CN110607285A

CN110607285A - Heat-resistant avian adenovirus serotype 4 genetic engineering vaccine candidate strain and construction method thereof

Info

Publication number: CN110607285A
Application number: CN201910801213.7A
Authority: CN
Inventors: 吴艳涛; 李保珍; 曹永忠; 张小荣; 陈银; 郭梦娇; 张成成; 阮宝阳
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2019-08-28
Filing date: 2019-08-28
Publication date: 2019-12-24

Abstract

The invention relates to a heat-resistant avian adenovirus serotype 4 genetic engineering vaccine candidate strain and a construction method thereof. The candidate strain is heat stable Newcastle Disease Virus (Newcastle Disease Virus) rAHR09-4F2 expressing serum 4 type avian adenovirus spike protein 2, and the preservation number is CCTCC NO: V201932. The candidate strain is obtained by using a heat-resistant Newcastle disease attenuated rAHR09 strain as a vector, inserting a serum 4 type avian adenovirus (FAdV4) spike protein (fiber2) gene into a P and M gene spacer region of the vector and utilizing a reverse genetic technology. The biological characteristics and the immune protection efficacy evaluation result show that the recombinant virus has good thermal stability and immunogenicity, and provides good immune protection for FAdV4 infection.

Description

Heat-resistant avian adenovirus serotype 4 genetic engineering vaccine candidate strain and construction method thereof

Technical Field

The invention belongs to the technical field of genetic engineering vaccines, and relates to a recombinant Virus strain rAHR09-4F2 for expressing spike protein of avian adenovirus group I (FAdV-4) by taking Newcastle Disease Virus (NDV) as a vector, wherein the recombinant Virus strain can be used for preventing and controlling avian diseases caused by the avian adenovirus group I.

Background

Avian adenovirus (fowladenvirus, FAdV), a opportunistic pathogen that infects the avian body, generally does not exhibit clinical symptoms, but under concurrent infection conditions, adenovirus can exhibit severe pathogenicity. The avian group i adenovirus can mainly cause diseases including avian hydropericardium syndrome (HPS), Inclusion Body Hepatitis (IBH) and ananoveric erosions (AGH), among which IBH and HPS are the most serious. In recent years, group I avian adenovirus of serotype 4 (FAdV-4) and serotype 8b (FAdV-8b) are mainly prevalent in chicken flocks in China, and serious economic loss is caused to the poultry industry.

The group i avian adenovirus vaccine developed and put into use earlier was a inactivated vaccine. In 1990, after the first HPS outbreak of Pakistan, the disease was initially prevented by inactivated vaccine of liver homogenate. Live attenuated vaccines have also been developed to control the virus, and Mansoor et al developed a live attenuated vaccine to prevent HPS. In recent years, studies at home and abroad have reported that inactivated vaccines, attenuated live vaccines, genetic engineering vaccines and the like can be used for immunoprophylaxis of the disease. Commercial inactivated vaccines are available in more than 50 countries and regions of asia, africa, latin america, oceania, etc., most of which are monovalent vaccines of serotype 4 virus, multivalent of serotype 8/8a, and combined with other avian-derived viruses, with only one live, undeniated strain of 8a, the Esurient vaccine used in australia for chicken immunization before egg laying.

With the development of reverse genetics technology, research on NDV as a live vector of a vaccine is rapidly progressing. NDV can rapidly cause the organism to generate comprehensive immune response, can proliferate in vivo for a long time and stably and efficiently express exogenous genes, and can durably provide immune protection for the organism; the NDV carrier has high safety, can be used for feeding seedlings in various ways of drinking water, spraying, dripping nose, dropping eyes or injecting, and is very convenient to use; NDV attenuated virus has the growth characteristic of high-titer chick embryos, and the production cost is very low; the NDV attenuated vaccine immunization is an indispensable immunization program for almost all newborn chicks in the poultry industry in China, so the NDV attenuated vaccine has great economic significance for being used as a live virus vaccine vector.

Generally, NDV is not very tolerant to heat, and can be inactivated (lost the ability to infect a host) at 50-55 ℃ for 30 min. Early research results show that among strains of different virulence types of NDV, strains with higher temperature tolerance exist, and mainly show that the strains still have the capability of infecting a host after being treated at 56 ℃ for 30min or have Hemagglutination (HA) activity although the strains lose infectivity. The NDV V4 strain was the first strain to be isolated as a thermotolerant NDV strain, and studies on the thermotolerant strain of NDV have been conducted intensively. The attenuated NDV/rAHR09 strain still has hemagglutination, MDT value >120h and ICPI value 0.057 when treated at 56 deg.C for 45 min. The result shows that the NDV/rAHR09 strain has heat resistance and obviously weakened virulence, and can be used as a candidate strain of a heat-resistant ND attenuated vaccine.

Since most live vaccines are heat sensitive, cold chain maintenance is required during transport and storage to ensure vaccine quality. The heat-resistant NDV vaccine strain has good heat resistance, can resist heat at 50-55 ℃ for 70min, is used as a vaccine candidate strain, and has wider application prospect in genetic engineering vaccines taking the heat-resistant NDV as a carrier.

Disclosure of Invention

Poultry adenovirus I is mainly prevalent in chicken flocks in China, and the serotypes of the poultry adenovirus I are FAdV-4 and FAdV-8b, so that diseases such as Hydropericardium syndrome (HPS) and chicken Inclusion Body Hepatitis (IBH) are caused respectively, and serious economic loss is caused to the poultry industry. The fiber protein (fiber) is an important structural protein of the avian adenovirus, contains neutralizing antigen epitope of the virus and is also related to the infectivity of the virus. The invention selects heat-resistant NDV low virulent strain as vaccine live vector, inserts the FAdV-4 spike protein coding gene into NDV vector by reverse genetics technology, constructs the FAdV-4 live vaccine aiming at the current domestic epidemic, and evaluates the biological characteristics and immune protection efficacy of recombinant virus.

The invention relates to a heat-resistant avian adenovirus serotype 4 genetic engineering vaccine candidate strain, which is a heat-stable Newcastle Disease Virus (Newcastle Disease Virus) rAHR09-4F2 expressing avian adenovirus serotype 4 spike protein 2, and the preservation number is CCTCC NO: V201932.

The invention also discloses a construction method of the heat-resistant gene engineering vaccine candidate strain for the avian adenovirus serotype 4, which is to insert avian adenovirus serotype 4fiber gene into the P and M gene spacer region of the heat-resistant Newcastle disease virus NDV/rAHR 09.

The invention further discloses application of the heat-resistant avian adenovirus serotype 4 genetic engineering vaccine candidate strain in preparation of vaccines.

Specifically, the construction steps of the thermostable Newcastle disease virus rAHR09-4F2 for expressing the avian adenovirus serotype 4 spike protein 2 are as follows: :

(1) cleavage of plasmid p-rVHR 09: the plasmid p-rVHR09 containing the whole genome of the attenuated strain of the heat-resistant Newcastle disease virus NDV/rAHR09 is digested by Pme I, and a linearized target fragment is recovered;

(2) cloning and sequencing of the FAdV-4fiber2 Gene: amplifying a serum 4-type avian adenovirus fiber2 gene by using a PCR method, recovering a PCR product, connecting the PCR product to linearized p-rVHR09, transforming competent cells, screening positive clones, and obtaining a positive recombinant plasmid p-rVHR 09-FAdV-4 fiber2 through sequencing verification;

(3) rescue of recombinant virus: respectively co-transfecting p-rVHR 09-FAdV-4 fiber2 and three eukaryotic expression plasmids of pCI-NP and pCI-P, pCI-L to a single-layer BSR-T7/5 cell, freezing and thawing the cell for three times after 60 hours after transfection, inoculating 9-11-day SPF (specific pathogen free) chick embryos, and after 96 hours, determining the titer to be more than 2 through HA (HA assay)⁴The allantoic fluid is continuously passed for 2 generations;

(4) and (3) identifying the recombinant virus by RT-PCR: viral RNA is extracted from HA positive allantoic fluid, a target fragment inserted into NDV/rAHR09 is identified by an RT-PCR method, and the recombinant virus with a positive identification result is named rAHR09-4F 2.

The obtained rAHR09-4F2 was evaluated, and the results were as follows:

(1) western-blot identification of recombinant viruses: inoculating rAHR09-4F2 and NDV/rAHR09 allantoic fluid into CEF cells, collecting the cells, cracking the cells to prepare a protein sample, performing Western-blot test, and identifying the expression level of spike protein in the recombinant virus;

(2) determination of heat resistance of recombinant viruses: taking 7 parts of 3-generation allantoic fluid of rAHR09-4F2, heat-treating in 56 deg.C metal bath for 20min, 30min, 40min, 50min, 60min, 70min, and 80min, and performing HA test.

(3) EID of recombinant viruses₅₀And (3) determination: diluting the allantoic fluid of rAHR09-4F2 virus by 10 times, and taking 10 times^-6-10^-9Inoculating SPF chick embryos of 9-11 days old in dilution, measuring HA titer of recombinant virus after 120h, and calculating EID₅₀；

(4) MDT assay of recombinant viruses: diluting the allantoic fluid of rAHR09-4F2 virus by 10 times, and taking 10 times^-6-10^-9Inoculating SPF (specific pathogen free) chick embryos of 9-11 days old in dilution, and observing for 120 h;

(5) ICPI assay of recombinant viruses: diluting the allantoic fluid of the rAHR09-4F2 virus by 10 times, inoculating 1-day-old SPF chicks in the brain, and calculating ICPI;

(6) recombinant virus rAHR09-4F2 immunopotency assay: the SPF chickens are immunized at the age of 7 days, and a recombinant virus group, an inactivated vaccine group and a challenge control group are arranged. Immunizations 7, 14, 21, 28d blood was collected and sera were isolated and neutralizing antibody titers were determined by a serum neutralization test. After immunization for 21d, the test chickens attack the FAdV-4 GX2013 strain, and throat swabs and cloaca swabs of the test chickens are collected at 3d and 7d after toxicity attack, and the toxicity content of the swabs is detected by fluorescence quantitative PCR.

The invention uses heat-resistant Newcastle disease attenuated rAHR09 strain as a carrier, inserts serum 4 type avian adenovirus (FAdV4) fiber protein (fiber2) gene into the P and M gene spacer region, obtains 1 recombinant Newcastle disease virus rAHR09-4F2 strain by utilizing reverse genetic technology, and shows the evaluation results of biological characteristics and immune protection effectiveness of the recombinant Newcastle disease virus, the recombinant virus has good heat stability and immunogenicity, and provides good immune protection for FAdV4 infection.

Drawings

FIG. 1: plasmid p-rVHR09 map

FIG. 2: cleavage electrophorogram of plasmid p-VHR09 (M: DL15000 DNA Ladder; lane 1: pmei I cleaved p-VHR09)

FIG. 3: schematic construction of recombinant plasmid rVHR09-P-FAdV-4 fiber2

FIG. 4: FAdV-4fiber2 gene amplification electrophoretogram (M: 200bp DNA Marker; lane 1: FAdV-4fiber2 gene)

FIG. 5: recombinant plasmid PCR identification electropherogram (M: 200bp DNA Marker; lane 1: p-rAHR 09-FAdV-4 fiber2 identification PCR product)

FIG. 6: recombinant plasmid p-rVHR 09-FAdV-4 fiber2 map

FIG. 7: recombinant virus rAHR09-4F2 identification electrophoretogram (M: 200bp DNA Marker; lane 1: rAHR09-4F2 identification PCR product)

FIG. 8: western-blot identification of recombinant virus rAHR09-4F2 (M: protein Marker; lane 1: protein sample prepared by CEF infected with rAHR09-4F 2; lane 2: protein sample prepared by LMH infected with FAdV-4; lane 3: protein sample prepared by CEF infected with NDV/rAHR 09)

FIG. 9: rAHR09-4F2 immunopotency evaluation test chicken FAdV-4 neutralizing antibody level detection result chart

FIG. 10: survival curve chart of each group of test chickens after rAHR09-4F2 immune efficacy evaluation challenge

FIG. 11: evaluation of rAHR09-4F2 Immunity efficacy test throat swab displacement monitoring results after FAdV-4 challenge

FIG. 12: rAHR09-4F2 immunopotency evaluation test the monitoring results of cloacal swab displacement after FAdV-4 challenge

The recombinant virus rAHR09-4F2 is preserved in the China center for type culture Collection in 2019, 5 months and 13 days; the address of the depository: wuhan university in China; the preservation number is CCTCC NO of V201932; and (3) classification and naming: thermostable Newcastle Disease Virus (Newcastle Disease rAHR09-4F2, NDV) rAHR09-4F2 expressing avian adenovirus serotype 4 spike protein 2.

Detailed Description

The biological materials involved in the present invention are as follows:

NDV/rAHR09 Cao Yong Zhong faithful, a heat stable gene VIII type Newcastle disease low virulent strain exogenous gene expression vector, patent application No.: CN201811244137.6, publication No.: CN109295095A

Plasmid p-rVHR 09: cao Yong loyalty et al, a thermostable gene VIII type Newcastle disease low virulent strain exogenous gene expression vector, patent application No.: CN201811244137.6, publication No.: CN109295095A

pCI-NP, pCI-P, pCI-L: identification of Liuqian and Newcastle disease virus heat-resistant strain HR09 and construction of reverse genetic operation system, Master thesis, Yangzhou university, 2017

FAdV-4 GX 2013: chentian\39580, establishment of a biological characteristic identification and detection method of a serum 4 avian adenovirus GX2013 strain, Master thesis, Yangzhou university 2016, and

identification of Liuqian, Newcastle disease virus heat-resistant strain HR09 and construction of reverse genetic operation system in BSR-T7/5 cell, Master thesis, 2017

Example 1: construction of serum 4 type fowl adenovirus gene engineering vaccine strain

1. Cleavage of plasmid rVHR09-P

A transcription vector p-VHR09 containing full-length genome (GenBank: MF285077.1) of NDV/rAHR09 attenuated mutant is preserved in open laboratory with emphasis on zooepidemiology of livestock and poultry of Yangzhou university (Cao Yongzhou et al, a heat stable gene VIII type Newcastle disease attenuated strain exogenous gene expression vector, patent application No. CN201811244137.6, publication No. CN109295095A), and the plasmid map is shown in FIG. 1. The enzyme digestion linearization is carried out on the P and M gene spacer region by using Pme I restriction endonuclease, after the enzyme digestion product is subjected to 1% agarose gel electrophoresis, the linearized target fragment of about 18000bp is recovered, and the result is shown in figure 2.

2. Cloning and sequencing of the integrated FAdV-4fiber2 Gene

The construction principle of infectious clone integrating FAdV-4fiber2 gene is shown in FIG. 3, and the specific operation steps are as follows:

2 pairs of primers are designed by referring to an open reading frame gene sequence of FAdV-4 GX2013 strain fiber2(SEQ ID NO.1), meanwhile, a gene initiation sequence and a gene termination sequence which are specific to the Newcastle disease virus are added on the basis of the primers, and then according to the instruction requirements of a non-ligase dependent single-chip rapid Cloning Kit (Clon express II One Step Cloning Kit), a homologous sequence (15bp-20bp) is introduced into the 5' end of the primer, and finally, the designed primer sequence is as follows:

pW FAdV-4-F2-F：

ATGATTGCACAACCACGTTTTTAAGAAAAAATACGGGTAGAAGCCACCATGCTCCGGGCCCCTAAAAGAAG(SEQ ID NO.2)

pW FAdV-4-F2-R：ATTTTTGAAGCTGCTAGTTTGGTTACGGGAGGGAGGCCGCTG

(SEQ ID NO.3)

extracting the DNA of the FAdV-4 GX2013 virus, and amplifying a target fragment by using the DNA as a template through a PCR reaction by using the primer. The PCR product was electrophoresed through 1% agarose gel to recover the desired amplified fragment, and the result is shown in FIG. 4, and the desired band of about 1500bp was recovered. The recovered product was cloned into linearized p-rAHR09 according to the Clonexpress II One Step Cloning Kit instructions. The ligation product was transformed into DH 5. alpha. and spread on LB plate containing ampicillin and incubated overnight at 37 ℃ in an incubator; on the next day, a single colony was selected to inoculate LB liquid medium containing ampicillin. Identification was performed by PCR using the primer pair ND-3-F (SEQ ID NO.4) + ND-3-R (SEQ ID NO. 5). As a result, as shown in FIG. 5, the target band sizes were 3200bp or so, respectively.

ND-3-F：AGGGCAGAGCCAARACARTAC(SEQ ID NO.4)

ND-3-R：CGCRGTTTGRCTCCAGAGTAT(SEQ ID NO.5)

Clones identified as positive were sent to Anhui Universal Biotechnology, Inc. for sequencing. The positive clone with correct sequencing was named p-rVHR 09-FAdV-4 fiber 2. The recombinant plasmid map is shown in FIG. 6.

3. Rescue of recombinant viruses

BSR-T7/5 cells and helper plasmids pCI-NP and pCI-P, pCI-L are stored in the livestock and poultry infectious disease important open laboratory of Yangzhou university department of agriculture.

Preparation of cells and plasmids for transfection: for transfectionThe BSR-T7/5 cells were pre-selected with 1mg/mL G418 and 5X 10 cells were plated the day before transfection⁵The cells of (2) were seeded in 35mm dishes and used for transfection at about 60% to 80% confluence. All plasmids used for transfection were extracted using the EndoFree Plasmid Midi Kit as described.

Co-transfection: co-transfecting a BSR-T7/5 cell with a transcription vector p-rVHR 09-FAdV-4 fiber2 containing NDV genome full-length cDNA and three auxiliary plasmids (pCI-NP and pCI-P, pCI-L), repeatedly freezing and thawing a transfected sample at-70 ℃ for 3 times after 60 hours of transfection, then inoculating SPF (specific pathogen free) chick embryos of 9-11 days old, wherein the inoculation amount is 0.4 mL/embryo, continuously incubating at 37 ℃, regularly observing the chick embryo state, and discarding the chick embryos which are abnormally dead within 24 hours. And after 96h, placing the chick embryos in a refrigerator at 4 ℃, collecting chick embryo allantoic fluid after the chick embryos are subjected to vasoconstriction, continuously carrying out passage 2 times on the chick embryos by the allantoic fluid which is positive by a hemagglutination test, and harvesting and storing the allantoic fluid for later use.

RT-PCR identification of recombinant viruses

Extracting virus genome RNA from harvested allantoic fluid, using JDCZ-F (SEQ ID NO.6) + JDCZ-R (SEQ ID NO.7) primer pair, identifying whether the recombinant virus P and M gene spacers have been successfully inserted into the target gene by RT-PCR, observing the fragment size of the PCR product by 1% agarose gel electrophoresis, wherein the result is shown in FIG. 7, the target band is respectively about 1800bp and 1900bp in size, recovering the target fragment, connecting pEASY-T3 vector, transforming Tans1-T1, picking single colony for culture the next day, and further carrying out sequencing verification on the clone identified as positive by PCR. The successfully rescued virus was designated rAHR09-4F 2.

JDCZ-F：CCGGGTCGATTGACGATCAGAAA(SEQ ID NO.6)

JDCZ-R：GCACAGTCGGGGCACTTCGATTCTA(SEQ ID NO.7)

Western-blot identification of recombinant viruses

The recombinant viruses rAHR09-4F2 and NDV/rAHR09 allantoic fluid are diluted and inoculated to confluent CEF cells, and FAdV-4 is inoculated to LMH cells. And (3) taking out each virus inoculated cell, adding cell lysate to prepare a protein sample, identifying the expression condition of recombinant virus spike protein by Western-blot, diluting the recombinant virus spike protein by using anti-FAdV-4 fiber2 mouse serum to serve as a primary antibody, and incubating overnight at 4 ℃. The horseradish peroxidase-labeled anti-mouse secondary antibody is diluted, developed by an enhanced chemiluminescence method (ECL), and a protein band is observed, so that the result is shown in figure 8, and the recombinant virus can express a gene for encoding the spike protein.

Example 2: biological characterization of recombinant viruses

1. Determination of the Heat resistance of recombinant viruses

Taking 3-generation allantoic fluid of recombinant virus rAHR09-4F2, placing 500. mu.L of the 3-generation allantoic fluid in a 56 ℃ metal bath for heat treatment for 20min, 30min, 40min, 50min, 60min, 70min and 80min, and performing HA test. The results are shown in Table 1, and the results of the heat resistance test show that the rAHR09-4F2 still HAs HA activity after being treated at 56 ℃ for 70 min.

TABLE 1 rAHR09-4F2 strain hemagglutination resistance assay results

2. EID of recombinant viruses₅₀Measurement of

Continuously diluting the allantoic fluid rAHR09-4F2 by 10 times, and taking 10⁶～10⁹Inoculating the diluted virus into allantoic cavities, inoculating 5 allantoic fluids of 9-11 days old chick embryos per dilution, culturing at 37 ℃ in an incubator for 120h (5d) day by day, taking out the dead chick embryos, refrigerating, taking out all chick embryos at 5d, cooling in a refrigerator at 4 ℃ overnight, and performing HA experiments the next day. The results are shown in Table 2, and the strain EID of rAHR09-4F2₅₀Comprises the following steps: 10^7.42EID₅₀the/mL shows that the recombinant virus has good replication performance and can be stably propagated on chick embryos.

3. MDT assay for recombinant viruses

Continuously diluting the allantoic fluid rAHR09-4F2 by 10 times, and taking 10^-6～10^-9Inoculating diluted virus into SPF chick embryos of 9-10 days old through an allantoic cavity, inoculating 5 embryos per dilution allantoic fluid, and culturing at 37 ℃ for 7 days. The observation was carried out every 12h for 7d, and the death time of the chick embryos was recorded. The value of MDT is calculated and compared with the parental virus, the result is shown in the table 2, and the result shows that the value of MDT of the recombinant virus is more than 120 h.

4. ICPI assay for recombinant viruses

Taking HA value greater than 2⁴The allantoic fluid of fresh rAHR09-4F2 was diluted with sterile PBS containing no antibiotic at 10, and then, 10 SPF chicks of 1 day old were inoculated intracerebrally at 50. mu.L/chick, and simultaneously inoculated intracerebrally with sterile PBS containing no antibiotic as a negative control group. The morbidity and mortality of the chicken flocks are observed every day, and 8 days are continuously observed. The ICPI values were calculated and compared to the parental virus and the results are shown in Table 2. The ICPI value of strain rAHR09-4F2 was 0.050. By integrating MDT and ICPI values, rAHR09-4F2 meets the attenuated virulence standard and has no obvious difference from the virulence of parent strains.

TABLE 2 partial biological Properties of the rAHR09-4F2 Strain

Example 3: recombinant virus rAHR09-4F2 immunopotency assay

1. Test grouping and immunization

SPF chicken test groups are shown in Table 3. Immunization was performed on SPF chickens 7 days old. Test chickens in the rAHR09-4F2 group were inoculated with rAHR09-4F2 (10) by nasal drip and eye drop⁶EID₅₀) The inactivated vaccine group is inoculated with a bivalent inactivated vaccine (0.25 mL/vaccine) of FAdV-4+ FAdV-8b subcutaneously at the neck, and the virus-attacking control group is inoculated with PBS (0.1 mL/vaccine) by nasal drop. FAdV-4+ FAdV-8b bivalent inactivated vaccine prepared by referring to the method of Huyage (Huyage. development of serum type 4 and 8b avian group I adenovirus bivalent oil emulsion inactivated vaccine. university of Yangzhou Master academic thesis, 2018.)

TABLE 3 immunoassay grouping

2. Post-immune antibody level monitoring

In SPF chicken immunization 7 th, 14 th, 21 th and 28 th days, serum was collected from each group of test chickens, and the antibody level in each group of test chickens was determined by neutralization test. The specific method comprises the following steps:

killing serum samples to be detected of each group of test chickens at 56 DEG CActivating for 30min, diluting with growth liquid at a multiple ratio (1:4, 1:8, 1:16 … … 1:1024), and adding virus liquid (200 TCID) of strain FAdV-4 GX2013₅₀50 mul) was mixed with serum diluted in equal volume, placed in an incubator at 37 ℃ for 1h, each serum dilution was repeated 4 times, and negative and positive controls were set up, 100 mul of cell suspension was added to each well, placed at 37 ℃ with 5% CO₂And (5) culturing in a cell culture box, observing for 5-7 d, counting the result and calculating the titer of the antibody in the serum according to a formula when the positive control hole completely appears cytopathic effect, and judging the final result.

Distance ratio ═ (percentage of protection greater than 50% — 50%)/(percentage of protection greater than 50% — percentage of protection less than 50%)

lgTCID₅₀Distance ratio x difference between log of dilutions + log of dilutions above 50% protection

The results of the serum neutralization test are shown in FIG. 9, except for the challenge control group, the serum neutralizing antibodies were detected after the test chickens were immunized for 7 days, the peak values were reached at 21 days after the immunization, and the levels of the neutralizing antibodies against FAdV-4, which were generated by the rAHR09-4F2 group and the inactivated vaccine group, were 10 respectively^2.93And 10^3.23。

4. Challenge test

After SPF chickens were immunized for 21 days, FAdV-4 GX2013 strain (10) was used for each group of test chickens^7.5TCID₅₀Per mL) is subjected to toxin counteracting through intramuscular injection, and the toxin counteracting dosage is 0.2mL per unit. Observing the morbidity and mortality condition of each group of experiments, wherein all the experimental chickens in the challenge control group die within 3d after challenge, and the pericardial effusion which is yellowish and clear is discovered through autopsy; the liver is crisp and swollen, the appearance is light yellow to dark yellow, and a necrotic focus is accompanied; kidney enlargement, hemorrhage; edema and hemorrhage of the spleen. 5 rAHR09-4F2 immunization groups died continuously in the challenge period of 3d, compared with the challenge control group, the death time was delayed to a certain extent, the autopsy lesion was similar to that of the challenge control group, and the remaining 5 surviving chickens and the test chickens in the inactivated vaccine group quickly recovered to normal after transient mental depression and decreased food consumption. The survival curves of the tested chickens in each group are shown in figure 10, and the survival rates of the tested chickens in the rAHR09-4F2 group and the inactivated vaccine group are 50% and 100% respectively. Collecting pharynx of each group of test chicken at 3d and 7d after challengeThroat swabs and cloaca swabs, all collected swabs are processed to extract DNA, and SYBR Green I real-time fluorescence quantitative PCR method (G ü nes A, Mark A, Grafl B, et al. real-time PCR assay for univariate detection and quantification of all five species of fowladenviruses (FAdV-A to FAdV-E). Journal of viral Methods,2012, 183: (2): 147-.

SEQUENCE LISTING

<110> Yangzhou university

<120> heat-resistant avian adenovirus serotype 4 gene engineering vaccine candidate strain and construction method thereof

<130>

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 1440

<212> DNA

<213> Newcastle Disease Virus (Newcastle Disease Virus)

<400> 1

atgctccggg cccctaaaag aagacattcc gaaaacggga agcccgagac cgaagcggga 60

ccttccccgg ctccaatcaa gcgcgccaaa cgcatggtga gagcatccca gcttgacctg 120

gtttatcctt tcgattacgt ggccgacccc gtcggagggc tcaacccgcc ttttttggga 180

ggctcaggac ccctagtgga ccagggcgga cagcttacgc tcaacgtcac cgatcccatc 240

atcatcaaga acagatcggt ggacttggcc cacgacccca gtctcgatgt caacgcccaa 300

ggtcaactgg cggtggccgt tgaccccgaa ggggccctgg acatcacccc cgatggactg 360

gacgtcaagg tcgacggagt gaccgtaatg gtcaacgatg actgggaact ggccgtaaaa 420

gtcgacccgt ccggcggatt ggattccacc gcgggtggac tgggggtcag cgtggacgac 480

accttgctcg tggatcaggg agaactgggc gtacacctca accaacaagg acccatcact 540

gccgatagca gtggtatcga cctcgagatc aatcctaaca tgttcacggt caacacctcg 600

accggaagcg gagtgctgga actcaaccta aaagcgcagg gaggcatcca agccgacagt 660

tcgggagtgg gcgtttccgt ggatgaaagc ctacagattg tcaacaacac tctggaagtg 720

aaaccggatc ccagcggacc gcttacggtc tccgccaatg gcctagggct gaagtacgac 780

actaataccc tagcggtgac cgcgggcgct ttaaccgtgg tcggaggggg gagcgtctcc 840

acacccatcg ctacttttgt ctcgggaagt cccagcctca acacctacaa tgccacgacc 900

gtcaattcca gcgcgaacgc cttctcttgc gcctactacc ttcaacagtg gaacatacag 960

gggctccttg ttacctccct ctacttgaaa ttggacagcg ccaccatggg gaatcgccct 1020

ggggacctca actccgccaa tgccaaatgg ttcacctttt gggtgtccgc ctatctccag 1080

caatgcaacc cctccgggat tcaagcggga acggtcagcc cctccaccgc caccctcacg 1140

gactttgaac ccatggccaa taggagcgtg accagcccat ggacgtactc ggccaatgga 1200

tactatgaac catccatcgg ggaattccaa gtgttcagcc cggtggtaac aggtgcctgg 1260

aacccgggaa acatagggat ccgcgtcctc cccgtgccgg tttcggcctc cggagascgm 1320

tacacccttc tatgctatag tctgcagtgc acgaacgcga gcatttttaa tccaaacaac 1380

agcggaacca tgatcgtggg acccgtgctc tacagctgtc cagcggcctc cctcccgtaa 1440

<210> 2

<211> 71

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 2

atgattgcac aaccacgttt ttaagaaaaa atacgggtag aagccaccat gctccgggcc 60

cctaaaagaa g 71

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 3

atttttgaag ctgctagttt ggttacggga gggaggccgc tg 42

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 4

agggcagagc caaracarta c 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 5

cgcrgtttgr ctccagagta t 21

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 6

ccgggtcgat tgacgatcag aaa 23

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence (manual sequence)

<400> 7

gcacagtcgg ggcacttcga ttcta 25

Claims

1. A heat-resistant fowl adenovirus serotype 4 genetic engineering vaccine candidate is a heat-stable Newcastle Disease Virus (Newcastle Disease Virus) rAHR09-4F2 with the preservation number of CCTCC

NO:V201932。

2. The method for constructing a candidate of a thermotolerant avian adenovirus serotype 4 genetic engineering vaccine as claimed in claim 1, wherein an avian adenovirus serotype 4fiber gene is inserted between the P and M intergenic regions of the thermotolerant newcastle disease virus NDV/rAHR 09.

3. Use of the heat-resistant avian adenovirus serotype 4 genetically engineered vaccine candidate of claim 1 for the preparation of a vaccine.