CN110743003A

CN110743003A - anti-HPV type vaginal temperature-sensitive gel, preparation method and application thereof

Info

Publication number: CN110743003A
Application number: CN201911276604.8A
Authority: CN
Inventors: 刘志鹏; 徐俊
Original assignee: Individual
Current assignee: Individual
Priority date: 2019-12-12
Filing date: 2019-12-12
Publication date: 2020-02-04

Abstract

The invention provides an anti-HPV type vaginal temperature-sensitive gel, a preparation method and application thereof. The temperature-sensitive gel comprises poloxamer, chitosan, chlorhexidine gluconate, giant salamander oligosaccharide peptide, recombinant human interferon and cell growth factors in a specific ratio, and on the basis, effective components such as antiviral drugs, antibacterial drugs, antifungal drugs, mycoplasma resistant drugs and the like can be further added; the temperature-sensitive gel is a sustained-release preparation, the pH value of the temperature-sensitive gel accords with the vaginal environment, the temperature-sensitive gel is in a liquid state at the temperature of lower than 28 ℃, the temperature-sensitive gel can permeate into deep folds of uterus and vagina to kill pathogens, the gel is formed after contacting with body temperature for 3-5 minutes, the gel is covered on the affected part and is not easy to overflow, and the action time and the action concentration of a medicament and a medicament receiving part are ensured to the maximum extent. Moreover, the gel of the invention can prevent the synthesis of E6 and E7 proteins of the HPV virus and inhibit the proliferation of the HPV virus; meanwhile, the bactericidal composition has strong bactericidal effect on gram-positive bacteria, gram-negative bacteria and fungi.

Description

anti-HPV type vaginal temperature-sensitive gel, preparation method and application thereof

Technical Field

The invention relates to the technical field of gynecological external medicines, in particular to an anti-HPV type vaginal temperature-sensitive gel, and a preparation method and application thereof.

Background

The vagina of a woman is naturally warm and wet, has more secretion and is easy to breed microorganisms, so that the nursing of the vagina is an important means for ensuring the health of the woman. Among vaginal care products, lotions, suppositories, traditional gels are the most widely used dosage forms; wherein, the lotion is a liquid preparation, although the lotion can wash vagina, the lotion is easy to overflow out of the body, which causes too short local action time and poor local nursing and sterilizing effects; moreover, the genital tract is cleaned by a large amount of lotion, which can destroy the natural protection mechanism of the vagina and the homeostasis in the vagina, and is easy to generate negative effects. The suppository has good local retention characteristics, but the effective part of local treatment is limited to 2-4cm of the vaginal orifice, and the vagina is 10-12cm long; the suppository cannot cover the whole reproduction, so that the nursing effect is poor, the inflammation is not easy to treat, and the suppository is a source of repeated attacks of the inflammation of a plurality of women.

The gel preparation overcomes the problems to a certain extent, can be delivered to 8cm in the vagina by virtue of an administration device, and has good adhesiveness. However, the drug is not uniformly dispersed in contact with the tissues of a patient when the drug is administered in the form of solid gel, and the current gel has small gel strength, poor biological adhesion and insufficient local action time, so that the curative effect is greatly influenced.

HPV (Human papilloma virus) is currently the only virus worldwide that has been shown to be directly associated with cancer (recurrent infection with HPV can induce the development and progression of cervical cancer in women). According to epidemiological statistics, almost all cervical cancer cases are caused by HPV infection. At present, the HPV infection rate in China is very high, the one-time sexual infection rate of 40-year-old women reaches 91 percent, and the high-risk type infection rate reaches 40 percent. While most HPV infections are cleared by the body's own immune system, in some cases, HPV infection may become persistent. Thus, all women are at risk of conversion of HPV infection to persistent infection, as well as the risk of pre-cancerous lesions developing invasive cervical cancer. Therefore, the prevention and control of HPV virus has important significance on female physiological health; however, in the prior art, prevention and treatment of HPV virus are mainly realized by vaccines or interferon, no external active prevention means exists, and the commonly used vaginal external medicine has no HPV prevention and treatment effect.

Disclosure of Invention

The invention aims to provide an anti-HPV type vaginal temperature-sensitive gel, a preparation method and application thereof aiming at overcoming the technical defects in the prior art, so as to solve the technical problem that the conventional vaginal gel in the prior art does not have an anti-HPV effect.

The invention also aims to solve the technical problem that the treatment effect of the conventional vaginal gel on female vaginitis needs to be improved.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

the vaginal temperature-sensitive gel for resisting HPV comprises the following components in parts by weight: 10-30 parts of poloxamer, 0.05-1 part of chitosan, 0.1-1 part of chlorhexidine gluconate and 1-5 parts of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 100-1000 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 1-100 mug/mL cell growth factors.

Preferably, the anti-HPV type vaginal temperature-sensitive gel comprises the following components in parts by weight: 15-25 parts of poloxamer, 0.5-1 part of chitosan, 0.1-0.5 part of chlorhexidine gluconate and 1.4-4.5 parts of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 100-7000 million IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 1-70 mu g/mL cell growth factors. Thereby obtaining the temperature-sensitive gel with higher adhesiveness.

Preferably, the poloxamer is selected from one or several of the following components: poloxamer 407, poloxamer 108, poloxamer 188, poloxamer 338.

Preferably, the temperature-sensitive gel further comprises one or more of the following components: antiviral drugs, antibacterial drugs, antifungal drugs, anti mycoplasma drugs.

Preferably, the antiviral drug is selected from one or several of the following components: giant salamander oligosaccharide peptide, recombinant human interferon, cell growth factor and gallate.

Preferably, the antibacterial drug is selected from one of the following components: compound povidone iodine liniment, compound chlorhexidine gargle, compound neomycin, potassium permanganate, benzoyl peroxide, compound chlorhexidine, erythromycin, metronidazole chlorhexidine, a methyl violet solution, clindamycin metronidazole, lidocaine chlorhexidine, crotamiton, ftibamzone, metronidazole glucose, neomycin fluocinolone acetonide, ciprofloxacin hydrochloride, and lincomycin hydrochloride.

Preferably, the antifungal drug is selected from one of the following components: undecylenic acid, acetic acid, salicylic acid, lactic acid, griseofulvin, nystatin, candicidin, econazole, miconazole, bifonazole, clotrimazole, ketoconazole, amphotericin B, flucytosine, mepacrycin, globithromycin, fluconazole, itraconazole.

Preferably, the antimycotic drug is selected from one of the following components: nystatin, fluconazole, amphotericin B, miconazole, ketoconazole.

Preferably, the anti-mycoplasma drug is selected from one of the following ingredients: tetracycline, doxycycline, azithromycin, methacycline, minocycline, josamycin, zedoary turmeric oil.

Preferably, the pH value of the temperature-sensitive gel is 4.0-4.5; the temperature of the temperature-sensitive gel is 28 ℃.

On the basis of the technical scheme, the invention further provides a preparation method of the anti-HPV type vaginal thermosensitive gel, which comprises the following steps:

1) adding water into poloxamer and chitosan according to the formula amount, uniformly stirring, standing for swelling, and then adjusting the pH value to 4.0-4.5 to obtain blank gel;

2) mixing the blank gel obtained in the step 1) with other components according to the formula amount, and uniformly stirring to obtain the anti-HPV type vaginal temperature-sensitive gel.

On the basis of the technical scheme, the invention further provides application of the HPV-resistant vaginal temperature-sensitive gel in preparation of vaginal HPV infection treatment medicines or vaginal repair medicines.

In addition, the anti-HPV type vaginal temperature-sensitive gel can also be used for treating vaginal diseases and other vaginal inflammations caused by HPV infection, including mycotic vaginitis, bacterial vaginitis, candidal vaginitis, senile vaginitis, trichomonas vaginitis, mycoplasma vaginitis and juvenile vaginitis.

Preferably, the chitosan is carboxymethyl chitosan.

The invention provides an anti-HPV type vaginal temperature-sensitive gel, a preparation method and application thereof. The technical scheme provides a temperature-sensitive blank gel which can carry out reversible sol-gel conversion along with temperature change as a matrix, and further functional components are added into the matrix. The temperature-sensitive gel comprises poloxamer, chitosan, chlorhexidine gluconate, giant salamander oligosaccharide peptide, recombinant human interferon and cell growth factors in a specific ratio, and on the basis, effective components such as antiviral drugs, antibacterial drugs, antifungal drugs, mycoplasma resistant drugs and the like can be further added; the temperature-sensitive gel is a sustained-release preparation, the pH value of the temperature-sensitive gel accords with the vaginal environment, the temperature-sensitive gel is in a liquid state at the temperature of lower than 28 ℃, the temperature-sensitive gel can permeate into deep folds of uterus and vagina to kill pathogens, the gel is formed after contacting with body temperature for 3-5 minutes, the gel is covered on the affected part and is not easy to overflow, and the action time and the action concentration of a medicament and a medicament receiving part are ensured to the maximum extent. Moreover, the gel of the invention can prevent the synthesis of E6 and E7 proteins of the HPV virus and inhibit the proliferation of the HPV virus; meanwhile, the vaginal suppository has a strong bactericidal effect on gram-positive bacteria, gram-negative bacteria and fungi, and can overcome the defects of short action time, incapability of radical treatment, easiness in relapse and the like of common vaginal medicaments at present.

The invention has stronger killing effect on HPV virus, gram-positive bacteria, gram-negative bacteria and fungi; and the use is convenient, and the effect is good. Meanwhile, the temperature-sensitive gel has good prevention and treatment effects on mycotic vaginitis, bacterial vaginitis, candida vaginitis, senile vaginitis, trichomonas vaginitis, mycoplasma vaginitis and juvenile vaginitis.

The invention can safely and effectively treat vaginal HPV infection and various bacterial vaginal diseases. The temperature-sensitive characteristic of liquid at low temperature and gel at high temperature enables the medicine to be uniformly covered on the surface of the mucosa, and the characteristic successfully solves a plurality of defects of the conventional gel in the prior art. The vaginal HPV infection treatment and vaginal care solution provided by the invention is a highly compliant and effective choice for patients.

Compared with the prior art, the technical effects of the invention are also reflected in the following aspects in a centralized way: when the temperature is lower than a certain gelling temperature, the preparation is in a liquid form, can permeate into any deep folds of the vagina and the uterus, is converted into a solid state after contacting with the body temperature for 3-5 minutes, can form a membrane with certain strength on the surface of a mucosa, greatly enhances the coverage protection and the lubricity of the vagina mucosa, and greatly improves the antibacterial capability. The problem that common gel is not uniformly dispersed at the affected part is successfully solved, the problem that the suppository cannot reach the deep part of the vagina is also avoided, the medicine concentration is maintained within a certain time, and the mucous membrane is mechanically protected. It is convenient and sanitary to use, does not pollute clothes, and has high patient compliance.

Drawings

FIG. 1 is a graph showing the amount of residual gel in the vagina of an experimental animal with time, according to an embodiment of the present invention.

FIG. 2 is a graph showing the result of the relative expression rate of mRNA of HPV in different experimental groups in accordance with the embodiment of the present invention.

Detailed Description

Hereinafter, specific embodiments of the present invention will be described in detail. Well-known structures or functions may not be described in detail in the following embodiments in order to avoid unnecessarily obscuring the details. Approximating language, as used herein in the following examples, may be applied to identify quantitative representations that could permissibly vary in number without resulting in a change in the basic function. Unless defined otherwise, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Example 1

The vaginal temperature-sensitive gel for resisting HPV comprises the following components in parts by weight: 10 parts of poloxamer, 0.05 part of chitosan, 0.1 part of chlorhexidine gluconate and 1 part of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 100 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 1 mug/mL cell growth factor.

Example 2

The vaginal temperature-sensitive gel for resisting HPV comprises the following components in parts by weight: 30 parts of poloxamer, 1 part of chitosan, 1 part of chlorhexidine gluconate and 5 parts of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 1000 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 100 mu g/mL cell growth factors.

Example 3

The vaginal temperature-sensitive gel for resisting HPV comprises the following components in percentage by weight: 10 to 30 percent of poloxamer, 0.05 to 1 percent of chitosan, 0.1 to 1 percent of chlorhexidine gluconate and 1 to 5 percent of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 100-1000 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 1-100 mug/mL cell growth factors.

Example 4

The vaginal temperature-sensitive gel for resisting HPV comprises the following components in percentage by weight: 20% of poloxamer, 0.08% of chitosan, 0.5% of chlorhexidine gluconate and 3% of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 550 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 50 mug/mL cell growth factor. Meanwhile, the temperature-sensitive gel also comprises antiviral drugs, antibacterial drugs, antifungal drugs and anti-mycoplasma drugs.

Example 5 (testing the phase transition temperature of the inventive gel)

Pouring the temperature-sensitive gel into a penicillin bottle, and heating in a water bath. Pouring penicillin bottles, and taking gel non-flowing as a phase transition temperature.

The results show that the gel of the present invention changed in properties from liquid to gel at 28 ℃ and the gel was highly adhesive.

Example 6

Adding a fluorescent marker into the temperature-sensitive gel; adding a fluorescent marker into a certain brand of solid gel as a control group, injecting the gel into the vagina of the rabbit respectively for 1h, 3h, 6h, 12h, 16h, 20h and 24h, killing the rabbit, and taking the vagina to observe the detention time of the gel in the body of the rabbit. The results of the experiment are shown in FIG. 1.

The experimental result shows that the gel is basically emptied after the solid gel of a certain brand is administrated for 3 hours, but the temperature-sensitive gel matrix of the invention can be observed for 24 hours, so that the in-vivo retention time is longer than 24 hours, and the treatment target of once-a-day administration can be realized.

Example 7

SPF grade female rabbits were pretreated with hormone in 60 animals. 15 were not treated at all and served as control group; 45 HPV16 viruses are inoculated and divided into 3 groups, and an HPV16 infected vaginitis rabbit model is constructed. After inoculation, the rabbits were given a blank gel matrix in one group, a certain brand of gel in one group, and the gel of the invention in one group, once daily for 7 consecutive days, and after the last administration, the rabbits were sacrificed and dissected. The vaginal state was observed.

Observation shows that the vagina of the rabbit in the control group is normal and has no pathological changes; in the HPV16 infection group, rabbits using the blank gel group showed pimples in vagina and had rough and keratotic mucosal surfaces; the vagina of the rabbit using the gel experimental group of the invention is basically recovered to be normal; the vaginal symptoms of rabbits using a certain brand of gel were reduced, but not completely restored to normal. The results of the experiment are shown in table 1.

TABLE 1 statistical table of the cure rate after administration

Group of	Number of examples	Number of cure cases	Percent by weight%
				Gel set of the invention	15	13	87
Set of certain brands of gels	15	4	27
				Blank gel set	15	0	0

Example 8

RNA was extracted from the rabbit squamous epithelial cells obtained in example 7, and after reverse transcription, the relative expression level of HPV16mRNA was determined by qPCR technique. The results of the experiment are shown in FIG. 2.

The experimental result shows that the mRNA expression level of HPV is extremely low after the gel is used, which indicates that the HPV virus is well inhibited after the gel is used; after using a certain brand of gel, the expression level of HPV was somewhat reduced compared to the blank gel, but was not completely inhibited. This qPCR result was consistent with the vaginal observations in example 7.

In this experiment:

fluorescent marker: SyberGreen

Control genes: rplp0

Primer 1: CACTGGTCTAGGACCCGAGAAG

Primer 2: GGTGCCTCTGGAGATTTTCG

HPV 16E 6 gene:

primer 1: ACCAAAAGAGAACTGCAA

Primer 2: CAGCTGGGTTTCTCTACGTG

The embodiments of the present invention have been described in detail, but the description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention. Any modification, equivalent replacement, and improvement made within the scope of the application of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Liu Shi Peng

<120> HPV-resistant vaginal temperature-sensitive gel, preparation method and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

cactggtcta ggacccgaga ag 22

<210>2

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

ggtgcctctg gagattttcg 20

<210>3

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

accaaaagag aactgcaa 18

<210>4

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

cagctgggtt tctctacgtg 20

Claims

1. The vaginal temperature-sensitive gel for resisting HPV type is characterized by comprising the following components in parts by weight: 10-30 parts of poloxamer, 0.05-1 part of chitosan, 0.1-1 part of chlorhexidine gluconate and 1-5 parts of giant salamander oligosaccharide peptide; the temperature-sensitive gel for resisting HPV type vagina contains 100-1000 ten thousand IU recombinant human interferon; the temperature-sensitive gel for resisting HPV type vagina contains 1-100 mug/mL cell growth factors.

2. The vaginal temperature-sensitive gel for anti-HPV types according to claim 1, characterized in that the poloxamer is selected from one or several of the following components: poloxamer 407, poloxamer 108, poloxamer 188, poloxamer 338.

3. The vaginal temperature-sensitive gel for anti-HPV types according to claim 1, characterized in that it further comprises one or several of the following components: antiviral drugs, antibacterial drugs, antifungal drugs, anti mycoplasma drugs.

4. The vaginal temperature-sensitive gel for anti-HPV types according to claim 3, characterised in that the antiviral drug is selected from one or several of the following components: giant salamander oligosaccharide peptide, recombinant human interferon, cell growth factor and gallate.

5. The vaginal temperature-sensitive gel for anti-HPV types according to claim 3, characterized in that the antibacterial drug is selected from one of the following components: compound povidone iodine liniment, compound chlorhexidine gargle, compound neomycin, potassium permanganate, benzoyl peroxide, compound chlorhexidine, erythromycin, metronidazole chlorhexidine, a methyl violet solution, clindamycin metronidazole, lidocaine chlorhexidine, crotamiton, ftibamzone, metronidazole glucose, neomycin fluocinolone acetonide, ciprofloxacin hydrochloride, and lincomycin hydrochloride.

6. The vaginal temperature-sensitive gel for anti-HPV types according to claim 3, characterized in that the antifungal drug is selected from one of the following components: undecylenic acid, acetic acid, salicylic acid, lactic acid, griseofulvin, nystatin, candicidin, econazole, miconazole, bifonazole, clotrimazole, ketoconazole, amphotericin B, flucytosine, mepacrycin, globithromycin, fluconazole, itraconazole.

7. The vaginal temperature-sensitive gel for anti-HPV types according to claim 3, characterized in that the antimycotic drug is selected from one of the following components: nystatin, fluconazole, amphotericin B, miconazole, ketoconazole.

8. The vaginal temperature-sensitive gel for anti-HPV types according to claim 3, characterized in that the anti-mycoplasma drug is selected from one of the following components: tetracycline, doxycycline, azithromycin, methacycline, minocycline, josamycin, zedoary turmeric oil.

9. The method for preparing the anti-HPV type vaginal temperature-sensitive gel according to any one of claims 1-8, characterized by comprising the following steps:

10. The use of the anti-HPV vaginal temperature-sensitive gel according to any one of claims 1-8 for the preparation of a vaginal HPV infection treatment or vaginal repair drug.