chromatographic column is ZORBAX SB-C18 (specification: 5 μm, 4.6X 150mm), the detector is UVD 170U ultraviolet detector, the detection wavelength is 254nm, the mobile phase is acetonitrile-0.1% acetic acid (11:16, V/V), the flow rate is 1.0mL/min, and the sample injection amount is 20 μ l. After the test, the chromatographic column is washed by the mobile phase for 30min to remove impurities, then washed by acetonitrile for 30min, and finally balanced by methanol for 30min to be stored. The yield of 1-deoxynojirimycin in the fermented bacterial liquid was calculated according to a standard curve prepared from the 1-deoxynojirimycin standard (see table 2).
TABLE 2
From table 2, it can be seen that under the same conditions of seed fermentation and production fermentation, the titer of 1-deoxynojirimycin in the bacterial liquid of production fermentation using bacillus amyloliquefaciens LX-12 Δ nanR of the present invention is greatly increased (by more than 15%) compared to bacillus amyloliquefaciens LX-12 of the prior art, indicating that: the technical scheme of the invention has great application value in the aspect of improving the yield of the 1-deoxynojirimycin of the bacillus amyloliquefaciens.
Sequence listing
<110> university of Hubei
Application of knockout bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>687
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggagatat ccaaaacaag cagactgtcg ctcgtagaac aagtggtggc gcaaattgaa 60
tcgttaattc aatcggataa atggccggtc gggacgcgca ttccccctga gctggattta 120
atgaagcaat ttgatgtgag ccgaaacacg ttgcgtgagg ccattcgggc gctcgtacat 180
gccggcctgc ttcagacaag gcaggggagc ggtacgtatg tcagctcatc cagtgttctc 240
ggcgcggcat tttaccgcca tattaaaaaa tcaaatttgc ttgaaacatt agaagtcaga 300
tacgcactcg aaagagaagc tgcacgattg gcggcggaaa ggcgtaatga cgaagacctg 360
aaagcactga aggcatgctt ggatgaatgt gaagcggcct tgcaaaatga agatcgaaaa 420
cggtatgccg aagccgacat taagctgcac aaaacaattg tacaggcggc ccataacaat 480
atgctttctg atctatacga gcatatgacg gaggcgcttt gtgcgtcagt ccataacctg 540
ttggaaatca cccctgctat ccggatccac acccagcttg ccgccgcaat tatcggacag 600
aaaccggatc aggccatgga ggccgtcaac caatacatca cagtatttaa agatacaata 660
cacatggagg atgaacatga aaattaa 687
<210>2
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gggagctcgg atgacccgat acttgaa 27
<210>3
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tgtggatccg gatagcaggc cgagaacact ggatga 36
<210>4
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tcatccagtg ttctcggcct gctatccgga tccaca 36
<210>5
<211>36
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tcatccagtg ttctcggcct gctatccgga tccaca 36
<210>6
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atgtgataac tcggcgta 18
<210>7
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gcaagcagca gattacgc 18
<210>8
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ttatgtagtg aggctcagaa tc 22
<210>9
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tgacgaacgc aataaaag 18
Claims (5)
1. The application of knocking out a nanR gene of bacillus amyloliquefaciens in improving the yield of 1-deoxynojirimycin.
2. Use according to claim 1, wherein the bacillus amyloliquefaciens is a strain producing 1-deoxynojirimycin.
3. The use of claim 1, wherein the bacillus amyloliquefaciens has a preservation number of CCTCC NO: m2015234.
4. Use according to claim 3 of said knockout Bacillus amyloliquefaciensnanRGene,The method comprises the following steps:
(1) the preservation number is CCTCC NO: m2015234 genome DNA of Bacillus amyloliquefaciens LX-12 is used as a template, and PCR amplification is carried outnanRUpstream homology arms of genes andnanRa downstream homology arm of a gene;
(2) by overlap extension PCRnanRUpstream homology arms of genes andnanRthe downstream homology arms of the genes are connected together to form a target gene segment;
(3) by usingSacI andXbai, carrying out double enzyme digestion on a target gene fragment by using restriction endonuclease to obtain an enzyme digestion gene fragment;
(4) preparation of plasmid T2(2) -ori and useSacI andXbacarrying out double enzyme digestion on plasmid T2(2) -ori by using I restriction enzyme to obtain a linear plasmid fragment;
(5) connecting the enzyme-digested gene fragment obtained in the step (3) with the linear plasmid fragment obtained in the step (4) by using DNA ligase to obtain a knockout plasmid T2(2) -deltananR;
(6) The knockout plasmid T2(2) - Δ was ligatednanRTransferring the bacillus amyloliquefaciens into the bacillus amyloliquefaciens LX-12, and screening by taking kanamycin as a screening marker to obtain a positive transformant;
(7) carrying out colony PCR detection on the positive transformant after several times of transfer culture to obtainnanRUpstream homology arms of genes ornanRThe downstream homology arm of the gene and the genome DNA of the bacillus amyloliquefaciens LX-12 generate a positive single-exchange binder strain with single exchange;
(8) selectingnanRPositive single crossover binder strains with upstream homology arms of the gene that produce a single crossover with the genomic DNA of Bacillus amyloliquefaciens LX-12 andnanRthe downstream homologous arm of the gene and the positive single-exchange conjugator strain which generates single exchange with the genome DNA of the bacillus amyloliquefaciens LX-12 are mixed and inoculated in a culture medium without kanamycin for a plurality of times of transfer culture, and the strain is screened by a PCR method to obtain the strain with knockoutnanRGenetically Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)LX-12ΔnanR。
5. The use of claim 1, wherein when 1-deoxynojirimycin is produced by fermentation of a strain with knock-out of the nanR gene of bacillus amyloliquefaciens in the application process, the formula of a fermentation medium is as follows:
60-100g/L of soybean meal; 50-80g/L corn starch; 0.5-1.0g/L KH2PO4;0.3-0.6g/L MgSO4·7H2O;0.1-0.3 g/LFeSO4·7H2O;0.01-0.05 g/L MnSO4·H2O and the balance of water.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911123113.XA CN110747156B (en) | 2019-11-16 | 2019-11-16 | Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911123113.XA CN110747156B (en) | 2019-11-16 | 2019-11-16 | Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110747156A true CN110747156A (en) | 2020-02-04 |
CN110747156B CN110747156B (en) | 2021-03-30 |
Family
ID=69283377
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201911123113.XA Active CN110747156B (en) | 2019-11-16 | 2019-11-16 | Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110747156B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111560390A (en) * | 2020-05-11 | 2020-08-21 | 武汉骏安生物科技有限公司 | Application of 2-deoxy-3-deoxyphosphogluconate aldolase in controlling yield of 1-deoxynojirimycin |
CN113637605A (en) * | 2021-08-09 | 2021-11-12 | 浙江珲达生物科技有限公司 | Bacillus amyloliquefaciens and application thereof in preparation of 1-deoxynojirimycin |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103068968A (en) * | 2010-08-12 | 2013-04-24 | 三井化学株式会社 | Isopropyl alcohol-producing bacterium having improved productivity by gntr destruction |
CN105192592A (en) * | 2015-08-06 | 2015-12-30 | 武汉骏安生物科技有限公司 | Laba beans with function of reducing blood glucose and processing method thereof |
-
2019
- 2019-11-16 CN CN201911123113.XA patent/CN110747156B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103068968A (en) * | 2010-08-12 | 2013-04-24 | 三井化学株式会社 | Isopropyl alcohol-producing bacterium having improved productivity by gntr destruction |
CN105192592A (en) * | 2015-08-06 | 2015-12-30 | 武汉骏安生物科技有限公司 | Laba beans with function of reducing blood glucose and processing method thereof |
Non-Patent Citations (1)
Title |
---|
GENBANK: "GntR family transcriptional regulator [Bacillus amyloliquefaciens]", 《AMP32559.1》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111560390A (en) * | 2020-05-11 | 2020-08-21 | 武汉骏安生物科技有限公司 | Application of 2-deoxy-3-deoxyphosphogluconate aldolase in controlling yield of 1-deoxynojirimycin |
CN113637605A (en) * | 2021-08-09 | 2021-11-12 | 浙江珲达生物科技有限公司 | Bacillus amyloliquefaciens and application thereof in preparation of 1-deoxynojirimycin |
Also Published As
Publication number | Publication date |
---|---|
CN110747156B (en) | 2021-03-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109913488B (en) | Method for increasing yield of bacillus iturin | |
CN110747156B (en) | Application of knock-out bacillus amyloliquefaciens nanR gene in improvement of yield of 1-deoxynojirimycin | |
WO2021018170A1 (en) | Preparation of transformed microorganism for producing pyridine carboxamide with low by-product and use thereof | |
CN105647822B (en) | Recombinant mortierella alpina for overexpression of omega-3 desaturase from phytophthora parasitica as well as construction method and application thereof | |
CN107603980A (en) | A kind of Kiwi berry Gene A cPDS based on PTG Cas9 edits carrier and its construction method and application | |
CN108611308B (en) | Preparation method and application of bacillus licheniformis for high-yield poly-gamma-glutamic acid | |
CN109385391B (en) | Strain and construction method thereof, and application of strain in fermentation production of high-temperature-resistant xanthan gum | |
CN108277191B (en) | Application of bacillus licheniformis DW2 delta ccpN in bacitracin production | |
CN110295189B (en) | Application of 4-aminobutyric acid aminotransferase in improving fermentation yield of iturin A | |
CN111154705B (en) | Bacillus thermoglucosidasius engineering bacterium and construction method and application thereof | |
CN108588108B (en) | Preparation method and application of bacillus for efficiently metabolizing glycerol | |
CN111560390A (en) | Application of 2-deoxy-3-deoxyphosphogluconate aldolase in controlling yield of 1-deoxynojirimycin | |
CN115960948A (en) | Application of ZmCP03 gene in corn | |
CN113136382B (en) | Method for synthesizing glyoxylic acid by utilizing corynebacterium glutamicum based on CRISPII regulation and control | |
CN115058374A (en) | Recombinant zymomonas mobilis for synthesizing acetoin by utilizing pyruvic acid and construction method and application thereof | |
CN109182240B (en) | Application of bacillus licheniformis DW2 delta phoP in bacitracin production | |
CN114907998A (en) | Saccharomyces cerevisiae, method for improving genome mutation rate of saccharomyces cerevisiae, method for domesticating saccharomyces cerevisiae and application of saccharomyces cerevisiae and method | |
CN110305917B (en) | Application of rex gene of bacillus in improving yield of poly-gamma-glutamic acid | |
CN108441508B (en) | Application of bacillus licheniformis DW2 DeltalrPC in bacitracin production | |
WO2016026954A1 (en) | Ars induced gene amplification | |
CN114540351B (en) | sRNA of targeted klebsiella pneumoniae MdtABC efflux pump and application thereof in preparation of tetracycline antibiotic resistant strain | |
CN111073821A (en) | Construction method of monascus ruber strain capable of producing lovastatin with high yield and producing no citrinin | |
CN117660279B (en) | Method for improving thaxtomin A yield through streptomyces scab SCAB _75421 gene | |
CN103525854A (en) | Construction method for high-gene-knockout-efficiency Aspergillus chevalieri var. intermedius mutant engineering bacterial strain | |
CN118291405A (en) | Camptothecine 10-hydroxylase and preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |