CN110684681B - Engineering bacterium for producing chicken alpha-interferon and application thereof - Google Patents
Engineering bacterium for producing chicken alpha-interferon and application thereof Download PDFInfo
- Publication number
- CN110684681B CN110684681B CN201911058648.3A CN201911058648A CN110684681B CN 110684681 B CN110684681 B CN 110684681B CN 201911058648 A CN201911058648 A CN 201911058648A CN 110684681 B CN110684681 B CN 110684681B
- Authority
- CN
- China
- Prior art keywords
- interferon
- chicken
- alpha
- chicken alpha
- producing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/21—Interferons [IFN]
- A61K38/212—IFN-alpha
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Wood Science & Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Pulmonology (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Communicable Diseases (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to fermentation production of chicken interferon, in particular to an engineering bacterium for producing chicken alpha-interferon and application thereof. The engineering bacteria contain a gene which has a nucleotide sequence shown as SEQ ID NO.1 and codes chicken alpha-interferon, and the preservation number is CCTCC M2019748. The engineering bacteria of the invention are used for fermentation production, and the yield of the recombinant chicken alpha-interferon can reach 11.09g/L without changing the fermentation process, and is improved by 28 times on the original basis.
Description
Technical Field
The invention relates to fermentation production of chicken interferon, in particular to an engineering bacterium for producing chicken alpha-interferon and application thereof.
Background
China is a big world chicken-raising country, 39 hundred million chickens are listed in 2018, the loss caused by virus infection every year cannot be estimated, and a new efficient, safe and toxic-side-effect-free product for preventing and treating chicken viral diseases is urgently needed. At present, colibacillus and pichia pastoris are used for successfully expressing recombinant interferon, but no recombinant chicken interferon in China obtains a new veterinary drug certificate so far, and no imported recombinant chicken interferon obtains an imported registration certificate.
When the recombinant chicken alpha-interferon is secreted and expressed by host bacteria, the problems of incomplete signal peptide excision, uneven expression of secreted products, degradation of expression products during high-density fermentation, large glycosylation degree, high mannose glycosylation and the like often occur, so that the yield of the recombinant chicken alpha-interferon is low and the production cost is high. Therefore, it is necessary to screen new recombinant chicken alpha-interferon high-producing strains, so as to reduce the production cost and reduce the loss of chicken breeding caused by viral diseases.
Disclosure of Invention
In order to solve the problems of low yield and high production cost of the recombinant chicken alpha-interferon produced by a microbial fermentation method, the invention tries to use various strategies (including codon and signal peptide optimization) to finally obtain a high-yield recombinant chicken alpha-interferon pichia pastoris, thereby laying a foundation for large-scale industrial production of the recombinant chicken alpha-interferon.
The technical scheme of the invention is as follows:
an engineering bacterium for producing chicken alpha-interferon, which is characterized in that: the preservation number is CCTCC M2019748; the engineering bacteria contain a gene which has a nucleotide sequence shown as SEQ ID NO.1 and codes chicken alpha-interferon.
The application of the engineering bacteria for producing chicken alpha-interferon in preparing products for treating chicken viral diseases.
A microbial inoculum, which is characterized in that: comprises the engineering bacteria for producing the chicken alpha-interferon.
The application of the microbial inoculum in preparing products for treating chicken viral diseases.
In some embodiments, the chicken viral disease comprises infectious bronchitis, infectious bursal disease, and infectious laryngotracheitis of chicken.
A gene encoding chicken interferon-alpha characterized by: the nucleotide sequence is shown in SEQ ID NO. 1.
An expression cassette, characterized in that: comprises the above gene.
A vector, characterized by: comprising the above-mentioned gene or expression cassette.
A recombinant cell, wherein: comprising the above-mentioned gene or expression cassette or vector.
A method for producing chicken alpha-interferon is characterized by comprising the following steps: culturing the above engineering bacteria or recombinant cells for producing chicken alpha-interferon, and inducing the production of chicken alpha-interferon.
The method finds the red chicken alpha-interferon protein on an NCBI website (https:// www.ncbi.nlm.nih.gov /), deletes the original signal peptide of the red chicken alpha-interferon, carries out statistical analysis on the amino acid with degenerate codons, and selects the codon with high use frequency to obtain a new recombinant chicken alpha-interferon gene sequence. The new recombinant chicken alpha-interferon gene is obtained through gene synthesis, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1. The gene is inserted into a secretory multicopy pPICZaA expression vector and is transfected into pichia pastoris, and a high-concentration bleomycin-containing flat plate is adopted for screening to obtain the pichia pastoris with obviously improved recombinant chicken alpha-interferon secretion capacity.
The screened pichia pastoris is applied to the microbial fermentation production of the recombinant chicken alpha-interferon, the capability of producing the recombinant chicken alpha-interferon by the microbial fermentation method can be improved by 28 times on the original basis under the conditions of not changing the production process, the process steps and the culture conditions, the yield of the recombinant chicken alpha-interferon reaches 11.09g/L, and the pichia pastoris is suitable for large-scale industrial production of the recombinant chicken alpha-interferon and has high application value and industrial practicability.
The engineering bacteria for producing chicken alpha-interferon provided by the invention are subjected to patent preservation, and the preservation information is as follows:
the preservation name: pichia pastoris X33/ChIFN-alpha
And (3) classification and naming: pichia sp.X33/ChIFN-alpha
The preservation date is as follows: 9/25/2019
The preservation number is: CCTCC M2019748
The preservation unit: china center for type culture Collection
The address of the depository: china center for type culture Collection, taiwan university, eight Wuhan universities in flood and mountain areas, wuhan city, hubei province, zip code: 430072, E-mail cctcc@whu.edu.cn.
Drawings
FIG. 1.PPICZ α A-chicken α interferon plasmid map;
FIG. 2 shows an electrophoretogram of Pichia pastoris screened for containing the chicken interferon-alpha target gene of the invention.
Detailed Description
The present invention is described in detail below with reference to examples, it being understood that the following examples are only illustrative and illustrative of the present invention and do not limit the scope of the present invention in any way.
Experimental reagent:
DNA purification recovery kit, 2 XPCR Master Mix, restriction enzymes EcoR I and Not I, 10 XPuffer, T4-DNA ligase, D-sorbitol, yeast extract, yeast powder, tryptone, peptone, YNB, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, biotin, bleomycin, glycerol, sodium chloride, ammonium sulfate, glucose were purchased from Biotechnology engineering (Shanghai) GmbH;
pPICZ α a plasmid: purchased from Shanghai Xinyu Biotechnology, inc., under item number XY0216;
DH5 α competent cells: purchased from Invitrogen, cat No. 18265017;
x-33 Yeast competent cells: purchased from Invitrogen, cat # C18000;
cytolytic enzymes: purchased from sigma corporation, usa;
plasmid extraction and purification kit: purchased from Qiagen corporation;
chicken interferon-alpha quantitative determination reagent kit: purchased from Jiangsu Kejing Biotech, inc.;
methanol: purchased from Qingdao Jinpeng chemical Co., ltd;
biotin solution: 0.04g of biotin was weighed, dissolved in 100mL of single distilled water, and sterile-filtered through a cellulose filter with a pore size of 0.22 μm.
Culture medium:
LB Medium
Each 100ml of LB medium contained: 1g tryptone, 0.5g yeast extract, 1g sodium chloride, pH 7.4.
The preparation method comprises the following steps: at 950ml ddH 2 Dissolving 10g tryptone, 5g yeast extract, 10g sodium chloride in O, adjusting pH to 7.4 with NaOH, and ddH 2 And O is metered to 1L. If a solid medium is prepared, 15g of agar per liter are added. Sterilizing with high pressure steam at 121 deg.C for 20min.
YPD medium
The formula is as follows: yeast cream: peptone: glucose = 1.
The preparation method comprises the following steps: dissolving 10g of yeast extract, 20g of peptone in 900ml of ddH 2 In O, 20g of agar is added if plate making is required; sterilizing with high pressure steam at 121 deg.C for 20min; after cooling, 100ml of a separately sterilized (autoclaved at 115 ℃ C. For 15 min) glucose solution (containing 20g of glucose) was added.
BMGY medium
Per 100ml of BMGY medium contained: 1g of yeast powder, 2g of tryptone, 1ml of glycerol, 0.34g of YNB (ammonium sulfate and amino acid excluded), 1g of ammonium sulfate, 1.0941g of KH 2 PO 4 、0.4473g K 2 HPO 4 ·3H 2 O, 0.1ml of 0.4mg/ml biotin solution.
The preparation method of the 100LBMGY culture medium comprises the following steps: in ddH 2 Adding 1000g yeast powder, 2000g tryptone, 1L glycerol, 340gYNB (without ammonium sulfate and amino acid), 1000g ammonium sulfate, KH 2 PO 4 1094.1g，K 2 HPO 4 ·3H 2 Heating and stirring O447.3 g to dissolve, fixing the volume to 99900ml, and then sterilizing with high-pressure steam at 121 ℃ for 20min; cooling to room temperature, adding 100ml of sterilized biotin solution, mixing, and packaging in sterile container.
BMMY medium
Per 100ml of BMMY medium: 1g of yeast powder, 2g of tryptone, 0.5ml of methanol, 0.34g of YNB (ammonium sulfate and amino acid are not contained), 1g of ammonium sulfate,1.0941g KH 2 PO 4 、0.4473g K 2 HPO 4 ·3H 2 O, 0.1ml of 0.4mg/ml biotin solution.
The preparation method of the 1000LBMMY culture medium comprises the following steps: in ddH 2 Adding yeast powder 10000g, tryptone 20000g, methanol 5L, YNB 3400g (without ammonium sulfate and amino acid), ammonium sulfate 10000g, and KH 2 PO 4 10941g，K 2 HPO 4 ·3H 2 Heating, stirring and dissolving O4473 g, fixing the volume to 999900ml, and then sterilizing for 20min by high-pressure steam at 121 ℃; cooling to room temperature, adding 1L biotin solution sterilized separately, mixing, and packaging in sterile container.
The experimental reagents which are not particularly described in the invention are all conventional reagents in the field, and can be prepared according to the conventional method in the field or obtained commercially; the experimental methods not specifically described are conventional in the art and may be referred to, for example, in the Molecular cloning handbook (Sambrook J & Russell DW, molecular cloning: a laboratory Manual, 2001), or the manufacturer's instructions.
Example 1 construction of the engineered bacterium for producing recombinant Chicken interferon-alpha of the present invention
The original gene sequence (SEQ ID NO. 3) of the erythro-chicken alpha-interferon is found out on NCBI, the original signal peptide of the erythro-chicken alpha-interferon is deleted, the amino acid with degenerate codons is statistically analyzed, the codon with high use frequency is selected to obtain a new recombinant chicken alpha-interferon gene sequence (SEQ ID NO. 1), and the target gene is obtained by carrying out whole-gene synthesis by the committee of biotechnology (Shanghai) limited company.
Designing a primer, and adding an EcoR I enzyme cutting site to the 5 'end of the target gene and an Not I enzyme cutting site to the 3' end of the target gene through PCR reaction. After the PCR product was electrophoresed through 1.5% agarose gel, a 513bp fragment was recovered by using a DNA purification recovery kit, and the DNA sequence of the fragment is shown in SEQ ID NO.2.
The nucleotide sequences of the primers are as follows:
forward primer F1 (5 '-3'): GGAATTCCATGTGTAACCACTT;
reverse primer R1 (5 '-3'): ATTTGCGGCCGCTTTAAGTTCTAGTG.
The above PCR reaction system (25. Mu.l): 2 XPCR Master Mix 10. Mu.l, forward primer 200nM, reverse primer 200nM, target gene template 1. Mu.l, residual volume in ddH 2 And (4) complementing O.
The above PCR reaction procedure: pre-denaturation at 95 ℃ for 5min,1 cycle; denaturation at 95 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 72 ℃ for 30s,40 cycles; final extension 72 ℃ for 5min,1 cycle.
The PCR product was digested with EcoR I and Not I for 20min at 37 ℃.
The 100. Mu.l enzyme system is: 10 × buffer:10 mu l of the mixture; 6 mu g of DNA; ecoR I enzyme: 3 mu l of the solution; notI enzyme: 3 mu l of the solution; deionized water to make up the volume.
After the enzyme digestion product is electrophoresed through 1.5% agarose gel, fragments are recovered by a DNA purification recovery kit, and a linearized target gene fragment is obtained.
The expression vector pPICZ alpha A plasmid is treated by two enzyme digestion of EcoR I and Not I, and the enzyme digestion system and conditions are the same as those in the step 1. After the enzyme digestion product was electrophoresed through 1.5% agarose gel, a 3.6kp fragment was recovered using a DNA purification recovery kit to obtain a linearized plasmid fragment.
And (2) uniformly mixing the target gene fragment obtained in the step (1) with the linearized plasmid fragment according to the proportion of 1pmol to 10pmol, adding 5 mu LT4-DNA ligase, and connecting at 25 ℃ for 15min to obtain a connecting product, namely a recon (pPICZ alpha A-chicken alpha interferon).
10 parts of pPICZ alpha A-chicken alpha interferon plasmid is sequenced by the committee bioengineering (Shanghai) company Limited, and the plasmid with correct sequencing is reserved.
(1) Electric conversion
Transforming X-33 yeast competent cells by electric shock with pPICZ alpha A-chicken alpha interferon plasmid screened in the step 2, which comprises the following specific operation steps:
pPICZ alpha A-chicken alpha interferon plasmid 10u L into 80 u LX-33 yeast competent cell, gently mixing, adding into ice precooling 5min 0.2cm quartz electric transformation cup. The electric conversion cup is cleaned and soaked in 70% ethanol in advance before use, and is placed under an ultraviolet lamp for sterilization for half an hour. Wiping water on the outer wall of a quartz electric conversion cup, putting the quartz electric conversion cup into a groove of a BioRad GenePulse electric converter to shock under the conditions of 1.5kV, 25 muF, 200 omega and 0 ℃, immediately adding 1mL of D-sorbitol precooled for 30min at 4 ℃ after conversion, and uniformly mixing. And (3) placing the electric conversion cup in a 30 ℃ incubator for incubation for 1-2h to obtain an electric conversion product. And uniformly coating 150 mu L of the electrotransformation product on a YPD selection plate culture medium containing 100 mu g/ml bleomycin, observing the growth of a transformant, and culturing at 30 ℃ for 3-5 days to obtain the engineering bacteria for producing the chicken alpha interferon.
(2) Screening for Positive strains
Screening positive strains, and specifically comprising the following steps: randomly selecting a single colony with good growth vigor in the YPD plate at normal temperature, picking the single colony by using a sterilized toothpick or a sterilized gun head, and lightly dotting the single colony on the YPD plate containing 100 mu g/ml of bleomycin to make a copy; then, the toothpick or the tip with the adhered bacteria was placed in a corresponding 10. Mu.l sterile deionized water EP tube, 5. Mu.l (5 u/. Mu.l) of cytolytic enzyme (purchased from Sigma, USA) was added, water bath was carried out at 37 ℃ for half an hour, standing was carried out at-80 ℃ for 15 minutes, boiling was carried out in boiling water for 5 minutes, centrifugation was carried out at 12000RPM for 5 minutes, and 0.5-1. Mu.l of the supernatant was taken as a template and added to 25. Mu.l of the PCR reaction system.
The nucleotide sequence of the PCR primer is:
forward primer F1 (5 '-3'): GGAATTCCATGTGTAACCACTT;
reverse primer R1 (5 '-3'): ATTTGCGGCCGCTTTAAGTTCTAGTG.
The above PCR reaction system (25. Mu.l): 2 XPCR Master Mix 10. Mu.l, forward primer 200nM, reverse primer 200nM, template 1. Mu.l, residual volume in ddH 2 And O is complemented.
The above PCR reaction procedure: pre-denaturation at 95 ℃ for 5min,1 cycle; denaturation at 95 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 72 ℃ for 30s,40 cycles; final extension 72 ℃ for 5min,1 cycle.
After the PCR reaction, 10. Mu.L of the amplified product is subjected to 1.5% agarose gel electrophoresis, observed in a gel phase system and recorded by photographing, and an obvious band is formed at the position of 513bp, so that the constructed Pichia pastoris contains the target gene and is a positive clone (figure 2).
(3) Screening of multicopy strains
The single colony of the positive clone is streaked and inoculated to a bleomycin YPD solid culture medium containing 300 mug/ml, 600 mug/ml and 900 mug/ml in sequence, and a stable multi-copy high-yield strain is screened out. The method comprises the following specific steps:
single colonies of positive clones on YPD plates containing 100. Mu.g/ml of bleomycin were inoculated onto YPD selective plate medium containing 300. Mu.g/ml of bleomycin by a "three-step streaking method", and the colonies were observed after culturing at 30 ℃ for 3-5 days.
Single colonies with good growth vigor on YPD plates containing 300 mu g/ml bleomycin are inoculated on YPD selective plate culture media containing 600 mu g/ml bleomycin by a three-step streaking method, and the colonies are observed after 3-5 days of culture at 30 ℃.
Single colonies with good growth vigor on YPD plates containing 600 mu g/ml bleomycin are inoculated on YPD selective plate culture media containing 900 mu g/ml bleomycin by a three-step streaking method, and the colonies are observed after 3-5 days of culture at 30 ℃. All single colonies on this plate were multicopy strains.
Example 2 construction of engineering bacteria Using a Primary Gene sequence of Redbye Chicken alpha-Interferon
Obtaining a primary gene of the red chicken alpha-interferon:
the original gene sequence (SEQ ID NO. 3) of the Hongyuan chicken alpha-interferon is subjected to whole-gene synthesis by the Token biological engineering (Shanghai) Co., ltd to obtain the original gene of the Hongyuan chicken alpha-interferon. The gene is amplified by adopting the following primers, and the 5 'end of the target gene is added with an EcoR I enzyme cutting site, the 3' end is added with a Not I enzyme cutting site through PCR reaction, and the enzyme cutting site is added to protect a base. The PCR product was subjected to 1.5% agarose gel electrophoresis, and a 606bp fragment was recovered by using a DNA purification recovery kit.
The nucleotide sequences of the primers are as follows:
forward primer F2 (5 '-3'): GGAATTCCATGGCTGTGCCTGCAAG;
reverse primer R2 (5 '-3'): ATTTGCGGCCGCTTTACTAAGTGCGCGTGTTGCC.
And (3) PCR system: 2 XPCR Master Mix 10. Mu.l, forward primer 200nM, reverse primer 200nM, template 1. Mu.l, residual volume in ddH 2 And (4) complementing O.
PCR procedure: pre-denaturation at 95 ℃ for 5min,1 cycle; denaturation at 95 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 72 ℃ for 30s,40 cycles; final extension 72 ℃ for 5min,1 cycle.
Construction of expression vector: the procedure is as in step 2 of example 1.
Obtaining of recombinant yeast: the procedure is as in step 3 of example 1.
Example 3. Comparison of the performance of the engineered bacteria of the present invention in producing chicken interferon-alpha with the existing engineered bacteria, high density fermentation was performed on the engineered bacteria obtained in example 1 (the engineered bacteria of the present invention) and the engineered bacteria obtained in example 2 (the existing engineered bacteria), respectively, by the following method:
(1) Picking single colony of multi-copy strain, inoculating into a 1L triangular flask filled with 250mL YPD liquid culture medium, placing in a shaking table, and culturing at 30 ℃ and 200rpm until OD600= 0.6-0.8; after microscopic examination, the seeds are used as first-class seeds for standby.
(2) Inoculating 1L of 4 bottles of primary seed solution into sterilized 100L BMGY fermentation medium, culturing with a fermentation seed tank, controlling ventilation at 5L/min, temperature at 30 ℃, rotation speed at 200rpm, and allowing OD600= 0.6-0.8, and performing microscopic examination without error to serve as secondary seeds for later use. This phase takes 24h.
(3) 100L of the prepared secondary seed liquid was pumped into 1 ton of BMMY liquid medium. The fermentation temperature is 30.5 ℃, the fermentation rotating speed is 200rpm, the fermentation air volume is 35NL/min, 0.5% (v/v) methanol is supplemented every 24h, and the fermentation time is 72h, so that the yeast recombinant chicken alpha interferon fermentation broth is obtained.
The chicken alpha-interferon concentration in the fermentation broth was measured with a chicken alpha-interferon quantitative detection kit (Jiangsu Kejing Biotech Co., ltd.) according to the instruction (sandwich ELISA).
The fermentation experiment of each strain is repeated for 3 times, the concentration of the chicken alpha interferon in 3 batches of obtained fermentation liquid is shown in table 1, the average concentration of the chicken alpha interferon produced by the engineering bacteria is (11.09 +/-0.07) g/L, and the average concentration of the chicken alpha interferon produced by the existing engineering bacteria is (0.40 +/-0.03) g/L. Therefore, the recombinant chicken alpha-interferon sequence modified by the invention improves the capability of producing the recombinant chicken alpha-interferon by a microbial fermentation method by 28 times on the original basis.
TABLE 1 ELISA test results of chicken alpha interferon concentration in 3 consecutive batches of fermentation broth
The engineering bacteria (strain 1) of the invention are delivered to China center for type culture collection for strain collection, and the collection number is CCTCC M2019748.
Example 4 production of Chicken alpha-Interferon Using optimized fermentation Process
1. Strain activation and screening
The strain CCTCC M2019748 is streaked and inoculated to a bleomycin YPD solid culture medium containing 300 mug/ml, 600 mug/ml and 900 mug/ml in sequence, and stable multi-copy high-yield strains are screened out. The method comprises the following specific steps:
screening for the first time: taking 0.8-1.2 g of recombinant pichia pastoris freeze-dried powder, dissolving in 1mL of sterile YPD liquid culture medium, taking bacterial liquid, streaking on a YPD plate culture medium containing 300 mu g/mL of bleomycin, and performing aseptic operation in the whole process; culturing the streaked culture medium in a constant-temperature incubator at 30 ℃ for 48h;
and (3) screening for the second time: picking single colony from the plate screened for the first time, and then streaking and culturing on YPD plate culture medium containing 600 mug/ml bleomycin, and performing aseptic operation in the whole process; culturing the streaked culture medium in a constant-temperature incubator at 30 ℃ for 48h;
and (3) third screening: picking single colony from the plate screened for the second time, and then streaking and culturing on YPD plate culture medium containing 900 mug/ml bleomycin, and performing aseptic operation in the whole process; the streaked culture medium is placed in a 30 ℃ constant temperature incubator for 48h.
2. First order seed culture
Picking single colony from YPD solid culture medium screened for the third time, inoculating into a 1L triangular flask containing 250mL YPD liquid culture medium, placing in a shaking table, and culturing at 30 ℃ and 200rpm until OD600= 0.6-0.8; after microscopic examination, the seed is used as a first-level seed liquid for standby.
3. Second stage seed culture
Inoculating 1L of 4 bottles of primary seed solution into a sterilized 100L BMGY fermentation culture medium, culturing by using a fermentation seed tank, controlling the ventilation amount at 5L/min, the temperature at 30 ℃, the rotating speed at 200rpm, and taking the seed solution as a secondary seed solution for later use when the OD600= 0.6-0.8 and the seed solution is checked to be correct. This stage takes 12 to 16 hours.
4. Fermentation culture
(1) Fast growth stage of thallus
The prepared 100L of secondary seed liquid was pumped into 1 ton BMMY liquid medium by a pump. The fermentation conditions were controlled at 200rpm, 30 deg.C, pH5.0, and 10L/min aeration. Sampling every 4h to determine the carbon source residue and the thallus concentration, measuring the light absorption value (OD 600) at 600nm by using a spectrophotometer at the initial stage, and measuring the wet weight as a reference at the later stage. During the fermentation period, the dissolved oxygen is kept above 30% by adjusting the rotating speed and the ventilation quantity. And (4) taking the increase of the value of the dissolved oxygen electrode to 100% as a mark to show that the initial carbon source is completely consumed, and then entering the phase of enrichment and induction of the thallus. This stage takes 12 to 16 hours.
(2) Enrichment and induction stages of thallus
Sorbitol solution with the concentration of 0.1g/mL is supplemented at a constant rate of 6-9 mL/h/L, methanol is supplemented at a constant rate of 2-3 mL/h/L, the fermentation condition is controlled at the rotation speed of 200rpm, the temperature of 28 ℃, the pH value of 5.0, and the Dissolved Oxygen (DO) is between 20 and 30 percent. Sampling every 6h for 1 time, measuring OD600, cell wet weight and cell dry weight, and analyzing the growth state of the yeast. When the wet weight of the thalli reaches more than 400g/L, sorbitol is stopped being supplemented, and the thalli induction stage is switched. This stage takes 6 to 8 hours.
(3) Induction stage of thallus
Methanol is supplemented at the rate of 9-12 mL/h/L, the fermentation condition is controlled at the rotating speed of 200rpm, the temperature of 28 ℃, the pH value of 6.0 and the DO between 20-30 percent. Maintaining fermentation for 42-44 h, and ending fermentation when the wet weight reaches more than 500g/L to obtain fermentation liquor.
Determination of chicken alpha-interferon concentration in fermentation liquor
The chicken alpha-interferon concentration in the fermentation broth was measured with a chicken alpha-interferon quantitative detection kit (Jiangsu Kejing Biotech Co., ltd.) according to the instruction (sandwich ELISA). The concentrations of chicken interferon-alpha in 3 consecutive batches of fermentation broths are shown in table 2:
TABLE 2 ELISA test results of chicken alpha-interferon concentration in 3 consecutive batches of fermentation broth
| Detecting | Batch | 1 | |
|
Mean value |
| Concentration (g/L) | 20.6 | 20.7 | 21.1 | 20.8±0.15 |
Activity determination of chicken alpha-interferon in fermentation liquor
Measuring the activity of interferon by cytopathy inhibition method, detecting the biological activity of interferon by MDBK/VSV system, and calculating the titer of sample by standard substance. The determination method is referred to the pharmacopoeia of the people's republic of China 2005 edition. The determination result is shown in table 3, the activity of the chicken alpha-interferon in the fermentation liquor produced by the invention reaches 1.23 multiplied by 10 6 The above.
TABLE 3 Activity of Chicken interferon-alpha in 3 consecutive batches of fermentation broths
| Detecting | Batch | 1 | |
|
Mean value |
| Activity (IU/mL) | 1.23×10 6 | 1.30×10 6 | 1.52×10 6 | 1.35×10 6 |
Sequence listing
<110> Shandong Xianpuai Ei science and technology Co., ltd
<120> engineering bacterium for producing chicken alpha-interferon and application thereof
<130> P190830-XPA
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 489
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgtgtaacc acttgagacc acaagacgct actttctctc acgactcttt gcaattgttg 60
agagacatgg ctccaacttt gccacaattg tgtccacaac acaacgcttc ttgttctttc 120
aacgacacta tcttggacac ttctaacact agacaagctg acaagactac tcacgacatc 180
ttgcaacact tgttcaagat cttgtcttct ccatctactc cagctcactg gaacgactct 240
caaagacaat ctttgttgaa cagaatccac agatacactc aacacttgga acaatgtttg 300
gactcttctg acactagatc tagaactaga tggccaagaa acttgcactt gactatcaag 360
aagcacttct cttgtttgca cactttcttg caagacaacg actactctgc ttgtgcttgg 420
gaacacgtta gattgcaagc tagagcttgg ttcttgcaca tccacaactt gactggtaac 480
actagaact 489
<210> 2
<211> 513
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggaattccat gtgtaaccac ttgagaccac aagacgctac tttctctcac gactctttgc 60
aattgttgag agacatggct ccaactttgc cacaattgtg tccacaacac aacgcttctt 120
gttctttcaa cgacactatc ttggacactt ctaacactag acaagctgac aagactactc 180
acgacatctt gcaacacttg ttcaagatct tgtcttctcc atctactcca gctcactgga 240
acgactctca aagacaatct ttgttgaaca gaatccacag atacactcaa cacttggaac 300
aatgtttgga ctcttctgac actagatcta gaactagatg gccaagaaac ttgcacttga 360
ctatcaagaa gcacttctct tgtttgcaca ctttcttgca agacaacgac tactctgctt 420
gtgcttggga acacgttaga ttgcaagcta gagcttggtt cttgcacatc cacaacttga 480
ctggtaacac tagaacttaa agcggccgca aat 513
<210> 3
<211> 582
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggctgtgc ctgcaagccc acagcaccca cgggggtacg gcatcctgct gctcacgctc 60
cttctgaaag ctctcgccac caccgcctcc gcctgcaacc accttcgccc ccaggatgcc 120
accttctctc acgacagcct ccagctcctc cgggacatgg ctcccacact accccagctg 180
tgcccacagc acaacgcgtc ttgctccttc aacgacacca tcctggacac cagcaacacc 240
cggcaagccg acaaaaccac ccacgacatc cttcagcacc tcttcaaaat cctcagcagc 300
cccagcactc cagcccactg gaacgacagc caacgccaaa gcctcctcaa ccggatccac 360
cgctacaccc agcacctcga gcaatgcttg gacagcagcg acacgcgctc ccggacgcga 420
tggcctcgca accttcacct caccatcaaa aaacacttca gctgcctcca caccttcctc 480
caagacaacg attacagcgc ctgcgcctgg gaacacgtcc gcctgcaagc tcgtgcctgg 540
ttcctgcaca tccacaacct cacaggcaac acgcgcactt ag 582
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggaattccat gtgtaaccac tt 22
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atttgcggcc gctttaagtt ctagtg 26
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggaattccat ggctgtgcct gcaag 25
<210> 7
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atttgcggcc gctttactaa gtgcgcgtgt tgcc 34
Claims (6)
1. An engineering bacterium for producing chicken alpha-interferon, which is characterized in that: the preservation number is CCTCC M2019748; the engineering bacteria contain a gene which has a nucleotide sequence shown as SEQ ID NO.1 and codes chicken alpha-interferon.
2. Use of the engineered chicken interferon-alpha producing bacteria of claim 1 in the preparation of products for treating chicken viral diseases.
3. A microbial inoculum, which is characterized in that: comprising the engineered bacterium of claim 1 for producing chicken interferon-alpha.
4. Use of the bacterial agent of claim 3 in the preparation of a product for treating chicken viral diseases.
5. Use according to claim 2 or 4, characterized in that: the chicken viral diseases comprise chicken infectious bronchitis, infectious bursal disease and infectious laryngotracheitis.
6. A method for producing chicken alpha-interferon is characterized by comprising the following steps: culturing the engineered chicken interferon-alpha producing bacterium of claim 1 to induce the production of chicken interferon-alpha.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911058648.3A CN110684681B (en) | 2019-11-01 | 2019-11-01 | Engineering bacterium for producing chicken alpha-interferon and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911058648.3A CN110684681B (en) | 2019-11-01 | 2019-11-01 | Engineering bacterium for producing chicken alpha-interferon and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110684681A CN110684681A (en) | 2020-01-14 |
| CN110684681B true CN110684681B (en) | 2022-11-11 |
Family
ID=69115294
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911058648.3A Active CN110684681B (en) | 2019-11-01 | 2019-11-01 | Engineering bacterium for producing chicken alpha-interferon and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110684681B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112175065A (en) * | 2020-10-10 | 2021-01-05 | 石家庄石牧药业有限公司 | New process for preparing recombinant chicken alpha interferon with strong activity and high expression quantity |
| CN117304344B (en) * | 2023-11-28 | 2024-03-29 | 山东仙普爱瑞科技股份有限公司 | Fusion protein, recombinant strain expressing fusion protein and application of recombinant strain |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338314A (en) * | 2008-06-16 | 2009-01-07 | 南京农业大学 | Recombined chicken alpha interferon gene and recombinant vector thereof |
| CN102321631A (en) * | 2011-08-30 | 2012-01-18 | 贵州大学 | Construction and application of artificially-synthesized chicken interferon gene sequence and recombinant engineering bacterium thereof |
-
2019
- 2019-11-01 CN CN201911058648.3A patent/CN110684681B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338314A (en) * | 2008-06-16 | 2009-01-07 | 南京农业大学 | Recombined chicken alpha interferon gene and recombinant vector thereof |
| CN102321631A (en) * | 2011-08-30 | 2012-01-18 | 贵州大学 | Construction and application of artificially-synthesized chicken interferon gene sequence and recombinant engineering bacterium thereof |
Non-Patent Citations (1)
| Title |
|---|
| 毕赤酵母高密度培养表达鸡α-干扰素的工艺研究;姜正军等;《生物技术通报》;20140626;第6卷;第116-117页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110684681A (en) | 2020-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110684681B (en) | Engineering bacterium for producing chicken alpha-interferon and application thereof | |
| CN107384897B (en) | Alkaline protease, gene and application thereof | |
| WO2022134236A1 (en) | Alkaline protease mutant, gene thereof, engineering bacteria thereof, preparation method therefor and use thereof | |
| CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| CN104524564A (en) | Crucian herpes virus disease compound vaccine preparation, preparation method and application | |
| CN113736750A (en) | Gata virus strain and application thereof | |
| CN110628852A (en) | Fermentation process of chicken alpha-interferon | |
| CN110713943B (en) | Engineering bacterium for producing porcine alpha-interferon and application thereof | |
| CN111363028B (en) | Recombinant human type I collagen, expression strain and construction method thereof | |
| CN110724720A (en) | Fermentation process of porcine alpha-interferon | |
| CN114774396B (en) | Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive | |
| CN110627893A (en) | Post-extraction process of chicken alpha-interferon | |
| CN109608535B (en) | Optimized chicken alpha interferon peptide chain and recombinant expression engineering strain thereof | |
| CN110606884A (en) | Post-extraction process of porcine alpha-interferon | |
| CN112522125B (en) | Hyaluronidase engineering bacterium and construction method and application thereof | |
| CN115029337A (en) | Additive compounded by keratinase mutant and eucommia ulmoides leaf extract and application thereof | |
| CN114213505B (en) | Adeno-associated virus mutant suitable for specifically infecting U87-MG cells | |
| CN116082494A (en) | Recombinant human III type collagen polypeptide, expression vector, expression strain and construction method thereof | |
| CN115074347A (en) | Feed additive containing keratinase mutant and bile acid and application thereof | |
| CN110551702B (en) | Recombinant aspergillus tubingensis tannase and expression and application thereof | |
| CN113304254A (en) | Cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine | |
| CN107245105B (en) | HN-VP233-221aa fusion protein and preparation method and application thereof | |
| CN113564091B (en) | Probiotics for reducing phosphorus, preparation method and application thereof | |
| CN111500607A (en) | Fusion gene for peri-implant anti-inflammation, exosome, biological coating, preparation method and application | |
| CN111394295B (en) | Preparation of immobilized arginine deiminase and production thereof 14/15 N]Method for producing L-citrulline |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |