CN110699336A

CN110699336A - CIPK9 protein and application of coding gene thereof in drought resistance of plants

Info

Publication number: CN110699336A
Application number: CN201810660415.XA
Authority: CN
Inventors: 巩志忠; 王瑜; 孙志慧; 秦少川
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2018-06-25
Filing date: 2018-06-25
Publication date: 2020-01-17

Abstract

The invention relates to application of CIPK9 protein and a coding gene thereof in drought resistance of plants, wherein the CIPK9 protein has an amino acid sequence shown as SEQ ID NO. 1. According to the invention, the CIPK9 gene is cloned, the transgenic plant over-expressing the CIPK9 gene is constructed, and the character analysis of the obtained transgenic plant shows that the improvement of the expression level of the CIPK9 protein in the plant can obviously reduce the transpiration rate and the stomatal conductance of the plant, and improve the water utilization rate and the growth condition of the plant under a drought condition. Therefore, the CIPK9 protein and the coding gene thereof can be used for enhancing the drought resistance of plants in production practice, improving the yield of the plants under drought conditions and saving water resources.

Description

CIPK9 protein and application of coding gene thereof in drought resistance of plants

Technical Field

The invention relates to the field of genetic engineering and genetic breeding, in particular to CIPK9 protein and application of a coding gene thereof in drought resistance of plants.

Background

As global climate becomes warm, population continuously increases, fresh water resources are in short supply, and the drought problem is increasingly highlighted. Drought stress affects the growth and yield of crops, causes serious disasters to agricultural production, becomes a worldwide problem restricting agricultural production, and causes crop loss in abiotic stress. Most important crops are sensitive to drought, so that the cultivation of new drought-resistant varieties can effectively deal with yield loss caused by drought stress and improve the water utilization efficiency. The traditional breeding mode needs to identify and combine excellent characters, the success or failure of breeding is determined by the accuracy and the efficiency, the breeding period is long and the result is unpredictable although the biosafety and the stability are high. Compared with traditional breeding, molecular breeding has some obvious advantages, can improve breeding efficiency firstly, does not need breeding processes such as years of hybridization and excellent character screening, and has very strong directionality secondly, and results can be predicted. The improvement of the stress resistance of plants by editing or over-expressing a certain or some specific genes through a genetic engineering means is one of molecular breeding modes. If the edited or transferred genes can be stably inherited, new varieties can be obtained or new characters can be created, the technology breaks through the limitation of interspecific hybridization, is one of effective ways for improving the stress resistance of crops, can improve the yield of the crops under the adverse circumstances, and has important significance for solving the problem of food shortage caused by environmental stress. Meanwhile, the transgenic overexpression and gene editing technology can also be used for basic research work, the biological function of the gene is clarified, and a theoretical basis is provided for better applying the gene resources to new variety cultivation.

CIPK (CBL-interacting protein kinase) is a protein kinase, and the interaction with plant Calcineurin B protein CBL (calcinerin B-like protein) is an important way for regulating the kinase activity. CBL acts as a calcium receptor and binds to the second messenger calcium ion. The CIPK-CBL signal network participates in processes of potassium ion transport in cells, absorption of nitrate ions and ammonium ions and the like, and has important biological functions.

Corn is one of three world grain crops, the corn planting area of China is the second world, the corn is used as a main raw material for manufacturing the compound feed, and the yield of the corn directly influences the livestock industry. Corn is a crop easily affected by drought stress, so that the corn variety is improved and the drought resistance is improved by means of genetic engineering, and the method has important significance for yield reduction caused by drought.

Disclosure of Invention

In order to solve the problems in the prior art, the invention aims to provide the CIPK9 protein and the application of the coding gene thereof in drought resistance of plants.

In order to discover the drought-resistant related genes of the corn, the invention obtains 5000 transgenic lines by transgenically over-expressing a plurality of thousands of genes encoding related functional proteins including ion transport, transcription factors, protein kinase, biological metabolism and the like, observes the drought-resistant or drought-sensitive phenotype by carrying out drought treatment on the plants, and screens out the plants which are drought-resistant by over-expressing CIPK9 genes from the 5000 over-expressed lines. CIPK9 belongs to the CIPK family of protein kinases and exerts its activity by interacting with the calcineurin-like B protein CBL. The related research of the CIPK in the plants mainly comprises Arabidopsis thaliana, and comprises the functions of CIPK family members in calcium ion signal transduction and the aspects of regulating sodium and potassium ion transportation, but the functions of the CIPK family members in corn are rarely reported, and the CIPK9 gene function is not reported. Because maize and arabidopsis are monocotyledonous and dicotyledonous plants, their homologous genes may have different functions. According to the invention, a large amount of screening and research works are carried out to determine that the CIPK9 gene is probably a gene related to plant drought resistance, and experiments verify that the CIPK9 gene participates in the regulation and control of stomata and the like of plants under drought conditions, so that the transpiration of water is regulated, and the drought resistance of the plants is improved.

Accordingly, the present invention provides for the use of CIPK9 in:

(1) the CIPK9 is applied to improving the drought resistance of plants and/or improving the water utilization rate of the plants.

(2) Use of CIPK9 for increasing plant yield.

(3) The CIPK9 is applied to breeding transgenic plants with improved drought resistance and/or improved yield.

Specifically, the CIPK9 of the present invention has an amino acid sequence of any one of the following:

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1.

In addition, the invention also provides application of the CIPK9 gene or an expression cassette or a vector or a host cell containing the CIPK9 gene in improving the drought resistance of plants and/or breeding transgenic plants with improved drought resistance.

Wherein, the CIPK9 gene has any one of the following nucleotide sequences:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

(2) the nucleotide sequence shown in SEQ ID NO.2 is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence to obtain a coding nucleotide sequence of the protein with the same function;

(3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.2 under strict conditions.

In a specific embodiment of the invention, the CIPK9 gene consists of 4685 bases, is derived from corn and is numbered GRMZM2G055575 in a corn genome database. Reverse transcribed to cDNA and amplified and overexpressed is the T01 transcript of CIPK9 gene. The reading frame of the T01 transcript is from the 179 th to the 4296 th base of the 5' end. The gene consists of 14 exons, and the reading frame comprises 1 st to 180 th bases, 1086 th to 1148 th bases, 1228 th to 1299 th bases, 1494 th to 1601 th bases, 1700 th to 1780 th bases, 2002 th to 2055 th bases, 2155 th to 2280 th bases, 2369 th to 2458 th bases, 2592 th to 2714 th bases, 3090 th to 3200 th bases, 3401 st to 3517 th bases, 3634 th to 3690 th bases, 3880 th to 3954 th bases, 4038 th to 4118 th bases and the rest of intron sequences thereof. Since the same DNA segment sequence of maize can produce different transcripts and translate into different proteins, the production of different transcripts by the segment sequence and the translation of different proteins are within the scope of the present invention.

Among them, the vector containing the CIPK9 gene may be a cloning vector or an expression vector containing the CIPK9 gene, preferably an expression vector containing the CIPK9 gene, and more preferably a pBCXUN vector containing the Ubi promoter.

On the other hand, the invention also provides a preparation method of the transgenic plant, and particularly provides a plant with improved drought resistance and/or yield by improving the expression level of the CIPK9 gene.

Preferably, the improvement of the expression level of the CIPK9 gene is realized by transforming a vector overexpressing the CIPK9 gene.

Specifically, the preparation method of the transgenic plant comprises the following steps:

(1) amplifying a full-length gene cDNA sequence (shown as SEQ ID NO. 3) of the CIPK9 gene;

(2) constructing an overexpression vector of the CIPK9 gene;

(3) constructing recombinant agrobacterium tumefaciens of over-expression vectors containing CIPK9 genes;

(4) constructing a transgenic plant with CIPK9 gene over-expression by adopting an agrobacterium infection method.

The CIPK9 protein and the coding gene thereof provided by the invention are applied to plants, wherein the plants are monocotyledons or dicotyledons, and preferably corn, rice, wheat, cotton, soybean and the like.

The invention has the beneficial effects that:

(1) by improving the expression of the CIPK9 gene, the transpiration rate and the stomatal conductance of the plant are respectively reduced by 26 percent and 32 percent, so that the water loss of the plant is effectively reduced.

(2) The transgenic plant over expressing the CIPK9 gene constructed by the invention has obviously enhanced drought resistance, better growth condition under drought conditions and obviously reduced leaf wilting degree.

(3) Compared with the traditional breeding mode, the method for breeding the drought-resistant plant has the advantages of short breeding time and strong purposiveness, obviously shortens the period of drought-resistant breeding and improves the efficiency of drought-resistant breeding.

Drawings

FIG. 1 shows the detection of CIPK9 gene expression level of CIPK9 overexpression corn strain.

FIG. 2 shows the growth of plants after drought treatment of CIPK9 overexpression lines and control plants.

FIG. 3 is a measurement of Transpiration rate and stomatal Conductance for CIPK9 over-expressing lines and control plants, with Transpiration rate (transfer rate) on the left and stomatal Conductance (conductivity to H) on the right₂O)。

FIG. 4 shows the expression of the CIPK9 gene induced by drought.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified, and the main reagents include: restriction enzymes, DNA polymerases, T4 ligases, etc. from biological companies such as NEB and Toyobo; reverse transcription kit from Thermo corporation; RNA extraction kit from magenta; quantitative PCR reagents of Taraka corporation; the plasmid extraction kit and the DNA recovery kit are purchased from Tiangen corporation; MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, rifampicin and other antibiotics are purchased from sigma; the various other chemical reagents used in the examples were all imported or domestic analytical reagents; primer synthesis and sequencing was done by invitro.

Example 1 construction and detection of CIPK9 Gene overexpression vector

Extracting total RNA from B73 corn (Zea mays L.), reverse transcription to obtain cDNA, amplifying CIPK9 gene by using the cDNA as a template and F and R as primers, wherein the primers are provided with enzyme cutting sites and are connected to an over-expression vector after enzyme cutting.

The CIPK9 gene overexpression vector construction method comprises the following steps:

(1) b73 corn total RNA was extracted using the RNA extraction kit from magenta, with the specific steps referred to the kit instructions.

(2) The RNA was reverse transcribed to give cDNA using a reverse transcription kit from thermo, and the detailed procedures were as described in the kit's instructions.

(3) Using cDNA as a template and F and R as primers, amplifying cDNA (shown as SEQ ID NO.3 and coded amino acid sequence thereof is shown as SEQ ID NO. 1) of the CIPK9 gene, running electrophoresis on the amplified product, cutting gel and recovering, wherein the recovery method refers to a Tiangen company kit.

The primers used for amplifying the cDNA of the CIPK9 gene are as follows:

an upstream primer F: CGGGATCCATGGCGGAGCCCGC

A downstream primer R: CCGCTCGAGCTTCGTCTGTTTCATACTTGCATC

(4) The recovered CIPK9 gene cDNA and pBCXUN carrier are subjected to double enzyme digestion by Xba I and Cla I, and enzyme digestion products are subjected to electrophoresis and gel cutting for recovery. The recovered product was ligated with T4 ligase. The CIPK9 gene is connected to a pBCXUN vector (the pBCXUN vector takes a commercial vector pCAMBIA1300 as a framework, the hygromycin resistance gene hpt in the pBCXUN vector is replaced by a herbicide resistance gene barM; meanwhile, the promoter of the maize ubiquitin gene Ubi is cloned on the vector by an enzyme digestion connection mode to drive the transcription of a downstream overexpression gene), and the expression of the CIPK9 gene is driven by the Ubi promoter.

(5) 5 mu.L of the product of the enzyme digestion-ligation system is taken to transform the competence of the escherichia coli. Screening was performed on LB plates containing 50. mu.g/mL kanamycin. And (5) identifying the single clone by colony PCR, and selecting a positive clone for sequencing. The obtained recombinant expression vector with correct sequencing was named pBCXUN-CIPK 9. Colony PCR and sequencing universal primers were as follows:

UbiP-seq:TTTTAGCCCTGCCTTCATACGC

NosR-seq:AGACCGGCAACAGGATTCAATC。

example 2 construction and testing of CIPK9 Gene overexpressing plants

The pBCXUN-CIPK9 overexpression plasmid constructed in example 2 was transformed into competent Agrobacterium EHA105 strain by heat shock and colony PCR identified positive clones. Inoculating single colony of Agrobacterium identified correctly in 2-3mL liquid culture medium containing 100 μ g/mL kanamycin and 50 μ g/mL rifampicin, shake culturing at 28 deg.C overnight, inoculating to liquid culture medium containing large amount of antibiotics the next day, shake culturing, collecting thallus after several times of inoculation, and resuspending to OD₆₀₀Between 0.8 and 1.0. And infecting the young B73 corn embryo picked out under aseptic condition with the obtained recombinant agrobacterium suspension, and inducing the young corn embryo to callus and grow into seedlings. Transgenic plants are obtained by self-crossing and seed-breeding T3 generation for subsequent experiments. The results of extracting RNA of different transgenic inbred lines, performing reverse transcription to obtain cDNA, and performing quantitative PCR detection on the transgenic overexpression condition are shown in figure 1, and the expression quantity of the CIPK9 gene in the transgenic plant is about 7 times that of B73 of a non-transgenic control plant and is far higher than that of the non-transgenic control plant.

Example 3 detection of Dry treatment phenotype in maize overexpressing the CIPK9 Gene

Adding 140g of soil into each small pot, adding water into a tray, respectively placing 4 CIPK9 gene overexpression corn seeds and seeds of a non-transgenic control plant B73 into each small pot, covering 50mL of soil, pouring out the residual water in the tray after full water absorption, removing a seedling with uneven growth after seedling emergence, adding 1L of water into the tray, pouring out the water after full water absorption, starting drought treatment, and observing the drought treatment phenotype of the control plant and the transgenic plant. Control and transgenic plants were replicated in 3 pots each. The result is shown in fig. 2, the growth condition of the transgenic plant over-expressing CIPK9 is obviously better than that of the control plant, and the leaf wilting degree is obviously lower than that of the control plant, which indicates that the transgenic plant over-expressing CIPK9 gene has stronger drought resistance than that of the non-transgenic control plant.

Example 4 measurement of transpiration Rate and stomatal conductance of maize overexpressing the CIPK9 Gene

The single plant non-transgenic control 3 obtained in the example 2 and the CIPK9 gene overexpression transgenic plant 3 are respectively planted in a large barrel, 1 plant in each barrel grows to the 7-8 leaf stage, and the indexes such as the leaf transpiration rate, the stomatal conductance and the like are measured. The measuring instrument is LI-6400XT of LI-COR company, and the using method refers to the using instruction of the product. The result is shown in figure 3, the transpiration rate of the transgenic plant is 2.2, which is reduced by 26% compared with the control plant; the stomatal conductance of the transgenic plant is 0.06, which is reduced by 32% compared with that of the control plant, and the water loss speed of the transgenic plant in a transpiration mode is obviously reduced compared with that of the control plant.

Example 5 drought induced CIPK9 Gene expression

A B73 corn plant in the three-leaf one-heart period is taken and exposed in the air for drought treatment for 3 hours, total RNA under the conditions of normal growth and drought treatment is respectively extracted, cDNA is reversely transcribed, and the expression condition of the CIPK9 gene is detected by taking the cDNA as a template. The results are shown in FIG. 4, and the expression level of CIPK9 gene was about 2.7 times that of the gene which was not drought-induced after 3 hours of drought induction, indicating that the gene plays an important role in the drought stress response process.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in China

<120> CIPK9 protein and application of coding gene thereof in drought resistance of plants

<130>KHP181113385.1

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>445

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ala Glu Pro Ala Ala Ala Gly Arg Lys Thr Arg Val Gly Pro Tyr

1 5 10 15

Glu Val Gly Lys Thr Ile Gly Glu Gly Ser Phe Ala Lys Val Lys His

20 25 30

Ala His Asp Ser Arg Thr Gly Ala Val Arg Ala Ile Lys Val Leu Asp

35 40 45

Arg Ser His Val Leu Arg His Lys Met Val Glu Gln Ile Lys Arg Glu

50 55 60

Ile Ser Thr Leu Lys Leu Ile Lys His Pro Asn Val Val Gln Leu His

65 7075 80

Glu Val Met Ala Ser Arg Thr Lys Ile Tyr Met Val Leu Glu Phe Val

85 90 95

Asp Gly Gly Glu Leu Phe Asp Lys Ile Val Asn Ser Gly Arg Leu Gly

100 105 110

Glu Asp Glu Ala Arg Ile Tyr Phe His Gln Leu Ile Asn Ala Val Asp

115 120 125

Tyr Cys His Ser Arg Gly Val Tyr His Arg Asp Leu Lys Pro Glu Asn

130 135 140

Leu Leu Leu Asp Ser His Gly Thr Leu Lys Val Ser Asp Phe Gly Leu

145 150 155 160

Ser Ala Phe Ala Pro Gln Thr Lys Glu Asp Gly Leu Leu His Thr Ala

165 170 175

Cys Gly Thr Pro Asn Tyr Val Ala Pro Glu Val Leu Ala Asp Lys Gly

180 185 190

Tyr Asp Gly Met Ala Ala Asp Val Trp Ser Cys Gly Ile Ile Leu Phe

195 200 205

Val Leu Met Ala Gly Tyr Leu Pro Phe Asp Asp Ala Asn Leu Met Arg

210 215 220

Leu Tyr Lys Leu Ile Cys His Ala Thr Phe Ser Cys Pro Pro Trp Phe

225 230235 240

Ser Ser Gly Ala Arg Lys Phe Ile Lys Arg Ile Leu Asp Pro Asn Pro

245 250 255

Asp Thr Arg Ile Lys Ile Ala Glu Ile Leu Glu Asp Glu Trp Phe Lys

260 265 270

Lys Gly Tyr Lys Pro Pro His Phe Glu Gln Gly Glu Asp Val Asn Leu

275 280 285

Asp Asp Val Asp Ala Ala Phe Asn Asp Ser Glu Asp Arg Leu Val Ala

290 295 300

Glu Lys Arg Glu Lys Pro Glu Ser Met Asn Ala Phe Ala Leu Ile Ser

305 310 315 320

Arg Ser Gln Gly Phe Asn Leu Gly Asn Leu Phe Glu Lys Glu Met Met

325 330 335

Gly Met Val Lys Arg Glu Thr Ser Phe Thr Ser Gln Cys Thr Ala Gln

340 345 350

Glu Ile Met Ser Lys Ile Glu Asp Ala Cys Gly Pro Leu Gly Phe Asn

355 360 365

Val Arg Lys Gln Asn Tyr Lys Met Lys Leu Lys Gly Asp Lys Ser Gly

370 375 380

Arg Lys Gly His Leu Ser Val Ala Thr Glu Val Phe Glu Val Ala Pro

385 390395 400

Ser Leu His Met Val Glu Leu Arg Lys Thr Gly Gly Asp Thr Leu Glu

405 410 415

Phe His Asn Phe Tyr Lys Asn Phe Ser Ser Glu Leu Lys Asp Ile Val

420 425 430

Trp Lys Ala Glu Ser Asp Ala Ser Met Lys Gln Thr Lys

435 440 445

<210>2

<211>4685

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ataaagccgc aggcgcgcgg agcggaggtc gcgagagcaa aattcactgc tccctgcccg 60

tcgaaccagc cgagcaagcc aacgcaaacc cagcgagccg cggcacctcg tcgcgcgcgc 120

cttgcctgtc cgcttcttcg tccgatcgtc cgccggtccg agccgagccc cccgaagtat 180

ggcggagccc gcggcggcgg ggaggaagac gcgggtgggg ccgtacgagg tcggcaagac 240

catcggggag ggcagcttcg ccaaggtgaa gcacgcccac gactcccgca cgggcgccgt 300

ccgcgctatc aaggtgctcg accgcagcca cgttctccgc cacaagatgg tcgagcaggt 360

ccatccctct cctcgctccg tgcctggaat ccttcccccc tttctctccc cttcgcagac 420

cgctggaatc aatttagcct cgggggaatt taaaaatcct ggagctgcca caggaagatc 480

tctctgtaat ttataatttg ttcgcatgtc agtcacgtgt gatggtcgaa gaatatcctt 540

tgacgtctct gtcgtggccg agaggattgt ctgtgacgag acatcatgcg tctgatcgag 600

tgcccagctt tgcttaagct tttgattggt gtggagaatt agataggatg ggacggggcg 660

aagctaggat ctgaaattag gggaccaaat tggggtctgt tagaagcatt tttttatcat 720

ttacatgaga attagctaaa gaaactaaca gtccctatag aattagggga gtattagggg 780

ggacattggc ccctgtgccc cccccccccc ccccctccct gcggtcgccc ctgcccacaa 840

ggaagaacta tacgctccca gtgttccttt ttttagattg agattgaaga catggagtaa 900

tgaagatcgg gttaatattt tccgatgcaa ttttactgaa tgaacaaaaa tctcttcatc 960

gacccatcct catttcttta gacattgaag acagggaata ttgaagagct aattccaata 1020

caatcttcat caacccttcc tcattttttt ttaagattga agacagggag agtattgaag 1080

agctaatatt tcccaataca gtttactgaa tgagagaaaa aaaccctctt tatcagccct 1140

taatttgtgt ggtgaaatat caatatgcta acattagatg tctgctgtca agttgcttca 1200

acagttccat ttactgttta gcctcacttt ggaaagtgaa tgcacctctt cttgttcttc 1260

cagatcaaac gggagatttc gactttgaag ctaatcaaac atcccaacgt ggttcagctg 1320

catgaggtat aatatttttg tgagacgtga tgatgcatgt ttcattaact tttgatgatt 1380

ccatcatttt gtgtgcattt gataggttat ggcgagtagg acgaagatat acatggttct 1440

tgaatttgtt gatggaggcg agttattcga taagatcgta aggctctcaa aactttcagt 1500

gggtcatatt gttactcttt tacttttgta cattgctttt aacatgtcgt gggcttagtt 1560

ttttagaccc tggcatatat ttagatagtt ggggccttat tatttaggtg ttaggttcat 1620

atgaatgtta ccaattaact catttatcac atggtcttga taattattca ggtcaattct 1680

ggaaggctag gagaggatga agctaggata tactttcatc aacttataaa tgcggttgat 1740

tattgtcata gccgaggagt gtaccataga gatctgaagg tttgcccaat tatccttctt 1800

tctttctcat gtgtcagtct taactatgaa tgctgtggtg cacacttttt aactcgtgcc 1860

atgtatgcct tttgcagcca gagaatctac ttctggactc acatggaacc cttaaagttt 1920

cagactttgg cctaagtgca tttgcaccac aaacaaaagt atgatctcta gtcagtagct 1980

agaagcatga attttgtgtg ttcattagac aagctctttt ctttctattt gaagctgatg 2040

tgtcttatgt tttattacat cattgaatta acttgctacc ttttaaagca gacgtataat 2100

gtattcctca gttgtgtttg tgtttggaga catggaaagg tgataagaat ttccattaac 2160

tcttctgagt ttttgtcagg aggatgggct tctgcatact gcctgtggaa ctccaaacta 2220

tgtagcgcct gaggtgagtt tctcacctct cctcagttgt cagcttattt gtgttgttac 2280

cttatgtgat taatgtactt caagatgtgt aagtatcgca cacttcctgc aggtgctcgc 2340

tgataaaggc tatgatggta tggctgcaga tgtatggtcc tgtggcataa tcttgtttgt 2400

tcttatggcc ggatacttac ccttcgatga tgccaatctg atgagactgt acaaactggt 2460

aaattcggtt aatacactta tatattggtt tccctatgaa atacaagggt aattttgatg 2520

aacttttctt tgacttcctt ttgtagatct gccatgcaac tttttcttgc ccaccatggt 2580

tttcttctgg agcaaggaag tttattaagc gcattctcga tcctaaccct gataccgtaa 2640

gttcgaacta agacgtgcct tttcattatc tgtctcatct cattcattta tctgttgtat 2700

tgttgtcacc agattacaac cagtgtcact gttatcactg ttggataaat gggtgctgta 2760

ttcttgcaga ggataaaaat tgcagaaatt ttggaagatg aatggttcaa aaaaggctat 2820

aaaccaccac attttgaaca aggcgaagat gttaaccttg acgacgttga tgctgcattc 2880

aatgattcag aggtattata tagaccaaat gttcattttg aatctacgac tatcttgaaa 2940

atctttccag ctttccagaa atattacgtg ctttaaaagc atttttacat tctattttat 3000

gttcacatta tcgttcaggt tcatagctgc tataatatga acttttttgt ttcttctttt 3060

ttggaaggcc aggttgagaa attctaagga cttgatgaca caatagattt cttgttcttt 3120

ttatggctac tcaaatgtct cattgttttt atagtgtata taggattccc ttgaatatct 3180

gattggtgaa cattgcagtt aaccgataat taattgtaac atacatgact ccagttaatc 3240

ggtcaccttt caatttttac attttaggac cgtcttgtag cagagaaaag agaaaagcca 3300

gaatcaatga atgcatttgc tcttatttcg aggtcacagg gcttcaacct tggaaatttg 3360

tttgagaagg agatgatggt aaatttctca tagctttgaa tctattatgt catgtttgga 3420

atgtagtaaa gattagttac aattatattg gaggaaagtc tggtctctgg cgttgattgc 3480

ccacttctgt aaatctcagt cttggtcagg gaacaaaatg agtactttcg ctgcaaattt 3540

ttcttgattt cttgctaatg catgcctttc ctgaataggg aatggtaaag agggaaacat 3600

ctttcacgtc tcaatgtaca gcacaggaga tcatgtcaaa aatagaggat gcatgtgggc 3660

cacttggttt caacgtgcgg aaacaaaatt acaaggtgtg tgacatttac tatcattggc 3720

tagtgatgtg tggtctaact ggtttcttga gaatttgcat tataattata taacattaac 3780

gattcacatg aacctttatt tgatcctcca gatgaaattg aaaggtgaca aatccggaag 3840

aaaaggccac ttatctgttg caactgaggt actggcacta ctcccagaat tacaacattg 3900

gatttatatt ctagtttgtt ttagcccgcg ttagctgctg ttttaagaag taaagaaagc 3960

aaggttgagc acaccgataa aaaaacacac actattaaat cattctcttg tatgaactct 4020

taccttacat atgtatccat attttactca tttgtaggtt tttgaggttg ctccttcact 4080

tcacatggtt gagcttcgta aaaccggagg agacacattg gaattccaca atgtacgttt 4140

tcagaaataa gttttttttt tccaaatatg tgtgtttcca aataactagc gtgatctcat 4200

gggaattgca tgcagttcta caagaatttc tcatcagagc tgaaagatat cgtgtggaaa 4260

gctgaatctg atgcaagtat gaaacagacg aagtgacacc cagggaatct gtgtaactta 4320

tgatgtcaca ttgtgagata gaccaccacc tcgggtgata ccgcttgttt ggtactgtat 4380

gtttttttta ctggtaccac attggcaatc aatctcgtgt acagagctcc ttctgaatga 4440

gcgcagctgt acacgagaca tgaagaggcc ctccctgaga tgctccaaac gttgcaatgg 4500

aactaaaaat ttgtataaat gggtccttgg cgtcctacca atcgggcctg ctgcaggggc 4560

aaccactagc ggaggagcgg caggtcccct tctctattgt atagagcacc gactttctgt 4620

agtttctact gttgtcactt ttacaaaaac aaattttttt tctaatcgac cacggtcaag 4680

cttcc 4685

<210>3

<211>1338

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atggcggagc ccgcggcggc ggggaggaag acgcgggtgg ggccgtacga ggtcggcaag 60

accatcgggg agggcagctt cgccaaggtg aagcacgccc acgactcccg cacgggcgcc 120

gtccgcgcta tcaaggtgct cgaccgcagc cacgttctcc gccacaagat ggtcgagcag 180

atcaaacggg agatttcgac tttgaagcta atcaaacatc ccaacgtggt tcagctgcat 240

gaggttatgg cgagtaggac gaagatatac atggttcttg aatttgttga tggaggcgag 300

ttattcgata agatcgtcaa ttctggaagg ctaggagagg atgaagctag gatatacttt 360

catcaactta taaatgcggt tgattattgt catagccgag gagtgtacca tagagatctg 420

aagccagaga atctacttct ggactcacat ggaaccctta aagtttcaga ctttggccta 480

agtgcatttg caccacaaac aaaagaggat gggcttctgc atactgcctg tggaactcca 540

aactatgtag cgcctgaggt gctcgctgat aaaggctatg atggtatggc tgcagatgta 600

tggtcctgtg gcataatctt gtttgttctt atggccggat acttaccctt cgatgatgcc 660

aatctgatga gactgtacaa actgatctgc catgcaactt tttcttgccc accatggttt 720

tcttctggag caaggaagtt tattaagcgc attctcgatc ctaaccctga taccaggata 780

aaaattgcag aaattttgga agatgaatgg ttcaaaaaag gctataaacc accacatttt 840

gaacaaggcg aagatgttaa ccttgacgac gttgatgctg cattcaatga ttcagaggac 900

cgtcttgtag cagagaaaag agaaaagcca gaatcaatga atgcatttgc tcttatttcg 960

aggtcacagg gcttcaacct tggaaatttg tttgagaagg agatgatggg aatggtaaag 1020

agggaaacat ctttcacgtc tcaatgtaca gcacaggaga tcatgtcaaa aatagaggat 1080

gcatgtgggc cacttggttt caacgtgcgg aaacaaaatt acaagatgaa attgaaaggt 1140

gacaaatccg gaagaaaagg ccacttatct gttgcaactg aggtttttga ggttgctcct 1200

tcacttcaca tggttgagct tcgtaaaacc ggaggagaca cattggaatt ccacaatttc 1260

tacaagaatt tctcatcaga gctgaaagat atcgtgtgga aagctgaatc tgatgcaagt 1320

atgaaacaga cgaagtga 1338

<210>4

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgggatccat ggcggagccc gc 22

<210>5

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccgctcgagc ttcgtctgtt tcatacttgc atc 33

<210>6

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ttttagccct gccttcatac gc 22

<210>7

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

agaccggcaa caggattcaa tc 22

Claims

The application of CIPK9 in improving the drought resistance and/or the water utilization rate of plants.
Use of CIPK9 for increasing plant yield.
Application of CIPK9 in breeding transgenic plants with improved drought resistance and/or improved yield.
4. The use according to any one of claims 1 to 3, wherein the CIPK9 has the amino acid sequence of any one of:

(1) an amino acid sequence shown as SEQ ID NO. 1;

(2) the amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1.
Application of CIPK9 gene or expression cassette or vector or host cell containing CIPK9 gene in improving plant drought resistance and/or breeding transgenic plants with improved drought resistance.
6. The use according to claim 5, wherein the CIPK9 gene has the nucleotide sequence of any one of:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

(2) the nucleotide sequence shown in SEQ ID NO.2 is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence to obtain a coding nucleotide sequence of the protein with the same function;

(3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.2 under strict conditions.
7. A method for producing a transgenic plant, characterized by increasing the expression level of CIPK9 gene to obtain a plant having improved drought resistance and/or improved yield.
8. The method according to claim 7, wherein the increase in the expression level of CIPK9 gene is achieved by transforming a vector overexpressing CIPK9 gene.
9. The use according to any one of claims 1 to 6, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.