CN110663504A

CN110663504A - Urban garden soil improvement method

Info

Publication number: CN110663504A
Application number: CN201911138847.5A
Authority: CN
Inventors: 周惠民; 何丽斯; 李畅; 苏家乐; 刘晓青; 肖政; 李晓英; 孙晓波; 陈尚平
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2019-11-20
Filing date: 2019-11-20
Publication date: 2020-01-10

Abstract

The invention provides a soil improvement method for urban gardens, which comprises the following steps: digging up soil with the thickness of 0-20cm on the surface soil of urban garden soil for more than two years in which the rhododendrons are continuously planted, adding biomass charcoal after the soil is mixed with river sand, fully and uniformly mixing the biomass charcoal, and then tamping the soil.

Description

Urban garden soil improvement method

Technical Field

The invention belongs to the technical field of soil improvement, and particularly relates to a method for improving urban garden soil by using biomass charcoal, in particular to a method for improving physicochemical properties and fertility of rhododendron planting soil and improving diversity of soil microbial communities by using biomass charcoal.

Background

Rhododendron (Rhododendron) is one of ten traditional famous flowers in China, and is also an important garden flower and tree and potted flower. Although China is the origin of rhododendron in the world and the modern distribution center and gathers about 70% of rhododendron species resources, the popularization and application of rhododendron are far weaker than those of European and American countries. The azalea is acid soil with poor drought resistance, loose property, good ventilation, high organic matter content and pH value of 4.5-6.5. Although azalea is widely planted in gardens and urban green lands, urban soil is frequently interfered by excavation, transportation, mixing with a large amount of industrial wastes and domestic garbage and the like, a natural soil generation layer is damaged, and the problems of soil degradation such as high pH, reduction of organic matters, nutrient imbalance, salinization, hardening and the like are caused, so that azalea is weakened in growth vigor and even killed greatly. In addition, a single soil fertilization mode and a large amount of chemical fertilizers are usually adopted in the cultivation process for repeated use, so that the fertilizer utilization rate is reduced, the nutrient loss is serious, and the non-point source pollution is aggravated; on the other hand, salt accumulation and enrichment of certain chemical elements cause single salt poisoning and antagonism, induce soil salinization and seriously damage the biological population and functional diversity of soil. Research results of Wei Ying (2016) show that at present, the root system of a seedling of rhododendron pulchrum cultivated in urban green land for many years is in a state of dysplasia, dark old roots are more, but fresh hair roots used for absorbing nutrients and water are less, and lack of hair roots causes weak plant growth. The growing of the rhododendron root system is inhibited by the continuously degenerated soil and the bad climate in the urban environment. At present, although a great deal of soil improvement documents exist, no description is given for the practical application of soil restoration and improvement of azalea field planting.

In recent years, a great deal of research reports are made on the influences of biomass charcoal on the restoration and improvement of farmland soil and the yield and quality of crops. Studies show that the application of biomass charcoal in agricultural fields can improve soil fertility, increase nitrogen utilization efficiency, improve soil phosphorus and potassium effectiveness, promote crop nutrient absorption and improve crop productivity under different soil conditions and different crop types (Liu et al, 2013; Lehmann and Joseph, 2015). Due to the large differences in properties such as nutrient content, adsorption capacity, etc. between different biochar types (Aller,2016), different biochar types can have large variability in the improving effect of biochar on crop yield and soil quality (Jeffery et al, 2011). However, the application research of biomass charcoal at present mainly focuses on improving farmland soil and guaranteeing the yield of economic crops, for example, patent document with application publication No. 106747789a, entitled "vinegar residue biomass charcoal compounded matrix", discloses a specific process for using vinegar residue biomass and strengthening pepper seedlings, a specific formula and a preparation process, and does not relate to the influence of biomass charcoal on the improvement of garden degraded soil and the growth of important urban greening plants.

The vinasse is a direct leftover in the brewing process, has low pH value, contains rich crude protein which is 2-3 times higher than the content of corn, also contains various trace elements, vitamins, saccharomycetes and the like, and has high content of lysine, methionine and tryptophan, which cannot be provided by using crop straws as a common raw material of biomass charcoal. In addition, the vinasse also contains quite abundant fermentation products such as alcohol ester and acid, and the like, has a stimulating effect on the growth of crops, and has high available nutrient content and long potential nutrient supply time. In addition, the biomass charcoal and the pyroligneous liquor generated in the carbonization process of the biomass charcoal have the main component of acetic acid, contain a small amount of ketones, phenols, esters and the like, and can effectively adjust the pH value of the soil, so the biomass charcoal is very suitable for repairing the garden degraded soil. However, in practice, no case and practical application of vinasse charcoal for garden soil restoration exist, no relevant documents or patents are disclosed, and at present, vinasse is generally used as feed directly or after being processed, and the application range is limited, so that the specific application of vinasse charcoal for garden soil restoration in cities is needed to be developed.

Disclosure of Invention

In order to solve the problems, the inventor fully researches the soil improvement requirement and the performance of the biomass charcoal through intensive research and a large number of experiments, particularly the degradation reason of the urban garden soil for cultivating rhododendron, the rhododendron cultivation soil requirement and the characteristics of vinasse charcoal, and provides the following technical scheme.

In one aspect of the present invention, there is provided an urban garden soil improvement method, comprising: digging up the soil with the thickness of 0-20cm, preferably 10cm, of the surface soil of the urban garden soil, mixing with river sand, adding biomass charcoal, mixing uniformly, and then flattening the soil.

Preferably, the biomass char is a distillers' grain-derived biomass char.

Preferably, the urban garden soil is urban garden soil with continuously planted rhododendron for more than two years.

More preferably, the urban garden soil is urban garden soil in which rhododendron is planted continuously for more than five years.

Furthermore, the volume ratio of the river sand to the garden soil is 1: 10.

Further, the content of the biomass charcoal is 1-10%, preferably 8% based on the total weight of the surface soil and the river sand after mixing.

Preferably, the biomass charcoal is a distillers 'grain-derived biomass charcoal, and more preferably, the biomass charcoal is a rice distillers' grain-derived biomass charcoal.

In the present invention, the biomass char may be prepared by a method comprising the steps of:

(1) airing waste vinasse in a wine making process;

(2) taking dried vinasse as a raw material, and carrying out thermal cracking carbonization for 1 hour at the high temperature of 450 ℃ under the condition of oxygen limitation to obtain vinasse carbide;

(3) diluting the pyroligneous liquor obtained in the vinasse carbonization process by 10 times, soaking the vinasse carbonized matter in the diluted pyroligneous liquor for at least 12 hours, filtering, and drying at the constant temperature of 75 ℃ to obtain a solid mixture;

(4) and (4) crushing the solid mixture in the step (3), sieving the crushed solid mixture with a sieve with the mesh number of 2mm to obtain the final biomass charcoal, and storing the biomass charcoal in a sealed bag.

The technical principle and the beneficial effects are as follows:

the inventor finds that the current research mostly focuses on crops with the period of 3-6 months, the growth period of the crops is short, and the rhizosphere effect of the biomass charcoal is not obvious. And the rhododendron is a perennial woody plant, the biomass charcoal can be adsorbed to the root system for a long time, and the root system effect of the biomass charcoal can be reflected more.

After the biomass charcoal is applied, the pH value of the soil is adjusted, the water-retaining property is improved, the salinity is reduced, the soil fertility is improved, the carbon metabolism efficiency of microorganisms is improved, and the microbial diversity is restored; and stress on growth of rhododendron is relieved by adverse factors in garden degraded soil through self properties, physicochemical properties of soil and improvement of structure, and growth and development of rhododendron root systems are promoted.

The raw material for preparing the biomass charcoal is the vinasse, so that a series of environmental problems caused by the fact that the vinasse is easy to decay and deteriorate can be relieved, the resource recycling of wastes can be realized, a new way is developed for the application of organic waste carbonized products, and the social benefits of the biomass charcoal and the pyroligneous liquor are improved.

The vinasse biomass charcoal has neutral pH value and acidic pH value after being treated by the pyroligneous liquor, and can reduce the pH value of garden soil after being applied compared with high-pH-value biomass charcoal taking straws, livestock and poultry manure and the like as raw materials, thereby providing a pH soil environment suitable for growth of rhododendrons and being beneficial to growth and development of rhododendron root systems.

With the increasing importance of the research of the rhizosphere microorganisms of the soil, some research results in recent years consider that the significant influence of biomass charcoal on the rhizosphere microorganisms is the main reason for promoting the growth and development of root systems, improving the yield of crops and enhancing the disease resistance of the crops (Graber et al, 2010; Huang et al, 2015; Kolton et al, 2011; 2017). Graber et al (2010) found that the biomass charcoal added into the culture medium can promote plant growth, and research on separation and culture technology found that the rhizosphere of pepper growing in the culture medium added with the biomass charcoal has more plant growth promoting bacteria, which indicates that certain components in the biomass charcoal stimulate the growth of specific microorganisms, thereby promoting the growth of crops. Kolton et al (2017) found that the application of biomass charcoal significantly improves rhizospheric bacterial diversity and improves the metabolic efficiency of sugars and phenolic compounds by promoting bacteria that degrade phenolic compounds. Biomass char also has a significant impact on the microbial conditioned nutrient conversion process in soil. Many researches find that the biomass charcoal remarkably improves the activity of phosphatase in soil, promotes the mineralization of organic phosphorus in soil, and increases the effective phosphorus content of soil (Jin et al, 2016). Culture experiment researches on Liu Sai Men (2016) find that the biomass charcoal improves the effectiveness of phosphorus and potassium in soil by promoting partial phosphorus and potassium dissolving bacteria in the soil.

After the biomass charcoal is applied, the structure of the soil microbial community is changed, and the change response of a nutrient regulation and control mechanism in the rhizosphere process of the rhododendron is caused, so that the effectiveness of rhizosphere nutrients is improved, or the growth of part of specific microorganisms is continuously promoted, and the aim of promoting the growth of the rhododendron is fulfilled.

Drawings

FIG. 1: in the concrete implementation mode, experimental examples 1-6 and a control sample figure of rhododendron growth condition are carried out on each group of samples in the control example.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1:

provided is an urban garden soil improvement method, which comprises the following steps: digging up surface soil of 10cm thick away from the soil surface of the urban garden, mixing river sand produced in Xinyang of Henan, the volume ratio of the river sand to garden soil is 1:10, adding biomass charcoal, fully mixing uniformly, wherein the content of the biomass charcoal is 1% based on the total weight of the surface soil and the river sand after mixing, and then flattening the soil; the biomass charcoal is derived from vinasse; the urban garden soil is urban garden soil with continuously planted rhododendron for more than five years;

the biomass charcoal is derived from vinasse;

the biomass charcoal is derived from rice wine lees; the biomass charcoal can be prepared by a method comprising the steps of:

(1) airing waste vinasse in a rice wine brewing process;

(2) taking dried vinasse as a raw material, carrying out thermal cracking carbonization for 1 hour at the high temperature of 450 ℃ under the condition of oxygen limitation to obtain vinasse carbonized matter and pyroligneous liquor, wherein the carbon yield is 38.72 percent, and the liquid proportion is 29.69 percent;

Example 2 to example 6

The method for improving the soil of the urban garden is provided, except that the content of the biomass charcoal is different, the steps of the other methods are the same as those of the embodiment 1, and the content of the biomass charcoal in the embodiment 2 is 2 percent; the content of biochar in example 3 was 4%; the content of biomass charcoal in example 4 is 6%; example 5 the content of biomass charcoal was 8%; the content of biomass char in example 6 was 10%.

Through a soil culture test of one year, the influence of the biomass charcoal on the improvement of the degraded soil of urban gardens and the growth of rhododendron roseum is researched, the application amount of the biomass charcoal with the optimal influence effect is screened out, and the influence mechanism is explained through the response of the chemical and biological processes of plant rhizosphere. The experiment can provide theoretical basis and technical support for the restoration application of the biochar in the garden green land degraded soil.

The pH value of the experimental device vinasse biomass charcoal prepared through the steps is 5.82; the total nitrogen content is 2.7 percent; the total phosphorus content is 0.76 percent; the total potassium content is 0.9 percent; the organic carbon content is 674 g/kg; the ash content was 37.96%.

Experimental example 1:

the rhododendron of the carmine honey variety is used as a test material, and the pot experiment proves that the rhododendron has the following functions:

(1) gather city gardens degenerated soil, this experiment main acquisition point has: agricultural courtyards of Jiangsu province (32 degrees 2 'N, 118 degrees 52' E), national defense gardens (32 degrees 3 'N, 118 degrees 44' E) and crescent lake parks (32 degrees 1 'N, 118 degrees 49' E) are all rhododendron garden cultivation soil for more than five years, soil degradation indexes are calculated through measuring physical and chemical indexes and microbial indexes of the rhododendron garden cultivation soil, and finally garden soil with serious degradation is selected.

(2) Adopting annual rhododendron cutting seedlings with basically consistent growth vigor and 5cm height as test materials, and performing pot culture test at the beginning of 3 months;

(3) the volume ratio of river sand to garden soil is 1:10, the application amount of the biomass carbon is 1% of the total mass of the garden soil and the river sand, the biomass carbon and the river sand are applied to soil at one time before the rhododendron is transplanted, the soil and the river sand are uniformly stirred by a shovel, the soil and the shovel are fully mixed and then potted, the dry weight of each pot of potting soil is 1kg, 2 seedlings are planted in each pot, 8 pots are processed in each experimental example, and random arrangement is adopted;

(4) and (4) water and fertilizer management is unified according to conventional measures, and garden water and fertilizer management is normally carried out, wherein the water application amount is the water holding amount of the urban gardens each time. Watering for 1 time every 7 days in spring for 3-5 months, and applying more growth balance fertilizer (N-20%, P) to flowers once a month₂O₅-20％，K₂O-20%), and the dosage is 1.5-2.0 g/kg soil; watering for 1 time every 3 days in summer 6-8 months without fertilizing; in autumn 9-11 months, watering for 1 time every 7 days, and applying more flower promoting fertilizers every 45 daysN-10％，P₂O₅-30％，K₂O-20%), and the dosage is 1.5-2.0 g/kg soil; watering for 1 time every 15 days in winter for 12-2 months without applying fertilizer;

(5) and observing the biological characteristics and growth and development rules of the rhododendron in the growth process. Plant and soil samples were collected during the March flowering period of the second year.

Experimental example 2-experimental example 6:

experimental examples 2 to 6 the procedure was the same as in experimental example 1 except that the biomass char application ratio in step (3) was different.

Comparative example:

comparative example the procedure was the same as in example 1 except that no biomass char was applied in step (3).

And observing the biological characteristics and growth and development rules of the rhododendron in the growth process.

Collecting a sample to be tested of the plant in a long period of time of the rhododendron;

collecting a soil sample to be detected: collecting soil with rhizosphere circumference of 0-2mm by root shaking method, and mixing completely. Sieving with a 2mm sieve, mixing uniformly, and removing root system, plant residue and other impurities; part of the soil is stored at 4 ℃ and is used for measuring physical and chemical indexes such as pH and the like; part of the soil was stored at-20 ℃ for molecular biological analysis; and (5) naturally drying part of the sample for soil nutrient determination.

Collecting samples of the overground part and the underground part: after soil is removed from the roots, the above-ground parts and the below-ground parts are washed with deionized water and put into envelopes. Putting into a baking oven, deactivating enzyme at 105 deg.C for 30min, adjusting the temperature of the baking oven to 60 deg.C, baking to constant weight, and weighing. Weighing dry weight, crushing, and measuring element content.

Test example 1: rhododendron and peanut growth index and nutrient element content

The number of branches of each strain is obtained by directly counting samples, and the average value of each group is calculated;

measuring the plant height of each plant through a flexible rule, and calculating the average value of each group;

measuring the chlorophyll content SPAD value of the current mature leaf by a chlorophyll measuring instrument, selecting 6 plants, and calculating the average value of each group to obtain the data in the table 1:

table 1: long condition index of Rhododendron

Sample mean value	Average number of branches (strips)	Average plant height (cm)	Average chlorophyll content
				Comparative example 1(CK)	1.88	9.3	11.8
EXAMPLE 1 (1% BC)	3.19	12.7	24.5
				EXAMPLE 2 (2% BC)	3.25	11.8	27.1
EXAMPLE 3 (4% BC)	3.31	11.1	31.9
				EXAMPLE 4 (6% BC)	2.25	10.6	30.5
EXAMPLE 5 (8% BC)	2.50	11.9	31.0
				EXAMPLE 6 (10% BC)	3.69	10.2	36.5

Scanning a root system sample into an image by using a root system scanner, analyzing by using WinRhizo (Regent Instruments,2001) root system analysis system software to obtain parameters such as the total length, the total surface area, the number of roots and the like, and calculating an average value to obtain data in a table 2:

table 2: rhododendron root growth and development index

Sample mean value	Root total length (cm)	Total root surface area (cm)²)	The root of the fibrous root
				Comparative example 1(CK)	115	24	472
EXAMPLE 1 (1% BC)	148	42	656
				EXAMPLE 2 (2% BC)	176	44	765
EXAMPLE 3 (4% BC)	186	43	767
				EXAMPLE 4 (6% BC)	203	49	896
EXAMPLE 5 (8% BC)	204	52	901
				EXAMPLE 6 (10% BC)	187	43	823

Respectively weighing the dry weight of underground parts, namely roots, and the dry weight of overground parts, namely leaves, stems and flowers, crushing plant samples, and screening the plant samples through a 1mm sieve for measuring the nutrient content of the plants; plant total nitrogen content utilization H₂SO₄-H₂O₂Digestion, and measurement by a semi-micro Kjeldahl method; the total phosphorus content is measured by a vanadium molybdenum yellow colorimetry (Boston, 2005); utilization of total potassium content by HNO₃-H₂O₂Digestion, flame photometry. The calculation method of the absorption amount of each element is as follows: the element absorption amount (mg) per site is the element content (g/kg) per site — biomass (g).

Table 3: index of nutrient absorption

As can be seen from table 1 in conjunction with fig. 1, the rhododendron plants applied in experimental examples 1-6 have greater advantages in terms of number of branches, plant height, and chlorophyll content than those applied in the control example without the vinasse biomass charcoal;

table 2 it can be seen that the application of the distillers 'grains biomass charcoal in experimental examples 1-6 has significant advantages in the total length of the root system, the total surface area and the number of roots of the rhododendron plants compared to the comparative example in which the distillers' grains biomass charcoal is not applied;

as can be seen from Table 3, the application of the distillers 'grains biomass charcoal in the experimental examples 1-6 has a significant advantage in nutrient absorption of the plants compared to the comparative example in which the distillers' grains biomass charcoal is not applied;

in conclusion, the soil improvement method disclosed by the invention has a positive effect on the growth and nutrient absorption of the azalea cultivated in the garden soil, promotes the development of root systems and has a good root system effect.

Test example 2: quality of flower formation of rhododendron

Counting the plant samples at the same time in the full bloom stage of the rhododendron, wherein the flower formation number of all samples is basically stable, and obtaining the following data through sample counting and measurement:

table 4: flower quality result table

As can be seen from Table 4, although the cutting seedlings are small and the number of flowers is small, the advantages between the treatment groups and the control group are obvious. The control group has no plants to flower in the second year, and compared with the control example in which 2-6 percent of vinasse biomass charcoal is applied, the proportion of flowering plants is increased along with the increase of the application amount of the biomass charcoal; the flower forming amount of the flower forming plants is increased along with the increase of the application amount of the biomass charcoal; the mean diameter of the flowering plants was maximized by applying 8% distillers' grain biomass char.

Test example 3: influence of biomass charcoal on physicochemical properties and nutrient content of rhizosphere soil

Soil pH, organic matter, etc. were determined by reference to the method in rue kun (2000). The solid-liquid ratio of the soil pH is 1:5 (m/v); the total nitrogen content was measured using a CNS elemental analyzer (Elementar Variomax CNS Analyzer, Elementar, Germany); the content of the quick-acting phosphorus in the soil is measured by adopting a molybdenum-antimony colorimetric-resistance method; the quick-acting potassium content is determined by flame photometry.

TABLE 5 soil pH and nutrient content indices

As can be seen from Table 5, the application of the distillers 'grains biomass charcoal in the experimental examples 1-6 reduces the pH alkalinity of the soil and relieves the stress of excessive pH value on the growth of the rhododendron and peanut compared with the control example without the distillers' grains biomass charcoal; in addition, the contents of organic matters and other nutrients in the experimental examples 1-6 are obviously increased within a reasonable range;

in conclusion, the soil improvement method provided by the invention has a certain restoration effect on the cultivated soil of the azalea gardens and improves the soil fertility. Test example 4: influence of biomass charcoal on abundance and diversity of rhizosphere soil microbial communities

Extraction of total DNA of soil: extracting total DNA of soil from rhizosphere soil stored at-20 ℃. Extraction of total DNA in soil A rapid extraction kit (PowerSoil) for DNA in soil from MOBIO is adopted^TMDNA Isolation Kit, Mo bio laboratories inc., CA) extracts DNA of the genome of the soil microorganism, and the specific steps of the extraction are performed step by step according to the instructions.

And (3) measuring the abundance of soil bacteria and fungi: the copy numbers of the genes of the 16S rRNA of the soil bacteria and the 18S rRNA of the fungi are determined by using a fluorescent quantitative PCR (qPCR) technology. The bacterial 16S rRNA primer sequence was: f338, ACTCCTACGGGAGGCAGCAG; r158, ATTACCGCGGCTGCTGG. The specific amplification procedure is 95 ℃ for 3 min; 40 cycles of 95 ℃ for 1min,56 ℃ for 1min,72 ℃ for 1 min. The fungal 18S rRNA primer sequence is as follows: NS1, GTAGTCATATGCTTGTCTC; ATTCCCCGTTACCCGTTG in FungR. The specific amplification procedure is 95 ℃ for 3 min; 40 cycles of 95 ℃ for 1min,57 ℃ for 1min,72 ℃ for 1 min. The fluorescent quantitation principle is that a fluorescent dye SYBR Green I can emit light after being combined with double-stranded DNA, and then the quantity of the double-stranded DNA in a PCR system template is detected according to a fluorescent signal. The concentration of DNA extracted from the soil was measured by a NanoDrop ND-1000 microspectrophotometer, and then the DNA was diluted to 15 ng. mu.L-1. The quantitative PCR instrument used in this experiment was an ABI 7500 quantitative PCR instrument. The specific reaction system is 25 mu L: includes 12.5. mu.L of the amplidase mix SYBR premix EX Taq TM, 9.5. mu.L of sterile ultrapure water, 1. mu.L of each of 10. mu.M forward and reverse primers, and 1. mu.L of DNA template (15 ng). In each amplification, a melting curve analysis was performed to ensure that the fragment size from the PCR product was correct; and absolute quantitative determination is carried out by adopting a standard curve method, and the clone plasmid which is inserted into the same amplified fragment as the sample to be detected and has known copy number is serially diluted by 10 times and is used as a template for PCR amplification, so that a standard curve can be obtained. The plasmid preparation method comprises the following steps: PCR amplification products of bacterial 16SrRNA gene and fungal 18SrRNA gene were first purified using a purification kit, ligated into pEASY-T3 cloning vector (Promega, Madison, Wis.), and transformed into E.coli DH5 α. Then, positive clones were screened by the blue-white spot method, PCR amplified with vector primers, and sequenced to confirm that they contained the correct target gene. Finally, the positive clone is expanded and cultured to extract plasmidPurification, with a spectrophotometer to determine plasmid concentration. Since the vector size and the length of the PCR fragment into which the target gene is inserted are known, the gene copy number of the plasmid can be calculated from the concentration of the plasmid. Finally, the plasmid was serially diluted 10-fold to make a standard curve. The copy number of the plasmid used in this experiment to generate the standard curve was 10³-10⁹Between 98% and 109%, R²Is greater than 0.99. The average values were calculated after quantitative PCR to obtain the results of bacterial, fungal abundance and bacterial/fungal ratio of table 6:

TABLE 6 abundance index of bacteria and fungi

As can be seen from Table 6, the application of the vinasse biomass charcoal in the experimental examples 1 to 6 slightly reduces the abundance of bacteria in the soil, greatly improves the abundance of fungi, and obviously reduces the ratio of bacteria to fungi compared with the control example in which the vinasse biomass charcoal is not applied. Fungi play an important role in the formation and stabilization of soil micro-aggregates and in the maintenance of soil organic matter stabilization. Fungi are generally thought to be more capable of efficiently utilizing organic substrates than bacteria. The results show that the application of the biomass charcoal is beneficial to the sustainable utilization of soil, so that the soil microbial community structure is developed towards a healthier direction.

Analyzing structural diversity of soil bacteria and fungi communities: after extraction of total DNA from the sample, the total DNA was extracted using the bacterial 16SrRNA gene universal primer 515F: GTGCCAGCMGCCGCGG 907R: CCGTCAATTCMTTTRAGTTT are provided. ITS universal primer 1737F of fungus 18SrRNA gene: CTTGGTCATTTAGAGGAAGTAA 907R: GCTGCGTTCTTCATCGATGC, combining primer adapters and carrying out PCR amplification. A20. mu.l reaction system included 1Xreaction buffer (NEBQ5TM), 0.3mM dNTP, 0.25. mu.M of Fprimer, 0.25. mu.M of index primer, 1U Q5TMDNA polymerase (neb) and 1. mu.l of dilutedtemplate. The amplification condition is pre-denaturation at 95 ℃ for 2 min; denaturation at 95 deg.C for 0.5min, annealing at 52 deg.C for 0.5min, and extension at 72 deg.C for 0.5min for 25 cycles; finally, extension is carried out for 10min at 72 ℃. And detecting the PCR product by using 2% agarose, purifying, quantifying and homogenizing the product to form a sequencing library, and using the library for sequencing on a computer after the quality of the library is qualified. The sequencing method adopts IlluminaHiseq 2500 PE250 double-ended sequencing, and the obtained original image data file is converted into an original sequencing sequence (Sequenced Reads) through Base recognition (Base Calling) analysis.

According to the Overlap relation between PE Reads, splicing double-end sequence data (Merge) obtained by Hiseq sequencing into a sequence (Tags), and simultaneously performing quality control filtration on the quality of Reads and the effect of Merge. The method mainly comprises the following three steps: (1) splicing PE reads: splicing reads of each sample by using FLASH v1.2.7 software according to the minimum overlap length of 10bp and the maximum mismatch ratio allowed in an overlap region of 0.2 to obtain a spliced sequence, namely original Tags data (Raw Tags); (2) and (3) Tags filtration: filtering RawTags obtained by splicing by using Trimmomatic v0.33 software, wherein the parameters are a window with 50bp, if the average mass value in the window is lower than 20, cutting off a rear-end base from the window, and filtering Tags with the length being less than 75% of the length of the Tags after quality control to obtain high-quality Tags data; (3) removing chimera: using UCHIME v4.2 software, chimera sequences were identified and removed, resulting in final effective data (effectivtags).

Clustering the optimized Clean Tags according to the 97% sequence similarity level, dividing OTUs, and performing a series of analyses such as species composition classification, abundance, sample-to-sample difference and the like on microorganisms in different samples through database comparison. The average was calculated to give the results of the diversity of bacterial, fungal communities of table 7:

TABLE 7 microbial diversity index

As can be seen from Table 7, the Shannon: Shannon-Vera index, shows the relative abundance of microbial community functional diversity, the higher the number, the higher the biodiversity; simpson's diversity index, representing the dominance of the most common species in the microbial community, is higher indicating lower community diversity, so that application of whole stillage biochar in examples 1-6 significantly improved the biodiversity in the soil compared to the control, in which whole stillage biochar was not applied.

The comprehensive test results show that after the biomass charcoal is applied, the soil microbial community structure is changed, and the change response of a nutrient regulation and control mechanism in the rhizosphere process of the rhododendron is caused, so that the effectiveness of rhizosphere nutrients is improved, or the growth of part of specific microorganisms is continuously promoted, the purpose of promoting the growth of the rhododendron is achieved, and the virtuous cycle of rhododendron cultivation soil and the growth of the rhododendron is realized.

It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.

Claims

1. A method for improving urban garden soil is characterized in that the method is to fully and uniformly mix urban garden surface soil, biomass charcoal and river sand.

2. The method for improving soil in urban gardens according to claim 1, wherein the method comprises the step of fully and uniformly mixing topsoil, biomass charcoal and river sand, which is 10cm away from the surface of the soil in the urban gardens.

3. The method for improving soil in urban gardens according to claim 1, wherein the soil in urban gardens is soil in urban gardens where rhododendron is planted continuously for more than two years.

4. The method for improving soil in urban gardens according to claim 1, wherein further the volume ratio of river sand to garden soil is 1: 10.

5. The method for improving soil in urban gardens according to claim 1, wherein the application amount of the biomass charcoal is 1% -10% based on the total weight of the surface soil and the river sand after mixing.

6. The method for improving soil in urban gardens according to claim 5, wherein the application amount of the biomass charcoal is 8% based on the total weight of the surface soil and the river sand after mixing.

7. The method for improving soil in urban gardens according to claim 1, wherein the biomass charcoal is vinasse biomass charcoal, and the preparation of the biomass charcoal comprises the following steps:

(1) airing waste vinasse in a wine making process;

8. The soil improvement method for urban gardens according to claim 1, wherein: the biomass charcoal is derived from rice wine lees.

9. The use of the method for improving soil in urban gardens according to any one of claims 1 to 8 for improving soil environments in urban gardens with alkaline pH, heavy texture and low fertility.

10. Use of the method for soil improvement in urban gardens according to any one of claims 1 to 8 for the cultivation of mainly azalea-like acid-loving flowers in urban gardens.