CN110714093A

CN110714093A - SCAR molecular marker related to banana wilt resistance and detection method and application thereof

Info

Publication number: CN110714093A
Application number: CN201910961476.4A
Authority: CN
Inventors: 徐春香; 冯国恩; 李小泉; 陈厚彬; 吕顺; 王芳
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2019-10-11
Filing date: 2019-10-11
Publication date: 2020-01-21
Anticipated expiration: 2039-10-11
Also published as: CN110714093B

Abstract

The invention discloses an SCAR molecular marker related to banana vascular wilt resistance, and a detection method and application thereof. The nucleotide sequence of the SCAR molecular marker is shown as SEQ ID NO. 1 and has 251 bp. The method for detecting and identifying the banana wilt resistance comprises the steps of taking the DNA of a banana sample to be detected as a template, adopting an SCAR molecular marker detection primer to carry out PCR amplification reaction and detect an amplification product, wherein if a 251bp specific strip is amplified, the banana sample to be detected does not have the banana wilt resistance and is a banana wilt susceptible variety; otherwise, the banana sample to be detected has banana wilt resistance and is a banana wilt resistance variety. The SCAR molecular marker provided by the invention provides a molecular auxiliary technology for breeding new banana disease-resistant varieties, and further can be used for auxiliary screening of new banana varieties (lines) taking banana tissue culture seedlings, banana field variation plants, generations after physical and chemical mutagenesis and the like as screening groups.

Description

SCAR molecular marker related to banana wilt resistance and detection method and application thereof

Technical Field

The invention relates to the technical field of plant disease resistance breeding molecular markers, in particular to an SCAR molecular marker related to banana vascular wilt resistance and a detection method and application thereof.

Background

Bananas (Musa spp) are the bulk fruit of world trade and are the fourth largest food crop next to rice (Oryza sativa L.), wheat (Triticum aestivum L.), and corn (Zea mays L.). The banana is usually threatened by plant diseases and insect pests and damaged by typhoon and cold damage in production, and the development of the banana industry is severely restricted. Therefore, the cultivation and cultivation of a new variety of high quality bananas with good stress resistance is considered to be the most economical and effective method for solving the above problems.

Banana vascular wilt, also known as panama disease, is a vascular bundle systemic disease caused by fusarium oxysporum cubeba specialized (fusarium oxysporum f.sp.cubense, Foc) infection, and is a devastating soil-borne fungal disease. The banana wilt is one of the plant diseases which are distributed most widely and have the strongest destruction in the world, and becomes the biggest obstacle for the development of the banana industry. It has been reported that there are currently 4 race species of banana wilt bacteria, of which race 4 is the most harmful one and infects almost all banana species. In 1976, the banana wilt disease No. 4 physiological race is found on banana in Taiwan in China for the first time, and then the banana wilt disease is rapidly spread in major banana producing areas such as Guangdong, Fujian and Hainan, and the banana industry in China is seriously threatened. At present, no effective control measures exist, and the method becomes one of the biggest obstacles for the development of the banana industry. Therefore, breeding and cultivating banana to resist blight is an effective way to control the disease.

However, the traditional breeding method has low efficiency and long breeding period, and consumes a large amount of manpower and material resources. The molecular marker assisted selection can carry out early screening on potential resistance resources, shorten the progress of disease-resistant breeding and improve the breeding efficiency. However, reports of related molecular markers for assisting banana disease-resistant breeding at home and abroad are less, only Wang et al (2012) screen out two pairs of RAPD primers related to disease resistance by using disease-resistant banana varieties, and successfully develop two SCAR markers; cunha et al (2015) developed a SCAR marker for identifying the resistance/sensitivity of bananas of different genotypes to banana wilt; wangfang et al (2018) screen out two pairs of SRAP primers related to banana vascular wilt by using an SRAP molecular marker technology, and successfully develop two SCAR markers; SCAR molecular markers of banana vascular wilt resistance disclosed in patents CN201610508539.7 and 201711087768.7; because the disease resistance mechanism of the blight of the banana is more complex, the number of genes related to disease resistance is more, and the number of molecular means which can be directly and effectively used in banana breeding is less at present, the disease resistance mechanism of the banana needs to be researched in many aspects to develop a plurality of methods for identifying the blight-resistant bananas, and the research in the aspect has important significance for the disease resistance breeding of the bananas. On the other hand, the existing banana vascular wilt resistance molecular markers are few, and the accuracy of the existing banana vascular wilt resistance molecular markers cannot reach 100%, so that more different resistance molecular markers can be provided, and multiple molecular markers can be simultaneously used for detection and mutual verification during actual detection, so that the accuracy is improved.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide an SCAR molecular marker related to banana vascular wilt resistance.

The invention also aims to provide a detection method of the banana vascular wilt resistance molecular marker.

The invention further aims to provide application of the banana vascular wilt resistance molecular marker.

The above object of the present invention is achieved by the following technical solutions:

a SCAR molecular marker related to banana wilt resistance is disclosed, and the nucleotide sequence of the SCAR molecular marker is shown in SEQ ID NO. 1.

The SCAR molecular marker has a 251bp specific band, and the nucleotide sequence of the specific band is shown as SEQ ID NO:1, the SCAR molecular marker is derived from a 813bp specific band amplified by an SRAP molecular marker Me1-Em2 (the nucleotide sequence of the band is shown as SEQ ID NO: 4). The SCAR molecular marker disclosed by the invention does not find a known sequence with higher homology with the NCBI nucleic acid database and the banana genome database, and shows that the SCAR molecular marker is newly found. The target band amplified by the SCAR molecular marker is a single band, the stability of the band is good, the reproducibility is high, the analysis is simple and quick, the nucleotide sequence is short, the time required by PCR amplification is less, the operation is simpler, and the identification of the resistance of banana vascular wilt can be realized more quickly and efficiently.

The invention also provides a primer for amplifying the SCAR molecular marker.

Preferably, the nucleotide sequences of the primers are respectively shown as SEQ ID NO. 2-3.

The SCAR molecular marker or any one of the primers is applied to identifying the resistance of banana wilt, screening a banana variety resistant to the wilt or preparing a detection kit for the resistance of banana wilt.

A method for identifying the fusarium wilt resistance of bananas or screening fusarium wilt resistant banana varieties comprises the following steps:

s1, extracting genome DNA of a banana sample to be detected;

s2, carrying out PCR amplification reaction by using the DNA shown in the step S1 as a template and using any SCAR molecular marker primer;

s3, carrying out electrophoresis detection on the PCR amplification product of S2, and if a 251bp specific strip is amplified, indicating that the banana sample to be detected does not have banana vascular wilt resistance and is a banana vascular wilt susceptible variety; otherwise, the banana sample to be detected has banana wilt resistance and is a banana wilt resistance variety.

Preferably, the reaction system of the PCR amplification reaction of step S2 is: 50 ng/. mu.L template DNA 1. mu.L, 10mM primer 11. mu.L, 10mM primer 21. mu.L, Mg²⁺Free 10×Taq buffer 2.5μL，25mM MgCl₂1.5μL，2.5mM dNTP 2μL，5U/μL Taq DNA Polymerase 0.2μL，ddH₂O15.8. mu.L, total volume 25. mu.L.

Preferably, the reaction procedure of the PCR amplification reaction in step S2 is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 45s, and 30 cycles; final extension 72 ℃ for 10 min.

A kit for identifying fusarium wilt resistance of bananas or screening fusarium wilt resistant banana varieties comprises any one of the primers for detecting the SCAR molecular marker.

Preferably, the kit also contains reagents required by PCR amplification reaction and reagents required by extraction of the genomic DNA of the banana sample.

The invention also claims application of the kit in identifying the fusarium wilt resistance of bananas or screening the fusarium wilt-resistant bananas.

Preferably, the banana is a canna.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides an SCAR molecular marker related to banana wilt resistance, which is newly found, a known sequence with higher homology with the SCAR molecular marker is not found in a NCBI nucleic acid database and a banana genome database, and the SCAR molecular marker can be used for researching a gene related to banana wilt resistance and researching a wilt resistance mechanism of bananas. The target band amplified by the SCAR molecular marker related to the resistance of banana vascular wilt provided by the invention is a single band, shows the existence of the target band, and has the advantages of simple analysis, good amplification stability, high reproducibility and the like; the SCAR molecular marker provided by the invention has the advantages of short nucleotide sequence, simple PCR (polymerase chain reaction) procedure, less time required by amplification and simpler operation. The SCAR molecular marker of the invention can be used for detecting different target genes, and is matched with the existing molecular marker in actual detection, thereby mutually verifying and improving the accuracy. The SCAR molecular marker of the invention provides a molecular auxiliary technology for breeding new banana disease-resistant varieties, further can be used for auxiliary screening of new banana varieties (lines) taking banana tissue culture seedlings, banana field variation plants, generations after physical and chemical mutagenesis and the like as screening groups, and has a wide application prospect.

Drawings

FIG. 1 is a DNA electrophoresis chart of a portion of banana (Musa spp.) sample extracted by the modified CTAB method. 1: 'agrotechnology No. 1'; 2: 'Nantian yellow'; 3: 'Dongyan No. 1'; 4: BXM 51; 5: 'Antiwither No. 1'; 6: 'northern dwarf banana'; 7: the handle in Dongguan; 8: 'tail flush'; 9: 'Brazil banana'; 10: G30.

FIG. 2 is a PCR amplification electrophoresis diagram of SRAP primers Me1-Em2 on 10 banana Musa spp. M: DL2000 marker; 1: 'agrotechnology No. 1'; 2: 'Nantian yellow'; 3: 'Dongyan No. 1'; 4: BXM 51; 5: 'Antiwither No. 1'; 6: g30; 7: the handle in Dongguan; 8: 'tail flush'; 9: 'Brazil banana'; 10: 'northern dwarf banana'.

FIG. 3 is the PCR amplification electrophoresis diagram of SRAP primers Me9-Em1 on 10 banana Musa spp. M: DL2000 marker; 1: 'agrotechnology No. 1'; 2: 'Nantian yellow'; 3: 'Dongyan No. 1'; 4: BXM 51; 5: 'Antiwither No. 1'; 6: g30; 7: the handle in Dongguan; 8: 'tail flush'; 9: 'Brazil banana'; 10: 'northern dwarf banana'.

FIG. 4 shows the SRAP marker sequence related to banana vascular wilt resistance amplified by the Me9-Em1 primer.

FIG. 5 is a partial PCR amplification electrophoretogram of SCAR marker of Me9-Em 1. M: DL2000 marker; 1: 'agrotechnology No. 1'; 2: 'Nantian yellow'; 3: 'Dongyan No. 1'; 4: BXM 51; 5: 'Antiwither No. 1'; 6: g30; 7: the handle in Dongguan; 8: 'tail flush'; 9: 'Brazil banana'; 10: 'northern dwarf banana'.

FIG. 6 shows the results of SCAR-labeled primer screening for Me1-Em 2. A: 1, a primer; b: a primer 2; c: a primer 3; d: and (3) a primer 4. M: DL2000 marker; 1: 'agrotechnology No. 1'; 2: 'Nantian yellow'; 3: 'Dongyan No. 1'; 4: BXM 51; 5: the handle in Dongguan; 6: 'tail flush'; 7: 'Brazil banana'; 8: 'northern dwarf banana'.

FIG. 7 shows SCAR marker sequences related to banana vascular wilt resistance amplified by the Me1-Em2 primer.

Fig. 8 is an amplification electrophoretogram of the scarr marker against 23 infection-resistant banana (Musa spp. M: DL2000 marker; 1: g6-1; 2: 'Nantianqing'; 3: 'agrotechnology No. 1'; 4: 'Antiwither No. 1'; 5: 'Somali banana'; 6: 'Dutch banana'; 7: 'Longzhou central handle'; 8: L1N 1; 9: 'the slope of the high handle'; 10: 'Tianbao dwarf banana'; 11: 'mexican banana'; 12: 'Zhangiao 8-2'; 13: ke 2; 14: WS 2; 15: 'Guangdong No. 2'; 16: g20; 17: 'river mouth high handle'; 18: 'Honghe dwarf banana'; 19: 'Nalong handle'; 20: 'Pubei dwarf banana'; 21: 'Dingan Gaoya'; 22: g30; 23: 'Antiwither No. 5'.

Fig. 9 is an amplified electrophoretogram of the scarr marker against a new strain of banana (Musa spp. M: DL2000 marker; 1: NK 1; 2: NK 2; 3: HNAJ 0202; 4: YYK1, respectively; 5: 'northern dwarf banana'; 6: HNAJ 0212; 7: HNAJ 0219; 8: HNAJ 0301.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

The molecular marker for banana wilt resistance selects a test material, and samples the test material from a banana germplasm resource garden of banana vegetable research institute in Dongguan city in 2018 and 10 months. The selected banana varieties/lines (Musa spp. AAA) with different resistance/sensibility to banana wilt are 30 parts in total (table 1), and the selected banana varieties/lines comprise part of new varieties/lines cultivated by banana vegetable research institute in Dongguan city, a plurality of banana producing area varieties in China and a variety popularized in a large area.

Table 1 test 30 banana (Musa spp. aaa) varieties and resistance to banana wilt disease # 4 races

Example 1 Banana Whole genome DNA extraction

Method and device

1. Banana varieties with different banana wilt resistances (table 1) are selected for DNA extraction respectively. The DNA extraction method adopts a modified cetyl trimethyl ammonium bromide method (CTAB):

(1) 1mL of modified CTAB extract (3% CTAB, 100mmol/L Tris-HClpH8.0, 1.4mol/L NaCl, 20mmol/L EDTA pH8.0, 2% PVP, 4% beta-mercaptoethanol) was added to a 2mL centrifuge tube and preheated in a 65 ℃ water bath.

(2) Weighing 0.2-0.5 g of banana tender leaves into a mortar, adding a small amount of PVP, and quickly grinding into powder in liquid nitrogen.

(3) And transferring the powder into a preheated CTAB extracting solution, fully mixing uniformly, keeping the temperature at 65 ℃ for 60min, and shaking uniformly every 10-15 min to fully mix the powder and the extracting solution uniformly.

(4) Cooling to normal temperature at room temperature, centrifuging at 8000rpm for 6min, collecting supernatant, and transferring into new 2mL centrifuge tube.

(5) Equal volume of chloroform/isoamyl alcohol (24:1) was added, mixed gently, 12000rpm, and centrifuged for 10 min.

(6) And (3) sucking the supernatant into a 2mL centrifuge tube, adding 30% volume of absolute ethanol and equal volume of DNA (deoxyribonucleic acid) to extract phenol, namely chloroform and isoamylol (25:24:1), fully mixing uniformly, standing for a moment, and centrifuging at 12000rpm for 10 min.

(7) Transferring the supernatant into a new 2mL centrifuge tube, adding 1/10 volumes of 3M sodium acetate and isopropanol with the same volume, mixing the mixture by gently inverting the mixture up and down, and standing the mixture at-20 ℃ for more than 2 h.

(8) Centrifuging at 12000rpm for 10min, pouring out supernatant, washing DNA with 75% ethanol for 2-3 times, volatilizing ethanol at room temperature, dissolving DNA with TE buffer or sterile water, digesting with appropriate amount of RNase A (water bath at 37 ℃ for 1-2 h), and storing at 20 ℃ for later use.

2. DNA concentration and purity measurement

(1) And (3) electrophoresis detection: and (3) adding 1 mu L of 6 XLoading B mu ffer and 4 mu L of ddH2O into 2 mu L of DNA mother liquor, spotting the mixture in 1% agarose gel, performing 120V electrophoresis for about 15-20 min, observing and photographing under a gel imaging system, and detecting the size and the integrity of a genome DNA fragment.

(2) And (3) detecting by a nucleic acid protein instrument: a1. mu.L sample of DNA was aspirated, and the mass concentration of DNA and the absorbance A at a wavelength of 260nm and 280nm were determined using a nucleic acid protein analyzer (Eppendorf BioPhotometer Plus)₂₆₀And A₂₈₀And calculate A₂₆₀/A₂₈₀To judge the purity of the DNA. And judging the quality of the DNA according to the following basis: OD₂₆₀/OD₂₈₀The concentration should be between 1.6 and 1.9, RNA pollution is caused when the concentration is more than 1.9, and protein pollution is caused when the concentration is less than 1.6; OD₂₆₀/OD₂₃₀More than 2.0 and less than 2.0 indicates that salt and small-molecule impurities remain in the solution.

Second, result in

The DNA of banana genome is extracted by CTAB improvement method, the concentration of DNA mother liquor of the extracted sample can reach more than 400 ng/mu L, OD₂₆₀/₂₈₀The molecular marker has the advantages of about 1.8 percent and better quality, meets the test requirements, and can be used for the subsequent screening of SRAP molecular markers and SCAR molecular markers. FIG. 1 is the electrophoresis chart of the genome DNA of a part of banana sample extracted by the method.

Example 2 screening of molecular markers for SRAP associated with resistance to Banana wilt disease

Method and device

10 varieties of 'agricultural family No. 1', 'south China', 'east Banana No. 1', BMX51, 'anti-wither No. 1', G30, 'Dongguan', 'tail alignment', 'Brazil' and 'northern dwarf banana' are selected for screening the SRAP specific bands. The SRAP primer sequences are shown in Table 2 and synthesized by Shanghai Bioengineering services, Inc.

PCR amplification was performed on a PCR instrument (Bio-Rad T100, Bio-Rad/USA), the PCR reaction system and the PCR reaction conditions are shown in Table 3 and Table 4, respectively.

TABLE 2 SRAP marker primers and sequences

TABLE 3 PCR reaction System

TABLE 4 PCR reaction conditions

And adding 4 mu L of 6 Xloading buffer into the amplification product, taking 8-10 mu L of the amplification product, carrying out electrophoresis in 1.8% agarose gel at the voltage of 120V for about 40min, observing and analyzing in an ultraviolet gel imager, and recording the result.

Second, result in

100 pairs of SRAP primers were combined by synthesizing 10 forward primers and 10 reverse primers (Table 2). 5 disease-resistant varieties/lines ('agricultural family No. 1', 'south China', 'east Banana No. 1', BXM51 and 'anti-wither No. 1') and 5 susceptible varieties/lines (G30, 'eastern guan', 'olea', 'Brazil' and 'northern dwarf banana') are used as test materials, and 2 pairs of SRAP molecular markers related to banana wilt resistance are screened out, namely Me1-Em2 and Me9-Em 1. Me1-Em2 amplified specific bands of about 900bp in 5 susceptible varieties/lines (FIG. 2), and Me9-Em1 amplified specific bands of about 400bp in 5 susceptible varieties/lines (FIG. 3). Neither of the two pairs of SRAP markers had amplification of a specific band in the disease resistant variety/line (FIG. 2, FIG. 3)

Example 3 design and identification of primers specific to SCAR molecular markers for banana vascular wilt resistance

1. Screening of SCAR molecular marker primers for banana wilt resistance

The specific bands amplified from 2 SRAP-labeled 5 susceptible varieties/lines (G30, from Dongguan, from Brazilian, from northern dwarf) in example 2 were excised and recovered, and sent to Shanghai Biotechnology service GmbH for sequencing. The sequencing results were aligned and analyzed on the BioXM2.7 software, and the DNA sequences were substantially identical between the different varieties/lines. The pair of primers Me1-Em2 obtains a DNA sequence of 813bp, and the nucleotide sequence is shown as SEQ ID NO: 4, Me9-Em1 obtains a 400bp DNA sequence, and the nucleotide sequence is shown as SEQ ID NO: 5, respectively. The two obtained DNA sequences are subjected to BLAST analysis on NCBI nucleic acid database and banana genome database (http:// banana-genome-hub. southgreen.fr/BLAST) respectively, and have no high homology with the existing sequences, which may be caused by that the specific fragment is the intergenic region or the intron sequence of DNA in banana genome.

A plurality of pairs of SCAR marker primers are designed for the marker sequences obtained by Me9-Em1 by using a Primer3 online Primer design tool, but ideal bands cannot be amplified in any of the pairs, the specific sequences are shown in FIG. 4, and partial results are shown in FIG. 5. Therefore, this SRAP marker cannot be converted into a SCAR marker. The phenomenon that the pair of SRAP markers Me9-Em1 cannot be converted into SCAR markers occurs. This may be due to the presence of unreasonable primer design, sequence similarity or multiple copies in the DNA. The design of the SCAR primers is optimized to some extent according to the situations, and the SCAR primers cannot be successfully converted into SCAR markers.

The Primer3 online Primer design tool is utilized to design the SCAR Primer for the marker sequence obtained from Me1-Em2, and the specific sequence is shown in Table 5:

TABLE 5 SCAR marker primer sequences

4 disease-resistant varieties/lines (' agricultural family No. 1 ', ' south yellow ', ' east banana No. 1 ', and BXM51) and 4 susceptible varieties/lines (' Dongguan ' middle-tube ', ' Qiwei ' and ' northern dwarf banana ') were selected as test materials, PCR amplification was performed using the primers of SCAR molecular markers developed in the above Table 11, and SCAR marker primer screening was performed. The PCR reaction system is shown in Table 3 above, and the PCR reaction procedure is shown in Table 6:

TABLE 6 PCR reaction procedure

And adding 4 mu L of 6 Xloading buffer into the amplification product, taking 8-10 mu L of the amplification product, carrying out electrophoresis detection in 1.2% agarose gel at the voltage of 110V for about 25min, observing and analyzing in an ultraviolet gel imager, and recording the result.

As can be seen from FIG. 6(D), the amplification effect with primer 4(SC4-F/SC4-R) was the best, and 251bp bands were amplified in all 4 susceptible varieties/lines, and no other bands were observed. While there was no amplification of this band in 4 resistant varieties/lines. Therefore, the pair of primers SC4-F/SC4-R meets the requirements of SCAR molecular markers, and the band is found to be 72-322 bp of the original SRAP specific band through comparison (FIG. 7). While the other 3 pairs of primers amplified bands of corresponding sizes in 8 varieties/lines, but the bands were weaker in the disease-resistant varieties/lines, presumably due to partial mismatches during the amplification process.

2. SCAR molecular marker accuracy verification of banana wilt resistance

In order to further verify the accuracy of the SCAR marker, 23 canna varieties/systems with known sensibility such as 'Nantianqing', 'Guangdong No. 2', 'Nalong middle handle', 'river mouth high handle' and the like are selected as test materials, and SC4-F/SC4-R is adopted to carry out amplification detection on the SCAR primer. The amplification result is shown in FIG. 8, 251bp specific bands are amplified in all the susceptible varieties/lines, and the specific bands are not amplified in 4 disease-resistant banana varieties G6-1, Nandining, agricultural family No. 1 and Subtraction-resistant 1. The amplification result is consistent with the resistance of the banana wilt disease planted in the variety field. However, the disease-resistant variety No. 5 has high resistance to blight in the field, and a 251bp specific strip band is amplified and is inconsistent with the field performance. Meanwhile, the band amplified by the ke2 susceptible variety/line is weaker than that of other susceptible varieties to be tested, which is consistent with certain disease resistance to blight. Therefore, the accuracy of the SCAR molecular marker in the test reaches 96.67%, and the repeated test results are consistent.

Example 4 application of SCAR molecular marker for banana vascular wilt resistance SCAR molecular marker

For unknown lines, the SCAR marker developed in example 3 (SC4-F/SC4-R) was used: 7 parts of resources to be detected, namely HNAJ0212, HNAJ0219, HNAJ0301, HNAJ0202, 2 mutants (NK1 and NK2) of 'agricultural family No. 1' and 'Guangdong excellent antibody No. 1', are screened. The amplification results are shown in fig. 9, and the HNAJ0212, HNAJ0219, HNAJ0301 and HNAJ0202 all amplified 251bp specific bands, and the 4 were susceptible strains, while the 2 mutants of 'agrarian 1' (NK1, NK2) and the 1 mutant of 'yueju anti 1' (YYK1) did not amplify the specific bands, and were disease resistant strains. The SCAR molecular marker for banana vascular wilt resistance has certain application value.

Sequence listing

<110> southern China university of agriculture

<120> SCAR molecular marker related to banana wilt resistance, detection method and application thereof

<141>2019-10-10

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>251

<212>DNA

<213> Banana (Musa spp)

<400>1

gagggcgaat cctatgtcaa aatgggttca agtggtgctt tctctttgct cggcccgaag 60

gcactggatt cctattgcaa tggaaatacg ggttacacga tataatctac tgaatgaaga 120

gactggttga catggagggc ataggtcaag tacaagacag agaggctaac gaaggtggac 180

atggagggca tagcataggt caagtacaag acagagaggc taactaaggc caagggagct 240

tagaaaccac c 251

<210>2

<211>20

<212>DNA

<213> Banana (Musa spp)

<400>2

gagggcgaat cctatgtcaa 20

<210>3

<211>21

<212>DNA

<213> Banana (Musa spp)

<400>3

ggtggtttct aagctccctt g 21

<210>4

<211>813

<212>DNA

<213> Banana (Musa spp)

<400>4

tacccctctt ccagaatgat cctatcgcgg gaggagccat tgtagttata caactttttg 60

gcacagaagt ggagggcgaa tcctatgtca aaatgggttc aagtggtgct ttctctttgc 120

tcggcccgaa ggcactggat tcctattgca atggaaatac gggttacacg atataatcta 180

ctgaatgaag agactggttg acatggaggg cataggtcaa gtacaagaca gagaggctaa 240

cgaaggtgga catggagggc atagcatagg tcaagtacaa gacagagagg ctaactaagg 300

ccaagggagc ttagaaacca ccaacaccaa gagctaaaca tatgcatggg tgtacagcgt 360

tggcgtgagg gaattttttc ataatatagg gcttatttct agcattcatt aacgagatct 420

ccatcttcgg acatgaaagt gaacaaaggc attcttagta agttcaaaag ggagtctcgg 480

atccaatcca caatcaatgg gggaagcagc tacacaagca gcattattgg atttgttcaa 540

aagaaagtat cggatcacac attcgtcagt gcaatttcac aaaggttaac aaggttcaaa 600

gaaagggtgg tcagtgcaac ttcaaaggtt caaagaaagg gtggtcagtt ggggaagaca 660

atatgactct tcccagcacc gtcccgcaga atgtaatagt caacgtacct tttcctcgca 720

tctaccgcta cggccaagta aagcagccaa gtcactactc atgtgtagcg gcagttgtgt 780

ttgcttcaac aatctactgaatatatacga tgc 813

<210>5

<211>400

<212>DNA

<213> Banana (Musa spp)

<400>5

ttgagtccaa accggagtcg agatcggcag acaataagaa tggaaataga gttgacttca 60

gaatccaatc caatgggaaa aacaataaat gatcaatatg aaataaataa gaaaagtcga 120

catctttatc atatacatac tcagtacaga catagaaggg aaaaatatag gtgaattcta 180

tctcttctta tataggtgaa cggattctac tcttaattcc aatactcggg caggctggta 240

tcattccaat acgagggcgg ggcagagtca attacttgct ttgaagctag tcctgagtcg 300

aggtagtcta ggaagcaagc ttgagtggaa gtaggaaagt agtaagggta tccagtagta 360

agggtatcca gtagtaaaga tattaattcg tacgcagtca 400

Claims

1. A SCAR molecular marker related to banana wilt resistance is characterized in that the nucleotide sequence of the SCAR molecular marker is shown in SEQ ID NO. 1.

2. A primer for amplifying the SCAR molecular marker of claim 1.

3. The primer according to claim 3, wherein the primers are respectively shown as SEQ ID NO. 2-3.

4. Use of the SCAR molecular marker of claim 1 or the primer of any one of claims 2 to 3 for identifying banana wilt resistance or screening banana varieties resistant to wilt or for preparing a banana wilt resistance detection kit.

5. A method for identifying the fusarium wilt resistance of bananas or screening fusarium wilt resistant banana varieties is characterized by comprising the following steps:

s1, extracting genome DNA of a banana sample to be detected;

s2, carrying out PCR amplification reaction by using the DNA of the step S1 as a template and using the primer of claim 2 or 3;

6. The method according to claim 5, wherein the reaction system of the PCR amplification reaction of step S2 is: 50 ng/. mu.L template DNA 1. mu.L, 10mM primer 11. mu.L, 10mM primer 21. mu.L, Mg²⁺Free 10×Taq buffer 2.5μL，25mM MgCl₂1.5μL，2.5mM dNTP 2μL，5U/μL Taq DNA Polymerase 0.2μL，ddH₂O15.8. mu.L, total volume 25. mu.L.

7. The method of claim 5, wherein the reaction procedure of the PCR amplification reaction of step S2 is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 45s, and 30 cycles; final extension 72 ℃ for 10 min.

8. A kit for identifying banana fusarium wilt resistance or screening a fusarium wilt resistant banana variety, comprising the primer of claim 2 or 3.

9. The kit according to claim 8, further comprising reagents required for PCR amplification reaction and reagents required for extraction of genomic DNA from banana sample.

10. Use of the kit according to claim 8 or 9 for identifying banana fusarium wilt resistance or screening bananas resistant to fusarium wilt.