CN110724693B

CN110724693B - Method for improving dendrocalamus latiflorus plant type by GRG1 gene and application

Info

Publication number: CN110724693B
Application number: CN201911136315.8A
Authority: CN
Inventors: 朱强; 陈刚; 叶善汶
Original assignee: Fujian Agriculture and Forestry University
Current assignee: Fujian Agriculture and Forestry University
Priority date: 2019-11-19
Filing date: 2019-11-19
Publication date: 2020-11-06
Anticipated expiration: 2039-11-19
Also published as: CN110724693A

Abstract

The invention discloses a method for improving the plant type of dendrocalamus latiflorus by using GRG1 gene and application thereof, belonging to the technical field of plant gene editing and dendrocalamus latiflorus breeding. The invention utilizes CRISPR/Cas9 gene editing technology to directionally edit the conserved functional domain of the GRG1 gene in dendrocalamus latiflorus, and Cas9 protein directionally knocks out the genome under the guide of sgRNA of a targeted GRG1 gene. Taking callus of dendrocalamus latiflorus as a receptor material for genetic transformation: and (3) introducing the gene editing tool box into the callus cells by an agrobacterium-mediated method, and screening and identifying positive callus. And identifying genetically transformed positive plants of the transgenic dendrocalamus latiflorus plants obtained through the callus differentiation process, determining the editing condition of the target genes, and finally obtaining the dendrocalamus latiflorus strain with GRG1 gene function deletion and accelerated growth.

Description

Method for improving dendrocalamus latiflorus plant type by GRG1 gene and application

Technical Field

The invention belongs to the technical field of plant gene editing and dendrocalamus latiflorus breeding, and particularly relates to a method for improving the plant type of dendrocalamus latiflorus by using a GRG1 gene and application of the method.

Background

The dendrocalamus latiflorus is a large sympodial bamboo, has hexaploid species (2n =72, AABBCC) of three subgenomic groups, and is widely distributed in each province of China. It can produce bamboo shoots with rich nutrients, 20m in height and 25-30 cm in diameter. The product is widely applied to the fields of building, artware, papermaking, water and soil conservation and the like. The bamboo shoots are good bamboo shoots and bamboo materials, are fresh, tender, sweet and delicious, have long bamboo shoot period and tall, thick and strong bamboo poles, can be used for tying bamboo rafts, can be used as building materials of water pipes and the like, are high-quality papermaking raw materials, can be used for weaving living goods, and have high ornamental value and economic value. The industrial development of the dendrocalamus latiflorus, which is an important plant material, has been difficult to meet the increasing economic demand. The breeding work of the dendrocalamus latiflorus faces huge limitation, although the dendrocalamus latiflorus is a sympodial bamboo and has extremely strong asexual reproduction capability, the breeding aspect can only start from the aspects of introduction and selective breeding. Up to now, the most successful breeding method for crop breeding is crossbreeding. For the dendrocalamus latiflorus, the feasibility of cross breeding is not high, mainly because of the special biological characteristics of bamboo plants, namely irregular flowering and death of the plants after flowering, the conventional breeding method has great difficulty in dendrocalamus latiflorus breeding, and the genetic improvement process of the plants is also severely limited.

During the growth and development of plants, many factors play a role. Gibberellins (GAs) play a great role in this process, and can promote cell division, elongation, break seed dormancy, and the like. Gibberellins act in plants, are synthesized in cells, and transmit 'growth' signals to cells through signal transduction and transmission, so that the gene expression related to the gibberellins in the cells is changed. Finally, the growth promoting effect of gibberellin on plants is achieved by affecting the expression of genes, thereby achieving the regulating effect.

The CRISPR/Cas9 system is a great biotechnological breakthrough in the second 21 st century, and can specifically target a protein with a DNA endonuclease function to a target DNA Double strand under the guiding action of single-stranded RNA, so as to cause DNA Double Strand Break (DSB), and cause target DNA Double strand mutation, deletion and replacement in the presence of homologous repair and non-homologous repair mechanisms in cells. The precise gene 'modification' effect makes it an important means for researching gene function.

The dendrocalamus latiflorus and the moso bamboos belong to bamboo plants and have high species homology. Under the treatment of exogenous gibberellin, the young bamboo plants show the growth-accelerated state of growth such as growth acceleration and internode elongation. Meanwhile, on the molecular level, the expression levels of some genes in the moso bamboo bodies are greatly changed along with the treatment. These confirm that these altered genes are involved in gibberellin control of plant growth in Phyllostachys pubescens. The invention takes the exogenous gibberellin response Gene GRG1 (GAResponsive Gene 1) of the moso bamboo as a template design primer, and obtains the exogenous gibberellin response Gene GRG1 in the dendrocalamus latiflorus by homologous cloning. Through determining the GRG1 gene sequence in the dendrocalamus latiflorus, the conserved functional domain of the GRG1 gene is selectively targeted, and the expression of the GRG1 gene in the dendrocalamus latiflorus is changed, so that the growth and development of plants are changed.

Disclosure of Invention

The invention aims to provide a method for reconstructing a plant type of dendrocalamus latiflorus by using a GRG1 gene and application thereof, aiming at the defects of the conventional dendrocalamus latiflorus breeding. The method utilizes CRISPR/Cas9 technology capable of accurately and directionally editing genes to perform targeted editing on GRG1 genes in the dendrocalamus latiflorus and change the expression of GRG1 genes in the dendrocalamus latiflorus to lose the functions of the GRG1 genes, so that the dendrocalamus latiflorus plant type with accelerated growth is obtained. The method realizes the fixed-point editing of the dendrocalamus latiflorus gene by a genetic engineering means so as to obtain an improved dendrocalamus latiflorus plant.

In order to achieve the purpose, the invention adopts the following technical scheme:

a dendrocalamus latiflorus GRG1 gene has 3 homologous copies of GRG1-A, GRG1-B, GRG1-C, and the nucleotide sequences are respectively shown as SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5.

The method for improving the plant type of the dendrocalamus latiflorus by the dendrocalamus latiflorus gene GRG1 comprises the following steps:

(1) GRG1 gene cloning and target site design in dendrocalamus latiflorus;

(2) constructing an sgRNA expression cassette, connecting the sgRNA expression cassette with a PUBI-H vector, and constructing a dendrocalamus latiflorus GRG1 gene editing vector;

(3) transferring the constructed dendrocalamus latiflorus GRG1 gene editing vector into agrobacterium tumefaciens EHA105, and infecting the dendrocalamus latiflorus callus with agrobacterium tumefaciens EHA105 carrying a GRG1 gene editing vector;

(4) carrying out callus screening, proliferation, differentiation and rooting culture on the dendrocalamus latiflorus;

(5) PCR identification and screening positive dendrocalamus latiflorus mutant plants;

(6) and analyzing the editing efficiency and the editing type of the editing gene of the positive dendrocalamus latiflorus mutant plant.

The GRG1 gene cloning and target site design in the dendrocalamus latiflorus in the step (1) are as follows: primers GRG1-F and GRG1-R cloned from GRG1 gene in Mao bamboo are designed according to the GRG1 gene of the moso bamboo, and the primer sequences are shown as SEQ ID No. 1 and SEQ ID No. 2; extracting dendrocalamus latiflorus genome DAN and cDAN, and performing PCR amplification on GRG1 gene in dendrocalamus latiflorus by taking the dendrocalamus latiflorus genome DAN and cDAN as templates and GRG1-F and GRG1-R as primers; identifying that 3 copies of GRG1 gene in the obtained dendrocalamus latiflorus exist respectively in GRG1-A, GRG1-B, GRG1-C through cloning and homologous cloning strategies, and Single Nucleotide Polymorphisms (SNPs) generally exist in each copy; designing a target site at a consistent conserved sequence of the cloned GRG1 gene, wherein the target site target sequence is as follows: GCGTGTGCCACCCCAGCGTGAGG, wherein AGG is a PAM site.

The sgRNA expression cassette in step (2) is specifically constructed as follows: firstly, designing a primer containing target with a special base joint, annealing and complementing the target primer to form a target joint, connecting the target joint to an intermediate vector pYLsgRNA-OsU6c by means of enzyme digestion and connection, and assembling the target joint and the gRNA together to construct an sgRNA expression cassette.

Further, the primer containing the target with the special base adaptor is as follows: target F-c: 5'-tcaGCGTGTGCCACCCCAGCGTG-3', Target R-c: 5'-aaacCACGCTGGGGTGGCACACG-3' are provided.

The method for improving the dendrocalamus latiflorus plant type by the GRGR1 gene is applied to breeding of a transgenic dendrocalamus latiflorus plant with accelerated growth.

The invention has the advantages that: the method utilizes CRISPR/Cas9 gene editing technology to edit the dendrocalamus latiflorus GRG1 gene, and successfully modifies the transgenic dendrocalamus latiflorus plant through phenotype identification and DNA level identification of the transgenic plant to obtain the transgenic dendrocalamus latiflorus plant with accelerated growth. The novel dendrocalamus latiflorus material greatly promotes the development of dendrocalamus latiflorus breeding work and has high application value. Meanwhile, a new idea is opened for bamboo breeding work through a means of genetic engineering, the CRISPR/Cas9 technology is successfully applied to dendrocalamus latiflorus, and the effect of accurate directional editing is achieved, so that the functional research on genes is more convenient, and the breeding efficiency is greatly improved.

Drawings

FIG. 1a shows the construction of a PUBI-H vector structure for the dendrocalamus latiflorus GRG1 gene editing vector.

FIG. 1b shows the structure of the intermediate vector pYLsgRNA-OsU6c used for the construction of the sgRNA expression cassette.

FIG. 2 is a diagram of the structure of a vector edited by the GRG1 gene of dendrocalamus latiflorus.

FIG. 3 is the nucleic acid electrophoresis of transgenic dendrocalamus latiflorus. M: DNA molecular weight standard, T0: transgenic bamboo of generation T0; wt: wild type bamboo, 1-28: 28 independent transgenic lines, +: plasmid containing the target fragment as a positive control for the template, -: negative control with water as template

FIG. 4 is a sequence comparison result diagram of the sequencing identification sequence of the transgenic dendrocalamus latiflorus editing region. WT, sequencing of wild bamboo GRG1 region, T0-21, representing selected mutants, A, B, C respectively representing 3 homologous copies of GRG1 gene GRG1-A, GRG1-B, GRG1-C, adding background color mark PAM in the figure, and thickening mark as editing condition of homozygous mutant.

FIG. 5 is a phenotypic identification graph of homozygous mutant dendrocalamus latiflorus. A: after homozygous mutation of GRG1, the plant shows a high phenotype, wherein a is a wild type, and b is a T0-21 mutant; b, comparing the lengths of the wild type and the mutant stem segments, wherein a is the wild type, and B is the homozygous mutant; c, comparing the plant height with the stem length, wherein the upper graph is the plant height statistics, the lower graph is the stem length comparison, WT is wild type, T0-21: and (3) mutants.

Detailed Description

In order to make the present invention more comprehensible, the technical solutions of the present invention are further described below with reference to specific embodiments, but the following examples are only examples of the present invention and do not represent the scope of the present invention defined by the claims.

Example 1 cloning of GRG1 Gene in dendrocalamus latiflorus and target site design

Extracting genomic DNA of the dendrocalamus latiflorus leaves by using a plant genomic DNA extraction kit (# DP305) of Tiangen corporation; total RNA from the dendrocalamus latiflorus leaves was extracted using a plant RNA extraction kit (# R6827) from OMEGA, and the extracted RNA was inverted to dendrocalamus latiflorus cDNA using an RNA inversion kit (#6110) from TAKARA. The above mentioned experimental procedures are all described in the kit.

Previous studies showed (Zhang, h. Wang, q. Zhu, y. Gao, h. Wang, l. Zhao, y.wang, f. Xi, w. Wang, y. Yang, c. Lin and l. Gu. 2018. transcriptomechanical characterization of motion bamboo (phylostachys edulis) seeds in responsenseto exogenous gibberellin applications.BMC Plant Biol18: 125.) GRG1 gene in Phyllostachys pubescens (GA-responsive gene 1,PH01004823G0070) The gene is strongly induced by gibberellin, and is suggested to be possibly involved in the growth regulation of bamboo. The primers GRG1-F and GRG1-R corresponding to the dendrocalamus latiflorus GRG1 gene are designed through the comparison of GRG1 gene homologous sequences, the nucleotide sequences are respectively SEQ ID No. 1 and SEQ ID No. 2, and in order to better edit the GRG1 gene, the designed primers directly aim at the position between the initiation codon and the termination codon of the GRG1 gene.

The nucleotide sequences of primers SEQ ID No. 1 and SEQ ID No. 2 corresponding to the dendrocalamus latiflorus GRG1 gene are shown as follows:

SEQ ID No. 1: forward primer GRG 1-F: 5'-ATGAAGCGCGAGTACCAAGACGCCGG-3', respectively;

SEQ ID No. 2: reverse primer GRG 1-R: 5'-TCACGCTGCGGCGTCGCGCCACGCCGAGG-3' are provided.

PCR amplification is carried out by taking the genomic DNA or cDNA of the dendrocalamus latiflorus as a template and GRG1-F/GRG 1-R.

The PCR reaction system is as follows:

the PCR reaction program is: 94 deg.C, 98 deg.C for 10s, 60 deg.C for 30s, 68 deg.C for 30s, 30cycles, 68 deg.C for 10min, and 4 deg.C

Note: KOD DNA Polymerase, 10 XKOD buffer, dNTP Mix, Mg + used in the reaction were purchased from Toyobo (Toyobo).

And detecting the PCR product obtained by amplification in 1.5% agarose gel electrophoresis, recovering and purifying the gel, and purchasing the purification kit in Tiangen. Through homologous cloning strategy identification and cloning, 3 copies of GRG1 gene in the dendrocalamus latiflorus are obtained finally, wherein the copies are GRG1-A, GRG1-B, GRG1-C, and the nucleotide sequences are SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5; single Nucleotide Polymorphisms (SNPs) are also prevalent in each copy.

The GRG1-A, GRG1-B, GRG1-C fragment amplified by taking DNA and cDNA as templates is subjected to TA cloning, 10 monoclonals are selected for each cloning to carry out sequencing, and the sequencing result is subjected to multiple sequence comparison to determine that the dendrocalamus latiflorus GRG1 gene has no intron. With reference to the multiple copy case of the GRG1 gene, a target was designed at a consistently conserved sequence in the GRG1 gene functional domain. The nucleotide sequence of the target is as follows: 5'-GCGTGTGCCACCCCAGCGTGAGG-3', wherein the AGG at the 3' end is a PAM site.

Example 2 construction of Gene editing vectors

The intermediate vector pYLCRISPR/Cas9Pubi-H (hereinafter abbreviated as PUBI-H) vector and sgRNA expression cassette construction pYLsgRNA-OsU6c was introduced by the project group of the university of south China university professor Liu flare light (FIG. 1). The vector construction procedure was carried out according to the procedure mentioned in the documents Ma X, Zhang Q, Zhu Q, et al (2015), A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in monomer and DicotPlants. Mol plant 2015 Aug; 8(8): 74-84 (Ma X et al 2015).

The specific process is as follows:

(1) target joint preparation

For sgRNA expression cassettes driven by different promoters, different primers containing special base linkers are designed, and the conditions of the primers are shown in the table

TABLE 1 primers containing adapters of specific bases

Complementary preparation of target adapters by reaction annealing:

the PCR reaction program is: storing at 95 deg.C for 5min, 25 deg.C for 20min, and 4 deg.C

The Target joint Target-a/b/c is obtained by the reaction preparation.

(2) Preparation of sgRNA expression cassette

Note that T4 DNA ligase and 10 Xligase Buffer were purchased from Transgene, BsaI from NEB

The PCR reaction program is: 5min at 37 ℃, 5min at 16 ℃ and 10-15cycles; storing at 4 ℃. The obtained PCR product is the sgRNA ligation product.

Amplifying the sgRNA expression cassette, first round PCR:

the following PCR reactions were carried out with the primer combination forward primer U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3' and reverse primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3':

PCR reaction procedure: 94 deg.C, 98 deg.C for 10s, 60 deg.C for 30s, 68 deg.C for 30s, 30cycles, 68 deg.C for 10min, and 4 deg.C

Second round PCR:

the following PCR reactions were carried out using the primer combinations forward primer Uctcg-B1 ': 5'-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3' and reverse primer gRCggt-BL: 5'-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3' as amplification primers:

And detecting the obtained PCR product by 1.5% agarose gel electrophoresis, carrying out gel recovery and purification to obtain an sgRNA expression fragment, wherein the purification kit is purchased from Tiangen.

(3) Connection of sgRNA expression cassette to PUBI-H vector

The following PCR reaction was performed to ligate the sgRNA expression fragment to the PUBI-H vector to obtain a ligation product.

The PCR reaction program is: 5min at 37 deg.C, 5min at 16 deg.C, 10-15cycles, and storing at 4 deg.C.

The above-mentioned ligation product was transformed into E.coli DH 5. alpha. competent cells by heat shock method (42 ℃), and the bacterial solution was spread on LB plate containing 50mg/L kanamycin and cultured for 12 hours. Picking single colony growing on the plate, sending to a sequencing company for verifying the vector sequence, obtaining a dendrocalamus latiflorus GRG1 gene editing vector (figure 2) by sequencing verification, and transferring the vector into EHA105 agrobacterium-infected cells for later use.

Example 3 genetic transformation of dendrocalamus latiflorus and mutant plant acquisition

(1) Conversion material

The material used for the genetic Transformation System of the dendrocalamus latiflorus is dendrocalamus latiflorus callus (Ye, S., C. Cai, H. Ren, W. Wang, M. Xiaoang, X. Tang, C. Zhu, T. Yin, L. Zhuang and Q. Zhu.2017. An efficient Plant Regeneration and Transformation System of Ma Bamboo (Dendrocalamus muliforus) Started from Bamboo Shoot expression, Front Plant Sci.8: 1298.);

(2) agrobacterium transformation

Collecting 100 callus grains of caulis Bambusae in good growth state, soaking in OD₆₀₀=0.6 EHA105 agrobacterium suspension carrying gene editing vector, sucking off excess bacteria liquid by sterile filter paper for 10-20 min, placing in co-culture medium, and culturing in dark at 26 ℃ for 3 d.

(3) Bacteria removal and resistance screening

The co-cultured callus was collected in a sterile conical flask, washed with sterile water 4-5 times, sterilized by soaking in 800mg/L carbenicillin solution, and gently shaken for 15 min. The callus surface solution residue was blotted dry with sterile filter paper and placed in selection medium for subculture every 10 days for about 30 days.

(4) Callus differentiation

Resistant calli screened on the screening medium were transferred to differentiation medium for differentiation, subcultured every 30 d. And (3) starting to grow seedlings by green emergence from the positive differentiation callus with resistance for 30-50 days, transferring the differentiated seedlings to a rooting culture medium, and transplanting the seedlings into nutrient soil after the rootstocks of the seedlings are completely developed to obtain transgenic dendrocalamus latiflorus adult plants.

The above-mentioned medium components:

co-culture medium: 3/4MS, 30g/L sucrose, 3g/L sorbitol, 0.25g/L PVP, 2 mg/L2.4-D, 4.2 g/Lphytogel.

Screening a culture medium: 3/4MS, 30g/L sucrose, 3g/L sorbitol, 0.25g/L PVP, 2 mg/L2.4-D, 4.2g/L phytogel, 200mg/L carbenicillin, 30 mg/L hygromycin

Differentiation medium: MS, 30g/L sucrose, 2mg/L BAP, 0.5mg/L NAA, 4.2g/L phytogel, 30 mg/L hygromycin

Rooting culture medium: 1/2MS, 1mg/L IAA, 8g/L agar.

Example 4 molecular detection of transgenic dendrocalamus latiflorus

The PUBI-H binary vector carries a HYG resistance gene and a Cas9 gene. And (3) extracting DNA (deoxyribonucleic acid) from the transplanted and survived transgenic dendrocalamus latiflorus plants differentiated after callus resistance screening by adopting a CTAB (cetyltrimethyl ammonium bromide) method, carrying out PCR (polymerase chain reaction) identification by using specific primers, and detecting amplified products by using 1.5% agarose gel electrophoresis.

An amplification primer:

note: the PCR amplification is adopted for identification, the reagent used is Takara Ex Taq (# RR 001) purchased from Takara, and the system used in the reaction and the PCR reaction program are shown in the product application instruction.

The positive identification results of the plants are shown in FIG. 3, and the results in FIG. 3 show that: and identifying the obtained 28 strain transgenic dendrocalamus latiflorus plant materials, and displaying that the Cas9 and Hyg genes on the vector are inserted into a dendrocalamus latiflorus genome, wherein the obtained materials are all positive transgenic dendrocalamus latiflorus.

Example 5 identification of editing status and phenotypic examination of Positive transgenic dendrocalamus latiflorus

The dendrocalamus latiflorus transgenic plant material that has been identified as positive in both Cas9 and Hyg amplification in example 4 was selected. Since there are 3 copies of the dendrocalamus latiflorus GRG1 gene, specific primers need to be designed for each copy in consideration of target editing on each copy. The sequences of the 3 primer pairs are shown in the table below.

An amplification primer:

the PCR product was amplified by Takara Ex Taq, detected by 1.5% agarose gel electrophoresis, and gel recovered and purified. The purified fragment was TA cloned, and the monoclonal was picked for sequencing. Screening to number T_0-21 (FIG. 4), which has growth characteristics significantly different from wild type dendrocalamus latiflorus (in the figure, a represents wild type, and b represents mutant), shows that the internode distance is elongated and the division length is longer (FIG. 5).

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian agriculture and forestry university

Method for improving plant type of dendrocalamus latiflorus by <120> GRG1 gene and application

<130>22

<160>22

<170>PatentIn version 3.3

<210>1

<211>26

<212>DNA

<213>SEQ ID No .1 GRG1-F

<400>1

atgaagcgcg agtaccaaga cgccgg 26

<210>2

<211>29

<212>DNA

<213>SEQ ID No .2 GRG1-R

<400>2

tcacgctgcg gcgtcgcgcc acgccgagg 29

<210>3

<211>1869

<212>DNA

<213>SEQ ID No .3 GRG1-A

<400>3

atgaagcgcg agtaccaaga cgccggcggg agcggcggcg atatgggccc atccaaggac 60

aagatgatgg cggcggcggg ggaggaggag gaggtggacg agctgctggc cgcgctcggc 120

tacaaggtgc ggtcctctga catggccgac gtggcgcaga agctggagca gctcgagatg 180

gccatgggga tgggcggcgt gggcgccggt gccgccgcgg acgacgcctt cgtgtcgcac 240

ctggcgacgg acaccgtgca ctacaacccc tccgacctct cctcctgggt cgagagcatg 300

ctctccgagc tcaacgcgcc cccgcctccg ctcccgcctc cgctaccgcc ggccctgcag 360

gctccgcggc tctcgtccac ctcgtccact gtcacgggcg gcgggagcgg cggatacttt 420

gatctcccgc ccgcagtcaa ctcgtcgagc agcacgtacg ctctgaggcc gatcccctcg 480

ccggttgtgg cgccggccga cccatccgcg gattccgcgc gggagcccaa gcggatgcgc 540

actggcggca gcagcacgtc gtcgtcgtcg tcctcctcct cctctctcgg tggcgggggt 600

ggctcctctg tggtggaggc tgctccgccg gcgaggcaag cgtccgcgtc ggctaacgcg 660

ccggcggtgc cggttgtggt ggtgaacacg caggaggccg ggatccggct ggtgcacgct 720

ctgctggcgt gcgcggaggc cgtgcagcag gagaacttga cggcggcgga ggcgctggtg 780

aagcagatcc ccgttctcgc cgcgtcccag ggcggcccca tgcgcaaggt tgccgcctac 840

ttcggcgagg cgctcgcccg ccgtgtctat cgcttccgcc cgacgcggga cagctccctc 900

ctcgatgccg ccttcgcgga cctcctccac tctcacttct acgagtcctg cccctacctc 960

aagttcgccc acttcaccgc gaaccaagcc atcctcgagg cgttcgctgg ctgccgccgc 1020

gtccacgtcg tcgacttcgg catcaagcag gggatgcagt ggcccgcgct tctccaggcc 1080

ctcgccctcc gtcctggcgg gcccccgtcg ttccgcctca ccggcgtcgg cccgccgcag 1140

ccggacgaga ccgacgcctt gcagcaggtg ggttggaagc ttgcccagtt tgctcacact 1200

atccgcgtcg atttccagta ccgcggcctc gtcgctgcta cgctcgccga cctggagccg 1260

ttcatgctgc agccggaggg cgaggcggac gcgaacgaag aacctgaggt gatcgccatc 1320

aactcagtgt tcgagctgca ccggctgctc gcgcagcccg gcgccctgga gaaagtcctg 1380

ggcacgttgc gcgctgtgcg gccaaggatc gtgaccgtgg tagagcagga ggccaaccac 1440

aactccggct cattcatgga ccggttcacg gagtctctgc actactactc caccatgttc 1500

gattctctcg agggcgccgg ctccggccaa tccgacatct cgccgggggc ggctgctgct 1560

gctggtggca cggaccaggt catgtccgag gtgtacctcg gccggcagat ctgcaacgtc 1620

gtggcgtgcg agggcgcgga gcgcacggag cgccacgaga cgctggggca gtggcgcaac 1680

cgtctcggcc gcgccgggtt cgagcccgtg aacctgggct ccaatgccta caagcaggcg 1740

agcacgctac tcgcgctctt cgccgggggc gatgggtaca gggtggagga aaaggacggg 1800

tgcctcacgc tggggtggca cacgcgcccg ctcatcgcca cctcggcatg gcgcgtcgcc 1860

gcagcgtga 1869

<210>4

<211>1869

<212>DNA

<213>SEQ ID No .4 GRG1-B

<400>4

atgaagcgcg agtaccaaga cgccggcggg agcggcggcg acatgggctt gtccaaggac 60

aagatgatgg cggcggcggc gggggaggag gaggaggtag acgagctgct ggccgcgctc 120

ggctacaagg tgcggtcctc cgacatggcc gacgtggcgc agaagctgga gcagctcgag 180

atggccatgg ggattggcgg cgtgggcgcc ggcgccggcg cggacgacgg cttcgtgtcg 240

cacctggcga cggacaccgt gcactataac ccctccgacg tctcctcctg ggttgagagc 300

atgctctccg agctcaacgc gcccccgcct ccgctcccgc cggccccgca ggctccgagg 360

ctcgcgtcca cctcgtccac tgtcacgggc ggcggcggcg gcgggcactt cgatgtcccg 420

cccgcagtcg actcgtcgag cagcacgtac gctctaaggc cgatcccctc gccggttgtg 480

gcgccggccg acccgtccgc ggactcagcg cgggagccaa agcggatgcg cactggcggc 540

ggcagcacgt cgtcgtcgtc ctcctcgtcc tcctctctcg gcggcggggg cgctaggagc 600

tctgtggtgg aggctgctcc gccggcgacg caagcgttcg cggcggccaa cgcgcccgcg 660

gtgccggttg tggtggtgga cacacaggag aacgggatcc ggctggtgca cgcgctgctg 720

gcgtgcgcgg aggccgtgca acaggagaac ttgacggccg cagaggcgct ggtgaagcag 780

atccccattc tcgcagcgtc ccagggcggc gccatgcgca aggttgctgc ctacttcggc 840

gaggccctcg cccgccgtgt ctatcgcttc cgccccacgc cggacagctc cctcctcgat 900

gccgccttcg ccgacctcct ccacgcgcac ttctacgagt cctgccccta cctcaaattc 960

gcccatttca ccgcgaacca agccatcctc gaggcgttcg ctggctgccg ccgcgtccac 1020

gtcgtcgact tcggcatcaa gcaggggatg cagtggcccg cgcttctcca ggccctcgcc 1080

ctccgtcccg gcggaccccc gtcgttccgc ctcaccggcg tcggcccccc gcagccggac 1140

gagaccgacg ccttgcagca ggtgggttgg aagcttgccc agttcgctca cactatccgc 1200

gtcgatttcc agtaccgcgg cctcgtcgct gctacgctcg ccgacctgga gccgttcatg 1260

ctggagcctg agggcgaggc ggacgcgaac gaagaacctg aggtgatcgc cgtcaactca 1320

gtgttcgagc tgcatcggct gctcgcgcag cccggcgccc tggagaaggt cctgggaacg 1380

gtgcgcgctg tgcggccaag gatcgtgacc gtggtagaac aggaggccaa ccacaactcc 1440

ggctcattcc tggaccggtt cacggagtct ctgcactact actccaccat gttcgattct 1500

ctcgagggcg ccggctccgg ctccggccaa tccgaaatct cgccgggggc ggctgctgct 1560

ggtggtggca cggaccaggt catgtccgag gtgtacctcg gccggcagat ctgcaacgtt 1620

gtggcgtgcg agggcgcgga gcgcacggag cgccacgaga cgctggggca gtggcgcagc 1680

cgtctgggcc gcgccgggtt cgagcccgtg cacctgggct ccaatgccta caagcaggcg 1740

agcacgctgc tcgcgctctt cgccgggggc gatgggtaca gggtggagga gaaggacggg 1800

tgcctcacgc tggggtggca cacgcgcccg ctcatcgcca cctcggcatg gcgcgacgcc 1860

gcagcgtga 1869

<210>5

<211>1863

<212>DNA

<213>SEQ ID No 5 GRG1-C

<400>5

atgaagcgcg agtaccaaga ccccggcggg agcggcggcg gcgaagatat gagctcgtcc 60

aaggacaaga tgatggcggc gggggaggag gaggaggtgg acgagttgct ggccgcgctc 120

gggtacaagg tgcggtcgtc cgacatggcc gacgtggcgc agaagctgga gcagctcgag 180

atggccatgg ggatgggcgg cgtgggcgcc ggcgtcaccg cggacgacgg cttcgtgtcg 240

cacctggcga cggacaccgt gcattataac ccctccgacc tctcctcctg ggtcgagagc 300

atgctttccg agctcaacgc gcccccgcct ccgctcccgc cggccccgca ggcttcgagg 360

ctcgcgtcca cctcgtccac cgtcacgggt ggcggcggcg ccgggtactt cgatcccccg 420

caagccgtcg actcgtcgag cagcacgtac gctctgaggc cgatcccctc gccggttgtg 480

gcgccggtcg acccgtccgc ggactccacg cgggaaccca agcggatgcg cactcgcggc 540

ggcagcacgt cgtcgtcctc ctcgtcgtcc tcctctctcg gcagtggggg tgttaggagc 600

tctgtggtgg aggctgctcc gccagcgacg caagcgtccg cggcggctaa cgcgcccgcg 660

gtgccggttg tggtggggaa cacgctggag gccgggatcc ggctggtgca cgcgctgctg 720

gcgtgcgcgg aggccgtgca gcaggagaac atgacggccg cggaggcgct ggtgaagcag 780

atccccgttc tcgccgcgtc ccagggcggc gccatgcgta aggttgccgc ctacttcggc 840

gaggcgctgg accgccgtgt ccatcgcttc cgcccgacgc cggacagctc cctcctcgac 900

gccgccttcg ccgacctcct ccacgcgcac ttctacgagt cctgccccta cctcaagttc 960

gctcacttca ccgcgaacca agccatcctc gaggcgttcg ctggctgccg ccgcgtccac 1020

gtcgtcgact tcggcatcaa gcaggggatg cagtggcccg cgcttctcca agccctcgcc 1080

ctccgtcccg gcgggccccc ttcgttccgc ctcaccggcg tcggcccccc gcagccggac 1140

gagaccgacg ccttacagca ggtgggttgg aagcttgccc agtttgctca cactatccgc 1200

gtcgatttcc agtaccgcgg cctcgtcgcc gctacgctcg ccgacctgga gccgttcatg 1260

ctgcagccgg aggacgaggc ggacgcgaac gaagaacctg aggtgatcgc cgtcaactca 1320

atgttcgagc tgcaccggct gctcgcgcag cccggcgccc tggagaaggt cctgggcacg 1380

gtgcgcgctg tgcggccaag gatcgtgacc gtggtagagc aggaggccaa ccacaactcc 1440

ggttcattcc tggaccggtt cacggagtct ctgcactact actccaccat gttcgattct 1500

ctcgagggcg ccggctccgg ccaatccgaa atctcgccgg gggcggctgc tggtggcggc 1560

ggcacggacc aggtcatgtc cgaggtgtac ctcggccggc agatccgcaa cgttgtggcg 1620

tgcgagggtg cggagcgcac ggagcgccac gagacgctgg ggcagtggcg caaccgtctc 1680

ggccgcgccg ggtttgagcc cgtccacctg ggctccaatg ccttccggca ggcgagcacg 1740

ctgctcgcgc tcttcgccgg gggcgatggg tacagggtgg atgagaagga cgggtgcctc 1800

acgctggggt ggcacacgcg cccgctcatc gccacctcgg catggcgcgt cgccgcggcg 1860

tga 1863

<210>6

<211>23

<212>DNA

<213>target

<400>6

gcgtgtgcca ccccagcgtg agg 23

<210>7

<211>23

<212>DNA

<213>Target F-c

<400>7

tcagcgtgtg ccaccccagc gtg 23

<210>8

<211>23

<212>DNA

<213>Target R-c

<400>8

aaaccacgct ggggtggcac acg 23

<210>9

<211>22

<212>DNA

<213>U-F

<400>9

ctccgtttta cctgtggaat cg 22

<210>10

<211>20

<212>DNA

<213>gRNA-R

<400>10

cggaggaaaa ttccatccac 20

<210>11

<211>40

<212>DNA

<213>Uctcg-B1

<400>11

ttcagaggtc tctctcgact agtggaatcg gcagcaaagg 40

<210>12

<211>40

<212>DNA

<213>gRcggt-BL

<400>12

agcgtgggtc tcgaccgacg cgtccatcca ctccaagctc 40

<210>13

<211>20

<212>DNA

<213>Hyg-F

<400>13

cccatgtgta tcactggcaa 20

<210>14

<211>20

<212>DNA

<213>Hyg-R

<400>14

ttctacacag ccatcggtcc 20

<210>15

<211>24

<212>DNA

<213>Cas9-F

<400>15

acatcaacag gctttctgac tacg 24

<210>16

<211>24

<212>DNA

<213>Cas9-R

<400>16

acttggtgtt catcctagaa tcga 24

<210>17

<211>19

<212>DNA

<213>A-F

<400>17

tgcgatcacg ctgcggcga 19

<210>18

<211>20

<212>DNA

<213>A-R

<400>18

acaagcaggc gagcacgcta 20

<210>19

<211>19

<212>DNA

<213>B-F

<400>19

tgcgatcacg ctgcggcga 19

<210>20

<211>21

<212>DNA

<213>B-R

<400>20

cctgggctcc aatgccttcc g 21

<210>21

<211>19

<212>DNA

<213>C-F

<400>21

tgcgatcacg ctgcggcga 19

<210>22

<211>20

<212>DNA

<213>C-R

<400>22

gccggcagat ctgcaacgtt 20

Claims

1. The mangosteen GRG1 gene has the nucleotide sequence as shown in SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No. 5.

2. A method for improving the plant type of dendrocalamus latiflorus, which is characterized in that the expression of GRG1 gene in dendrocalamus latiflorus is changed to lose the function of the dendrocalamus latiflorus, and comprises the following steps:

(1) GRG1 gene cloning and target site design in dendrocalamus latiflorus; the nucleotide sequence of the GRG1 gene is shown as SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5;

(2) constructing a sgRNA expression cassette, connecting the sgRNA expression cassette with a pYLCRISPR/Cas9Pubi-H vector, and constructing a dendrocalamus latiflorus GRG1 gene editing vector; the pYLCRISPR/Cas9Pubi-H vector structure is shown in figure 1 a;

(3) transferring the constructed dendrocalamus latiflorus GRG1 gene editing vector into agrobacterium tumefaciens EHA105, and infecting dendrocalamus latiflorus callus by using agrobacterium-mediated method to carry the GRG1 gene editing vector agrobacterium tumefaciens EHA 105;

3. The method for improving the plant type of the dendrocalamus latiflorus as claimed in claim 2, wherein the method comprises the following steps: the sgRNA expression cassette in the step (2) is specifically constructed as follows: designing a target-containing primer with a special base joint, annealing and complementing the target primer to form a target joint, connecting the target joint to an intermediate vector pYLsgRNA-OsU6c by means of enzyme digestion and connection, and assembling the target joint and the gRNA together to construct an sgRNA expression cassette; the pYLsgRNA-OsU6c vector structure is shown in FIG. 1 b.

4. The method for improving the plant type of the dendrocalamus latiflorus according to claim 3, wherein the method comprises the following steps: the primer containing the target with the special base joint comprises the following components: target F-c: 5'-tcaGCGTGTGCCACCCCAGCGTG-3', Target R-c: 5'-aaacCACGCTGGGGTGGCACACG-3' are provided.

5. Use of the method according to claim 2 for improving the plant type of dendrocalamus latiflorus in breeding transgenic plants of dendrocalamus latiflorus with accelerated growth.