CN110607277B

CN110607277B - Method for differentiating human pluripotent stem cells into macrophages

Info

Publication number: CN110607277B
Application number: CN201910851098.4A
Authority: CN
Inventors: 那洁; 段福宇
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2019-09-10
Filing date: 2019-09-10
Publication date: 2023-05-09
Anticipated expiration: 2039-09-10
Also published as: CN110607277A

Abstract

The invention discloses a method for differentiating human pluripotent stem cells into macrophages. The invention provides a kit for differentiating pluripotent stem cells into macrophages, which comprises a complete set of culture solution capable of differentiating pluripotent stem cells into macrophages. The invention adopts a monolayer cell culture method to firstly differentiate to obtain hematopoietic stem cells, and further adds IL3 and M-CSF to stimulate and obtain CD14 and CD163 positive macrophages. The method has the advantages of definite chemical components, no animal source component, greatly improved safety of cell preparation, short time consumption, high differentiation efficiency, low cost, etc. The preparation method provided by the invention can be used for producing human macrophages on a large scale, has stable quality and high safety, and provides a large amount of cell sources for tissue engineering, drug development and cell treatment.

Description

Method for differentiating human pluripotent stem cells into macrophages

Technical Field

The invention relates to the technical field of biology, in particular to a method for differentiating human pluripotent stem cells into macrophages.

Background

The human pluripotent stem cells comprise human embryonic stem cells and human induced pluripotent stem cells, can differentiate into various cells in human body, can be used for preparing disease models and carrying out drug toxicity test, and can replace injured pathological cells through cell transplantation, thereby promoting organism wound repair and treating diseases.

Macrophages are important natural immune cells of a human body, and have important application values in the aspects of resisting pathogenic microorganism infection, removing necrotic cells and tissue debris, researching the occurrence and development of atherosclerosis and the like. At present, a large number of human macrophages are difficult to obtain, and the amplification and gene manipulation are difficult to carry out, so that the related research and clinical application are greatly limited.

The main method currently adopted for differentiating human pluripotent stem cells into macrophages is an embryoid body (embryoid body) differentiation method. The method adopts human pluripotent cells cultured on mouse trophoblast to generate embryoid bodies, and the embryoid bodies with moderate sizes are differentiated in a culture solution containing macrophage stimulating factors and interleukin 3 for about 3-4 weeks. The main problems of this method are long differentiation cycle, low efficiency and animal origin components, which hamper its potential clinical application.

Disclosure of Invention

The method aims at creating a differentiation method, which is determined by a chemical composition and is a cell culture additive with low cost, so that the human pluripotent stem cells are promoted to be rapidly and efficiently differentiated into high-purity macrophages.

In a first aspect, the invention claims a kit for differentiating pluripotent stem cells into macrophages.

The invention discloses a kit for differentiating pluripotent stem cells into macrophages, which comprises a culture solution II, a culture solution III, a culture solution IV, a culture solution V, a culture solution VI and a culture solution VII;

the culture solution II is any one of the following (a 1) to (a 6):

(a1) A culture broth comprising an insulin-free B27 additive and human bone morphogenetic protein 4;

(a2) A culture broth comprising an insulin-free B27 additive and human bone morphogenetic protein 4; the volume percentage of the insulin-free B27 additive in the culture solution II is 1-2%; the concentration of the human bone morphogenetic protein 4 in the culture solution II is 5-10ng/ml;

(a3) A culture broth comprising an insulin-free B27 additive and human bone morphogenetic protein 4; the volume percentage of the insulin-free B27 additive in the culture solution II is 2%; the concentration of the human bone morphogenetic protein 4 in the culture solution II is 5ng/ml;

(a4) A culture broth comprising an insulin-free B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human bone morphogenetic protein 4;

(a5) A culture broth comprising an insulin-free B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human bone morphogenetic protein 4; the volume percentage of the insulin-free B27 additive in the culture solution II is 1-2%; the concentration of the L-glutamine or the substitute thereof in the culture solution II is 1-2mM; the concentration of glycine in the culture solution II is 7.5 mug/mL; the concentration of the L-alanine in the culture solution II is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution II is 14.70 mug/mL; the concentration of the L-proline in the culture solution II is 11.50 mug/mL; the concentration of the L-serine in the culture solution II is 10.5 mug/mL; the concentration of the penicillin in the culture solution II is 50-100U/ml; the concentration of the streptomycin in the culture solution II is 50-100 mug/ml; the concentration of the vitamin C in the culture solution II is 25-50ng/ml; the concentration of the human bone morphogenetic protein 4 in the culture solution II is 5-10ng/ml;

(a6) A culture broth comprising an insulin-free B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human bone morphogenetic protein 4; the volume percentage of the insulin-free B27 additive in the culture solution II is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution II is 2mM; the concentration of glycine in the culture solution II is 7.5 mug/mL; the concentration of the L-alanine in the culture solution II is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution II is 14.70 mug/mL; the concentration of the L-proline in the culture solution II is 11.50 mug/mL; the concentration of the L-serine in the culture solution II is 10.5 mug/mL; the concentration of the penicillin in the culture solution II is 100U/ml; the concentration of the streptomycin in the culture solution II is 100 mug/ml; the concentration of the vitamin C in the culture solution II is 50ng/ml; the concentration of the human bone morphogenetic protein 4 in the culture solution II is 5ng/ml.

The culture solution III is any one of the following (b 1) - (b 3):

(b1) Culture broth ii containing GSK3 inhibitor;

(b2) Culture broth II containing 1-2. Mu.M GSK3 inhibitor;

(b3) Culture broth II containing 2. Mu.M GSK3 inhibitor.

The culture solution IV is any one of the following (c 1) - (c 6):

(c1) A culture solution containing an insulin-added B27 additive, human vascular endothelial growth factor VEGF-165 and human fibroblast growth factor bFGF;

(c2) A culture solution containing an insulin-added B27 additive, human vascular endothelial growth factor VEGF-165 and human fibroblast growth factor bFGF; the volume percentage of the B27 additive added with the insulin in the culture solution IV is 1-2 percent; the concentration of the human vascular endothelial growth factor VEGF-165 in the culture solution IV is 25-50ng/ml; the concentration of the human fibroblast growth factor bFGF in the culture solution IV is 5-10ng/ml;

(c3) A culture solution containing an insulin-added B27 additive, human vascular endothelial growth factor VEGF-165 and human fibroblast growth factor bFGF; the volume percentage of the insulin-added B27 additive in the culture solution IV is 2%; the concentration of the human vascular endothelial growth factor VEGF-165 in the culture solution IV is 50ng/ml; the concentration of the human fibroblast growth factor bFGF in the culture solution IV is 10ng/ml;

(c4) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human vascular endothelial growth factor VEGF-165, and human fibroblast growth factor bFGF;

(c5) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human vascular endothelial growth factor VEGF-165, and human fibroblast growth factor bFGF; the volume percentage of the B27 additive added with the insulin in the culture solution IV is 1-2%; the concentration of the L-glutamine or the substitute thereof in the culture solution IV is 1-2mM; the concentration of glycine in the culture solution IV is 7.5 mug/mL; the concentration of the L-alanine in the culture solution IV is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution IV is 14.70 mug/mL; the concentration of the L-proline in the culture solution IV is 11.50 mug/mL; the concentration of the L-serine in the culture solution IV is 10.5 mug/mL; the concentration of the penicillin in the culture solution IV is 50-100U/ml; the concentration of the streptomycin in the culture solution IV is 50-100 mug/ml; the concentration of the vitamin C in the culture solution IV is 25-50ng/ml; the concentration of the human vascular endothelial growth factor VEGF-165 in the culture solution IV is 25-50ng/ml; the concentration of the human fibroblast growth factor bFGF in the culture solution IV is 5-10ng/ml;

(c6) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human vascular endothelial growth factor VEGF-165, and human fibroblast growth factor bFGF; the volume percentage of the insulin-added B27 additive in the culture solution IV is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution IV is 2mM; the concentration of glycine in the culture solution IV is 7.5 mug/mL; the concentration of the L-alanine in the culture solution IV is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution IV is 14.70 mug/mL; the concentration of the L-proline in the culture solution IV is 11.50 mug/mL; the concentration of the L-serine in the culture solution IV is 10.5 mug/mL; the concentration of the penicillin in the culture solution IV is 100U/ml; the concentration of the streptomycin in the culture solution IV is 100 mug/ml; the concentration of the vitamin C in the culture solution IV is 50ng/ml; the concentration of the human vascular endothelial growth factor VEGF-165 in the culture solution IV is 50ng/ml; the concentration of the human fibroblast growth factor bFGF in the culture solution IV is 10ng/ml.

The culture solution V is any one of the following (d 1) to (d 3):

(d1) Culture IV containing TGF beta inhibitor;

(d2) Culture IV containing 5-10. Mu.M TGF-beta inhibitor;

(d3) Culture IV containing 10. Mu.M TGF-beta inhibitor.

The culture solution VI is any one of the following (e 1) to (e 6):

(e1) A culture medium containing an insulin-added B27 additive, human interleukin-3 and human macrophage colony stimulating factor;

(e2) A culture medium containing an insulin-added B27 additive, human interleukin-3 and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VI is 1-2 percent; the concentration of the human interleukin-3 in the culture solution VI is 10-20ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VI is 50-100ng/ml;

(e3) A culture medium containing an insulin-added B27 additive, human interleukin-3 and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VI is 2 percent; the concentration of the human interleukin-3 in the culture solution VI is 10ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VI is 50ng/ml;

(e4) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human interleukin-3, and human macrophage colony stimulating factor;

(e5) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human interleukin-3, and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VI is 1-2 percent; the concentration of the L-glutamine or the substitute thereof in the culture solution VI is 1-2mM; the concentration of glycine in the culture solution VI is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VI is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VI is 14.70 mug/mL; the concentration of the L-proline in the culture solution VI is 11.50 mug/mL; the concentration of L-serine in the culture solution VI is 10.5 mug/mL; the concentration of the penicillin in the culture solution VI is 50-100U/ml; the concentration of streptomycin in the culture solution VI is 50-100 mug/ml; the concentration of the vitamin C in the culture solution VI is 25-50ng/ml; the concentration of the human interleukin-3 in the culture solution VI is 10-20ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VI is 50-100ng/ml;

(e6) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human interleukin-3, and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VI is 2 percent; the concentration of the L-glutamine or the substitute thereof in the culture solution VI is 2mM; the concentration of glycine in the culture solution VI is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VI is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VI is 14.70 mug/mL; the concentration of the L-proline in the culture solution VI is 11.50 mug/mL; the concentration of L-serine in the culture broth VI was 10.5. Mu.g/mL. The concentration of the penicillin in the culture solution VI is 100U/ml; the concentration of streptomycin in culture solution VI is 100 mug/ml; the concentration of the vitamin C in the culture solution VI is 50ng/ml; the concentration of the human interleukin-3 in the culture solution VI is 10ng/ml; the concentration of the human macrophage colony stimulating factor in culture solution VI is 50ng/ml.

The culture solution VII is any one of the following (f 1) to (f 6):

(f1) A culture medium containing an insulin-supplemented B27 additive and human macrophage colony stimulating factor;

(f2) A culture medium containing an insulin-supplemented B27 additive and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VII is 1-2%; the concentration of the human macrophage colony stimulating factor in the culture solution VII is 50-100ng/ml;

(f3) A culture medium containing an insulin-supplemented B27 additive and human macrophage colony stimulating factor; the volume percentage of the insulin-added B27 additive in the culture solution VII is 2%; the concentration of the human macrophage colony stimulating factor in the culture solution VII is 50ng/ml;

(f4) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human macrophage colony stimulating factor;

(f5) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human macrophage colony stimulating factor; the volume percentage of the B27 additive added with the insulin in the culture solution VII is 1-2%; the concentration of the L-glutamine or the substitute thereof in the culture solution VII is 1-2mM; the concentration of glycine in the culture solution VII is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VII is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VII is 14.70 mug/mL; the concentration of the L-proline in the culture solution VII is 11.50 mug/mL; the concentration of the L-serine in the culture solution VII is 10.5 mug/mL; the concentration of the penicillin in the culture solution VII is 50-100U/ml; the concentration of streptomycin in the culture solution VII is 50-100 mug/ml; the concentration of the vitamin C in the culture solution VII is 25-50ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VII is 50-100ng/ml;

(f6) A culture medium containing an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, and human macrophage colony stimulating factor; the volume percentage of the insulin-added B27 additive in the culture solution VII is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution VII is 2mM; the concentration of glycine in the culture solution VII is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VII is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VIII is 14.70 mug/mL; the concentration of the L-proline in the culture solution VII is 11.50 mug/mL; the concentration of the L-serine in the culture solution VII is 10.5 mug/mL; the concentration of the penicillin in the culture solution VII is 100U/ml; the concentration of streptomycin in the culture solution VII is 100 mug/ml; the concentration of the vitamin C in the culture solution VII is 50ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VII is 50ng/ml.

The composition of the culture solution II is as follows: insulin-free B27 additive, human bone morphogenic protein 4, and cell basal broth.

The composition of the culture solution II is as follows: insulin-free B27 supplement, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human bone morphogenetic protein 4, and cell basal broth.

The composition of the culture solution III is as follows: GSK3 inhibitor and culture solution II.

The composition of the culture solution IV is as follows: insulin-added B27 additive, human vascular endothelial growth factor VEGF-165, human fibroblast growth factor and cell basal culture solution.

The composition of the culture solution IV is as follows: insulin-added B27 additive, L-glutamine or its substitute, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human vascular endothelial growth factor VEGF-165, human fibroblast growth factor and cell basal culture solution.

The culture solution V comprises the following components: TGF beta inhibitor and culture solution IV.

The composition of the culture solution VI is as follows: insulin-added B27 additive, human interleukin-3, human macrophage colony stimulating factor and cell basic culture liquid.

The composition of the culture solution VI is as follows: insulin-added B27 additive, L-glutamine or its substitute, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human interleukin-3, human macrophage colony stimulating factor and cell basal culture fluid.

The composition of the culture solution VII is as follows: insulin-supplemented B27 supplement, human macrophage colony stimulating factor and cell basal broth.

The composition of the culture solution VII is as follows: insulin-added B27 additive, L-glutamine or its substitute, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human macrophage colony stimulating factor and cell basal culture liquid.

Any of the above cell basal culture fluids may specifically be RPMI 1640 basal culture fluid.

Further, the L-glutamine or a substitute thereof is Glutamax, specifically "Glutamax ^TM Support "(e.g., gibco #35050061, or other products of the same composition). The said "GlutaMAX ^TM The component of the Supplement "was L-alanyl-L-glutamine, which was an alternative to L-glutamine, at a concentration of 200mM, and a solvent of 0.85% NaCl solution.

The protein sequence of any of the above human bone morphogenetic protein 4 (BMP 4) is shown in SEQ ID No.1.

The protein sequence of any of the above angiogenic factors (VEGF-165) is shown in SEQ ID No.2.

The protein sequence of any one of the human fibroblast growth factor (bFGF) is shown in SEQ ID No.3.

The protein sequence of any one of the human interleukin-3 (IL 3) is shown in SEQ ID No.4.

The protein sequence of the human macrophage colony stimulating factor (M-CSF) is shown in SEQ ID No.5.

In a second aspect, the invention claims a kit for differentiating hematopoietic stem cells into macrophages.

The kit for differentiating hematopoietic stem cells into macrophages, which is claimed in the present invention, comprises the aforementioned culture solution VI and the aforementioned culture solution VII.

In a first aspect, the GSK3 inhibitor may be any one of the following (g 1) - (g 4):

(g1)CHIR-99021；

(g2)B216763；

(g3)BIO；

(g4)TWS119。

in the first and second aspects, the tgfβ inhibitor may be SB431542.

In a first aspect, the kit may further comprise a culture broth i; the culture solution I may be any one of the following (h 1) to (h 6):

(h1) Stem cell culture fluid containing ROCK inhibitor;

(h2) Stem cell culture medium containing 5-10 μm ROCK inhibitor;

(h3) Stem cell culture medium containing 10 μm ROCK inhibitor;

(h4) A stem cell culture broth comprising Y27632;

(h5) Stem cell culture medium containing 5-10 mu M Y27632;

(h6) Stem cell culture broth containing 10mu M Y27632.

The composition of the culture solution I is as follows: ROCK inhibitors and stem cell culture fluids.

The composition of the culture solution I is as follows: inhibitors of Y27632 and stem cell culture broth.

Wherein, the stem cell culture solution can be TeSR-E8 culture solution.

In a third aspect, the invention claims a method of differentiating pluripotent stem cells into macrophages.

The method for differentiating the pluripotent stem cells into the macrophages, which is claimed by the invention, can comprise the following steps:

(2) Inoculating pluripotent stem cells into the culture solution II, and culturing for 0.5-1.5 days (such as 1 day);

(3) Changing the culture solution in the step (2) into the culture solution III, and culturing for 1.5-2.5 days (such as 2 days);

(4) Transferring the cells of step (3) to the culture solution IV described above, and culturing for 1.5-2.5 days (e.g., 2 days);

(5) Changing the culture solution in the step (4) into the culture solution V, and culturing for 2-4 days (such as 3 days);

(6) Transferring the cells obtained in the step (5) into the culture solution VI, and culturing for 4-6 days (such as 5 days);

(7) Transferring the cells obtained in the step (6) to the culture solution VII described above, and culturing for 2-4 days (e.g., 3 days).

Further, step (1) may be further included before step (2): pluripotent stem cells were inoculated into the culture medium I described above and cultured.

Still further, the step (1) may be: (a) Inoculating pluripotent stem cells into the culture solution I for culturing for 0.5-1.5 days (such as 1 day); (b) The culture solution in step (a) is replaced with the stem cell culture solution described above for 0.5-1.5 days (e.g., 1 day).

In a fourth aspect, the invention claims a method of differentiating hematopoietic stem cells into macrophages.

The method for differentiating hematopoietic stem cells into macrophages claimed in the present invention may comprise the steps of:

(6) Inoculating hematopoietic stem cells into culture solution VI, and culturing for 4-6 days (such as 5 days);

In either of the third and fourth aspects, the culturing conditions are 37℃and 5% CO ₂ . Any of the cultures can be carried out using Marigel coated dishes, specifically coated at 37℃for 2h.

In a fifth aspect, the invention claims the use of a kit as described hereinbefore for the preparation of macrophages.

Further, the use is to prepare macrophages starting from pluripotent stem cells (corresponding to the kit of the first aspect) or hematopoietic stem cells (corresponding to the kit of the second aspect).

In the present invention, the pluripotent stem cells are specifically human pluripotent stem cells; the hematopoietic stem cells are specifically human hematopoietic stem cells.

Any of the above human pluripotent stem cells are human embryonic stem cell lines or human induced pluripotent stem cells.

The human embryonic stem cell line is a commercial human embryonic stem cell line, such as human embryonic stem cell line H1. The human embryonic stem cell line H1 may be specifically derived from the american WiCell cell pool, accession No.: WA01. The human induced pluripotent stem cell is CD34-iPSC. The induced pluripotent stem cell CD34-iPSC is obtained by inducing human umbilical cord blood hematopoietic stem cells (CD 34 positive cells) to be reprogrammed by using a Sendai virus reprogramming kit (Invitrogen, cat# A16517).

The invention develops a culture solution additive capable of greatly enhancing the differentiation efficiency of human pluripotent stem cells into macrophages, and the additive does not contain animal-derived components, has definite chemical components and is favorable for being used as a clinical-grade stem cell differentiation culture system. The invention also provides a novel method for differentiating human pluripotent stem cells into macrophages, which can remarkably improve differentiation efficiency and reduce differentiation cost compared with the existing method.

The preparation method provided by the invention can be used for obtaining macrophages, hematopoietic stem cells are firstly differentiated by adopting a monolayer cell culture method, and micromolecules for regulating and controlling WNT and TGF beta signal channels and differentiation methods for removing insulin in a staged manner are added in a staged manner. The method has the advantages of definite chemical components, no animal source component, greatly improved safety of cell preparation, short time consumption, high differentiation efficiency, low cost, etc. The preparation method provided by the invention can be used for producing human macrophages on a large scale, has stable quality and high safety, and provides a large amount of cell sources for tissue engineering, drug development and cell treatment.

In a word, the invention adopts a staged induction method based on monolayer cell differentiation, can obtain a large number of macrophages from human pluripotent stem cells in about 16 days, greatly shortens the differentiation period, improves the differentiation efficiency, ensures the chemical composition, and is beneficial to the future application in clinical cell replacement therapy.

Drawings

FIG. 1 is a morphological diagram of human pluripotent stem cells.

FIG. 2 is a graph showing morphological changes during H1 differentiation into macrophages.

FIG. 3 is a graph showing morphological changes during differentiation of CD34-iPSC into macrophages.

FIG. 4 shows the results of a cell flow cytometer for hematopoietic progenitor cell surface marker detection.

FIG. 5 shows the results of a cell flow cytometer for macrophage surface marker detection.

FIG. 6 shows immunofluorescence results of macrophage surface marker detection.

FIG. 7 shows Giemsa staining of macrophages.

FIG. 8 shows the results of phagocytic function assay of macrophages.

FIG. 9 shows the results of macrophage LPS stimulation.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Human embryonic stem cell line H1 (abbreviated as H1 cells): wicell cell Bank, USA, accession number: WA01.

Induced pluripotent stem cells CD34-iPSC (abbreviated as CD34-iPSC cells): the human cord blood hematopoietic stem cells (CD 34 positive cells) were induced to be reprogrammed using the Sendai virus reprogramming kit (Invitrogen, cat# A16517), and the specific method was performed according to the kit instructions.

DMEM broth: gibco company, cat: 11965092.

RPMI1640 basal medium: thermo fisher company, cat: 11875093.

TeSR-E8 culture solution: STEMCELL company, cat No.: 05990.

E8-Y culture solution is TeSR-E8 culture solution containing 5-10 mu M ROCK inhibitor Y27632; in the examples of the present invention, the concentration of ROCK inhibitor Y27632 in E8-Y broth was 10. Mu.M.

The M1 culture medium is RPMI1640 culture medium containing 1-2% (v/v) of insulin-free B27 additive (B27 minus insulin), 0.5-1% (v/v) of Glutamax (L-alkyl-L-glutamine final concentration 1-2 mM), 0.5-1% (v/v) of optional amino acid (NEAA), 50-100U/ml of penicillin, 50-100 μg/ml of streptomycin, 25-50ng/ml of vitamin C and 5-10ng/ml of human bone morphogenetic protein 4 (BMP 4). In the embodiment of the invention, the concentration of each component in the M1 culture solution is as follows: 2% (v/v) of insulin-free B27 additive (B27 minus insulin), 1% (v/v) of Glutamax (final L-alanyl-L-glutamine concentration 2 mM), 1% (v/v) of nonessential amino acid (NEAA), 100U/ml of penicillin, 100. Mu.g/ml of streptomycin, 50ng/ml of vitamin C,5ng/ml of human bone morphogenetic protein 4 (BMP 4).

The M2 culture medium is RPMI1640 culture medium containing 1-2% (v/v) of B27 additive (B27 supplement), 0.5-1% (v/v) of Glutamax (L-alanyl-L-glutamine final concentration is 1-2 mM), 0.5-1% (v/v) of unnecessary amino acid (NEAA), 50-100U/ml of penicillin, 50-100 μg/ml of streptomycin, 25-50ng/ml of vitamin C, 25-50ng/ml of human vascular endothelial growth factor (VEGF-165) and 5-10ng/ml of human fibroblast growth factor (bFGF). In the embodiment of the invention, the concentration of each component in the M2 culture solution is as follows: 2% (v/v) B27 additive (B27 supplement), 1% (v/v) Glutamax (L-alanyl-L-glutamine final concentration 2 mM), 1% (v/v) nonessential amino acid (NEAA), 100U/ml penicillin, 100. Mu.g/ml streptomycin, 50ng/ml vitamin C,50ng/ml human vascular endothelial growth factor (VEGF-165), 10ng/ml human fibroblast growth factor (bFGF).

The M3 culture medium is RPMI1640 culture medium containing 1-2% (v/v) B27 additive (B27 supplement) 0.5-1% (v/v) Glutamax (L-alanyl-L-glutamine final concentration 1-2 mM), 0.5-1% (v/v) nonessential amino acid (NEAA), 50-100U/ml penicillin, 50-100ug/ml streptomycin, 25-50ng/ml vitamin C, 10-20ng/ml human interleukin-3 (IL 3), and 50-100ng/ml human macrophage colony stimulating factor (M-CSF). In the embodiment of the invention, the concentration of each component in the M3 culture solution is as follows: 2% (v/v) B27 additive (B27 supplement), 1% (v/v) Glutamax (L-alanyl-L-glutamine final concentration 2 mM), 1% (v/v) nonessential amino acid (NEAA), 100U/ml penicillin, 100ug/ml streptomycin, 50ng/ml vitamin C,10ng/ml human interleukin-3 (IL 3) and 50ng/ml human macrophage colony stimulating factor (M-CSF)

Non-essential amino acids (NEAA, 100×): gibco company, cat: 11140050; in the embodiment of the invention, the concentration of each amino acid in the M1 culture solution or the M2 culture solution is as follows: glycine 7.5 μg/mL, L-alanine 8.9 μg/mL, L-aspartic acid 13.20 μg/mL, L-aspartic acid 13.30 μg/mL, L-glutamic acid 14.70 μg/mL, L-proline 11.50 μg/mL, L-serine 10.50 μg/mL.

Insulin-containing B27 additive (B27 supplement): gibco company, cat: 17504-044.

Insulin-free B27 additive (B27 minus insulin): gibco company, cat: A1895601.

glutamax: gibco company, cat: 35050061.

vitamin C: sigma Aldrich company, cat: A4403.

ROCK inhibitor Y27632: targetMol company, cat: t1870. The structural formula of Y27632 is as follows:

human bone morphogenic protein 4 (BMP 4): r & D BioSystems, inc., cat: 314-BP; the protein sequence is shown in SEQ ID No.1.

Angiogenic factor (VEGF-165): the product number of SinoBiological company is: 11066-HNAH; the protein sequence is shown in SEQ ID No.2.

Human fibroblast growth factor (bFGF): the product number of SinoBiological company is: 10014-HNAE; the protein sequence is shown in SEQ ID No.3.

Human interleukin-3 (IL 3): peprotech company, cat: 200-03-10; the protein sequence is shown in SEQ ID No.4.

Human macrophage colony stimulating factor (M-CSF): peprotech company, cat: 300-25-10; the protein sequence is shown in SEQ ID No.5.

GSK3 inhibitor CHIR-99021: tocris Biosciences company, cat#: 4423/10. The structural formula of CHIR-99021 is as follows:

tgfβ inhibitor SB431542: selleck company, cat No.: s1067. The structural formula of SB431542 is as follows:

cell digest Accutase: merk Millipore Inc., cat: SF006.

0.25% Trypsin: gibco company, cat#: 25200056.

matrigel: BD Biosciences company, cat no: 356231.

PE-labeled CD43 antibody: the product number was from eBioscience: 12-0439-42.

APC-labeled CD34 antibodies: miltenyi Inc., cat#: 555824.

FITC-labeled CD45 antibody: miltenyi Inc., cat#: 130-113-679.

FITC-labeled CD14 antibody: biolegend company, cat: 301804.

APC-labeled CD11b antibody: biolegend company, cat: 301309.

PE-labeled CD163 antibodies: biolegend company, cat: 326505.

FITC-labeled mouse anti-human IgG antibody: the product number was from eBioscience: 11-4714-42.

PE-labeled mouse anti-human IgG antibody: the product number was from eBioscience: 12-4714-42.

APC-labeled mouse anti-human IgG antibodies: the product number was from eBioscience: 17-4714-42.

Anti-human CD163 antibodies: biolegend company, cat: 333602

Anti-human CD14 antibody: biolegend company, cat: 367101

Dylight 488 labeled secondary antibody: thermo company, with the product number: r37120.

Nuclear dye DAPI: sigma-Aldrich, cat#: d9542

Lipopolysaccharide LPS: sigma-Aldrich, cat#: l2880-10MG.

Giemsa dye liquor: sigma-Aldrich, cat#: G4507-5G.

RNA extract: invitrogen corporation: the goods number is: 15596026

5 x All-In-One RT Master mix reverse transcription kit:

company, product number: g490

qPCR master mix fluorescent quantitative PCR kit: promega Corp, cat: a6001

Example 1 differentiation of human pluripotent Stem cells into macrophages

The human pluripotent stem cells used in this example were two, H1 cells and CD34-iPSC cells, respectively.

1. Human pluripotent stem cells were seeded in 6-well plates (2.5X10 per well) ⁵ Cells), teSR-E8 culture solution is adopted, and the cells are cultured at 37 ℃ until the confluency of the cells is 70-80 percent.

2. After the completion of step 1, the six-well plate was taken, the culture supernatant was aspirated, and PBS buffer preheated to 37℃was added for washing 2 times. At this time, the morphology of H1 cells and CD34-iPSC cells is shown in FIG. 1 (scale bar 100 μm).

3. After the step 2 is completed, taking the six-hole plate, adding 1ml of cell digestive juice Acceutase into each hole, standing for 3-5min at 37 ℃, adding a proper amount of RPMI 1640 basic culture solution to terminate digestion, and centrifugally collecting cells.

4. Inoculating the cells collected in step 3 into a culture dish (the culture dish has been coated with Marigel at 37deg.C for 2 hr) at an inoculation density of 2.0X10 ⁴ Individual/cm ² －4.0×10 ⁴ Individual/cm ² E8-Y culture solution is adopted, and the temperature is 37 ℃ and the concentration of CO is 5 percent ₂ Culturing in an incubator for 1 day.

5. After completion of step 4, the culture dish was taken, the culture supernatant was discarded, and replaced with fresh TeSR-E8 broth at 37℃with 5% CO ₂ Culturing in an incubator for 1 day.

6. After the completion of step 5, the culture dish was taken, the culture supernatant was discarded, and the culture was replaced with M1 broth, at 37℃with 5% CO ₂ Culturing in an incubator for 1 day.

7. After completion of step 6, the culture dish was taken, the culture supernatant was discarded, and the culture was replaced with M1 broth containing 2. Mu.M GSK3 inhibitor CHIR-99021, at 37℃with 5% CO ₂ Culturing in an incubator for 2 days.

8. After the completion of the step 6, the culture dish was taken, the culture supernatant was discarded, an appropriate amount of 0.25% Trypsin was added to digest it to a single cell state, then the digestion was stopped by adding DMEM medium containing 10% (v/v) fetal bovine serum, and the cells were collected by centrifugation.

9. Inoculating the cells collected in step 8 into a culture dish (the culture dish has been coated with Marigel at 37deg.C for 2 h) at an inoculation density of 2.5X10 ⁴ Individual/cm ² －5.0×10 ⁴ Individual/cm ² M2 culture solution is adopted, and the temperature is 37 ℃ and CO is 5 percent ₂ Incubators were incubated for 2 days (fresh M2 broth was changed daily).

10. After completion of step 9, the dishes were taken and added with TGF-beta inhibitor SB431542, the TGF-beta inhibitor SB431542 concentration in the culture system was 10. Mu.M, at 37℃with 5% CO ₂ The cells were cultured in the incubator for 3 days, and it was gradually seen that colony-like cells began to appear, and were in a suspended state, which was cell A.

11. After completion of step 10, the culture dish was taken, the suspension cells were collected, transferred to M3 medium, and cultured at 37℃in 5% CO ₂ Culturing in incubator for 5 days, and changing half of culture solution every other day.

12. After 5 daysTaking the culture dish, collecting cells, transferring to M3 medium with human interleukin 3 removed, and extracting at 37deg.C with 5% CO ₂ Culturing was continued in the incubator for 3 days to obtain cell B.

During the above culture, the morphology change of the human pluripotent stem cells was observed (day 0 is the time when the culture solution M1 was added in step 6). The morphological changes of human pluripotent stem cells to macrophages are shown in FIG. 2 (H1 cells, scale bar 50 microns) and FIG. 3 (CD 34-iPSC cells, scale bar 50 microns). The result shows that the form of the human pluripotent stem cells is gradually changed into the form of macrophages, and the cells of the human pluripotent stem cells contain a plurality of vacuole structures with different sizes in vivo, and are in an adherent state in a long-spindle shape.

Example 2 detection of cells during the differentiation of pluripotent Stem cells into megaphaga

1. Flow cytometry detection of cell a and cell B

1. Cell A obtained in step 9 of example 1 and cell B obtained in step 12 were resuspended in PBS buffer containing 5% (v/v) fetal bovine serum to give cell A suspension (containing 1X 10) ⁵ Individual cells), cell B suspension (containing 1X 10 ⁵ Individual cells).

2. PE-labeled CD43 antibody (volume ratio 1:50) and APC-labeled CD34 antibody (volume ratio 1:50) were added to the A cell suspension of step 1, respectively, PE-labeled CD43 antibody (volume ratio 1:50), APC-labeled CD34 antibody (volume ratio 1:50), FITC-labeled CD45 antibody (volume ratio 1:50), FITC-labeled CD14 antibody (volume ratio 1:50), APC-labeled CD11B antibody (volume ratio 1:50), PE-labeled CD163 antibody (volume ratio 1:50) were added to the B cell suspension of step 1, respectively, and incubation was performed at room temperature in the dark for 20 minutes. Cells were then collected by centrifugation by washing 2 times with PBS buffer containing 5% (v/v) fetal bovine serum. Blank controls used IgG antibodies to the corresponding fluorescent channels.

3. After completion of step 2, the cells were resuspended in 500. Mu.L of PBS buffer containing 5% (v/v) fetal bovine serum and examined using a flow cytometer.

Cell A and cell B obtained by H1 cell differentiation were examined as shown in FIGS. 4 and 5. The results showed that about 96% of cells expressing CD43 on day 8, about 74% of the double positive hematopoietic progenitor cells of CD34 and CD43, were differentiated by culture medium M2, demonstrating that a number of hematopoietic precursor cells were obtained within 8 days. And (3) culturing the cell A in an M3 culture medium for 5 days, and culturing the cell A in the M3 culture medium with the human interleukin 3 removed for 3 days to obtain a cell B, wherein the flow detection result of the FIG. 5 shows that the cell B expresses typical macrophage surface markers CD14, CD163 and CD11B, simultaneously highly expresses blood cell markers CD45 and CD43 and does not express hematopoietic stem cell marker CD34, so that the differentiated cell B has the characteristics of typical macrophage surface markers.

2. Immunofluorescence detection of cell B

1. Cell B obtained in step 12 of example 1 was taken and fixed with 4% paraformaldehyde at room temperature for 10 minutes, then 4% (v/v) paraformaldehyde was aspirated, and washed 3 times with PBS buffer.

2. After the step 1 is completed, PBS buffer solution containing 0.25% (v/v) Triton X-100 is added, and the mixture is kept stand for 20 minutes at room temperature; then, PBS buffer containing 5% (v/v) BSA was added thereto and the mixture was blocked at room temperature for 1 hour.

3. After completion of step 2, anti-human CD163 antibody, anti-human CD14 antibody were added (volume ratio 1:100), incubated at room temperature for 2 hours, and then washed 3 times with PBST (PBS buffer containing 0.1% (v/v) Tween-20).

4. After completion of step 3, dyight 488 (volume ratio 1:500) labeled secondary antibodies were added, respectively, incubated for 1h at room temperature, and then washed 3 times with PBST buffer.

5. After completion of step 4, 1mg/mL (volume ratio 1:1000) DAPI was added, incubated at room temperature for 20 minutes, and then washed 3 times with PBST buffer. The cells were observed under a fluorescence microscope for staining.

Staining of cell B with H1 cells under fluorescence microscopy is shown in fig. 6 (scale bar 100 microns). The results indicated that cell B expressed CD14 and CD163 macrophage surface markers, indicating that it is a macrophage.

The results show that the culture solution M3 can efficiently induce and differentiate the human pluripotent stem cells into macrophages.

3. Giemsa staining experiments on cell B.

1. The concentration of cell B obtained in step 12 of example 1 was adjusted to 1X 10 ⁷ Dropping 10 mu l of the sample onto the glass slide, putting another glass slide on the glass slide at 45 degrees to just contact the glass slide, and then smoothly pushing the upper glass slide to the other side to generate a uniform cell liquid film;

2. placing the lower glass slide in formaldehyde for fixing for 5-7 minutes;

3. taking out the glass slide and drying the glass slide by air;

4. the Giemsa dye liquor is diluted with double distilled water in a ratio of 1:20 (dyeing effect is related to dilution ratio and buffer);

5. staining the slide glass for 15-60 minutes according to the situation;

6. taking out the glass slide, and slightly rinsing with water until the dye solution is removed;

7. air-dried, observed under a microscope and recorded by photographing.

As a result, as shown in FIG. 7 (scale bar 50 μm), it was found that the cells had a larger volume and a diameter of about 20. Mu.m, and that the nuclei were round and the cytoplasm contained many vacuolated structures of different sizes, which were typical macrophage morphology.

4. Macrophage phagocytosis assay

1. Cell B obtained in step 12 of example 1 was subjected to a procedure of 1X 10 ⁵ Individual/cm ² Inoculating the culture medium into a cell culture plate, and culturing overnight to adhere the culture medium;

2. the next day, candida albicans in proportion: cells = 5:1 concentration, fluorescently labeled candida albicans (university of bloom Lin Xin laboratory, ref: JNK1negatively controls antifungal innate immunity by suppressing cd23expression. Nature Medicine 2017,23 (3): 337-346.Doi: 10.1038/nm.4260.) were inoculated onto the cells and incubated for 2-4 hours; using the mesenchymal stem cells as a cell negative control;

3. after 2-4 hours, the culture solution was aspirated, gently rinsed 3 times with PBS, and then the cells were gently scraped with a gun head, blown into single cell suspension, and the phagocytosis ratio was detected by flow cytometry.

The results in FIG. 8 show that cell B can swallow fluorescent-labeled Candida albicans into its cells, about 76% of cell B phagocytes GFP-labeled Candida albicans after two hours of incubation in flow assay, while the mesenchymal cells of the negative control do not have the ability to phagocytize fungi, demonstrating that the differentiated cell B has the ability to phagocytize pathogenic microorganisms, conforming to the functional characteristics of macrophages.

5. LPS-stimulated macrophage assay

1. The cell B obtained in step 10 of example 1 was subjected to a procedure of 2X 10 ⁵ Individual/cm ² Is inoculated into a cell culture plate, and is cultured overnight to adhere to the cell culture plate.

2. The following day, cells were stimulated with 10ng/ml Lipopolysaccharide (LPS) for 12 hours and negative controls were not fed with LPS.

3. After step 2 was completed, the supernatant was aspirated, and after 2 washes with PBS, the PBS was aspirated.

4. After completion of step 3, 1ml was added

Extracting total RNA in cells.

5. After completion of step 4, reverse transcription was performed using a 5×all-In-One RT Master mix reverse transcription kit, and first strand cDNA was synthesized by reverse transcription according to the procedure described.

6. After the completion of step 5, Q-PCR was performed using the above cDNA as a template and a Promega kit, and the system was as shown in Table 1:

TABLE 1 fluorescent quantitative PCR reaction System (10 μl)

The reaction was performed on a fluorescent quantitative PCR apparatus CFX 96 (BIO-RAD) with the following procedure:

94℃5min；94℃30s；

repeating 40 cycles at 60 ℃ for 30s and 72 ℃ for 30 s;

72℃10min。

the qRT-PCR primer sequences used in the detection in this experiment are shown in Table 2, and GAPDH is an internal reference gene.

TABLE 2 fluorescent quantitative PCR primers

Gene	Forward primer (5 '-3')	Reverse primer (5 '-3')
			GAPDH	TGATGACATCAAGAAGGTGGTGAAG	TCCTTGGAGGCCATGTGGGCCAT
TNFa	CCTCTCTCTAATCAGCCCTCTG	GAGGACCTGGGAGTAGATGAG
			IL6	ACCCCCAATAAATATAGGACTGGA	TTCTCTTTCGTTCCCGGTGG
IL1b	ATGATGGCTTATTACAGTGGCAA	GTCGGAGATTCGTAGCTGGA
			IL10	TTCCAGTGTCTCGGAGGGAT	GCTGGCCACAGCTTTCAAGA
CCL2	CAGCCAGATGCAATCAATGCC	CAGCCAGATGCAATCAATGCC

As shown in fig. 9, cell B in example 1 was able to significantly up-regulate the expression of inflammatory cytokines and chemokines such as tnfα, IL1B, IL6, IL10 and CCL2 after stimulation with LPS, and had a similar response to that of macrophages in vivo after stimulation with LPS, demonstrating that cell B was able to up-regulate inflammatory response to inflammatory cytokines after stimulation with LPS, compared to the negative control group.

The results show that the culture solutions M1, M2 and M3 can efficiently induce and differentiate the human pluripotent stem cells into macrophages.

<110> university of Qinghua

<120> a method for differentiating human pluripotent stem cells into macrophages

<130> CGGNQALN196073

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 117

<212> PRT

<213> Artificial sequence

<400> 1

Met Ser Pro Lys His His Ser Gln Arg Ala Arg Lys Lys Asn Lys Asn

1 5 10 15

Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn

20 25 30

Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala Phe Tyr Cys His Gly

35 40 45

Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala

50 55 60

Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Ser Ile Pro Lys Ala

65 70 75 80

Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Ser Met Leu Tyr Leu Asp

85 90 95

Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu Met Val Val Glu

100 105 110

Gly Cys Gly Cys Arg

115

<210> 2

<211> 191

<212> PRT

<213> Artificial sequence

<400> 2

Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu

1 5 10 15

Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly

20 25 30

Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln

35 40 45

Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu

50 55 60

Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu

65 70 75 80

Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro

85 90 95

Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His

100 105 110

Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys

115 120 125

Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Lys Lys Ser Val

130 135 140

Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Tyr

145 150 155 160

Lys Ser Trp Ser Val Tyr Val Gly Ala Arg Cys Cys Leu Met Pro Trp

165 170 175

Ser Leu Pro Gly Pro His Pro Cys Gly Pro Cys Ser Glu Arg Arg

180 185 190

<210> 3

<211> 147

<212> PRT

<213> Artificial sequence

<400> 3

Met Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly

1 5 10 15

His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe

20 25 30

Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser

35 40 45

Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val

50 55 60

Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp

65 70 75 80

Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe

85 90 95

Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr

100 105 110

Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly

115 120 125

Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser

130 135 140

Ala Lys Ser

145

<210> 4

<211> 133

<212> PRT

<213> Artificial sequence

<400> 4

Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp Val Asn Cys

1 5 10 15

Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln Pro Pro Leu

20 25 30

Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu

35 40 45

Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe Asn Arg Ala

50 55 60

Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile Leu Lys Asn

65 70 75 80

Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro

85 90 95

Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg Lys Leu Thr

100 105 110

Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln Thr Thr Leu

115 120 125

Ser Leu Ala Ile Phe

130

<210> 5

<211> 159

<212> PRT

<213> Artificial sequence

<400> 5

Met Glu Glu Val Ser Glu Tyr Cys Ser His Met Ile Gly Ser Gly His

1 5 10 15

Leu Gln Ser Leu Gln Arg Leu Ile Asp Ser Gln Met Glu Thr Ser Cys

20 25 30

Gln Ile Thr Phe Glu Phe Val Asp Gln Glu Gln Leu Lys Asp Pro Val

35 40 45

Cys Tyr Leu Lys Lys Ala Phe Leu Leu Val Gln Asp Ile Met Glu Asp

50 55 60

Thr Met Arg Phe Arg Asp Asn Thr Pro Asn Ala Ile Ala Ile Val Gln

65 70 75 80

Leu Gln Glu Leu Ser Leu Arg Leu Lys Ser Cys Phe Thr Lys Asp Tyr

85 90 95

Glu Glu His Asp Lys Ala Cys Val Arg Thr Phe Tyr Glu Thr Pro Leu

100 105 110

Gln Leu Leu Glu Lys Val Lys Asn Val Phe Asn Glu Thr Lys Asn Leu

115 120 125

Leu Asp Lys Asp Trp Asn Ile Phe Ser Lys Asn Cys Asn Asn Ser Phe

130 135 140

Ala Glu Cys Ser Ser Gln Gly His Glu Arg Gln Ser Glu Gly Ser

145 150 155

Claims

1. A kit for differentiating pluripotent stem cells into macrophages comprises a culture solution II, a culture solution III, a culture solution IV, a culture solution V, a culture solution VI and a culture solution VII;

the culture solution II consists of an insulin-free B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human bone morphogenetic protein 4 and a cell basal culture solution; the volume percentage of the insulin-free B27 additive in the culture solution II is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution II is 2 mM; the concentration of glycine in the culture solution II is 7.5 mug/mL; the concentration of the L-alanine in the culture solution II is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution II is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution II is 14.70 mug/mL; the concentration of the L-proline in the culture solution II is 11.50 mug/mL; the concentration of the L-serine in the culture solution II is 10.5 mug/mL; the concentration of the penicillin in the culture solution II is 100U/ml; the concentration of the streptomycin in the culture solution II is 100 mug/ml; the concentration of the vitamin C in the culture solution II is 50ng/ml; the concentration of the human bone morphogenetic protein 4 in the culture solution II is 5ng/ml;

The culture solution III consists of CHIR-99021 and the culture solution II; the concentration of the CHIR-99021 in the culture solution II is 2 mu M;

the culture solution IV is prepared from an insulin-added B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human vascular endothelial growth factor VEGF-165 and human fibroblast growth factor; the volume percentage of the insulin-added B27 additive in the culture solution IV is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution IV is 2mM; the concentration of glycine in the culture solution IV is 7.5 mug/mL; the concentration of the L-alanine in the culture solution IV is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution IV is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution IV is 14.70 mug/mL; the concentration of the L-proline in the culture solution IV is 11.50 mug/mL; the concentration of the L-serine in the culture solution IV is 10.5 mug/mL; the concentration of the penicillin in the culture solution IV is 100U/ml; the concentration of the streptomycin in the culture solution IV is 100 mug/ml; the concentration of the vitamin C in the culture solution IV is 50ng/ml; the concentration of the human vascular endothelial growth factor VEGF-165 in the culture solution IV is 50ng/ml; the concentration of the human fibroblast growth factor in the culture solution IV is 10ng/ml;

The culture solution V consists of SB431542 and the culture solution IV; the concentration of SB431542 in the culture solution V is 10. Mu.M;

the culture solution VI is a basic culture solution of B27 additive, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human interleukin-3, human macrophage colony stimulating factor and cells; the volume percentage of the B27 additive added with the insulin in the culture solution VI is 2 percent; the concentration of the L-glutamine or the substitute thereof in the culture solution VI is 2mM; the concentration of glycine in the culture solution VI is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VI is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VI is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VI is 14.70 mug/mL; the concentration of the L-proline in the culture solution VI is 11.50 mug/mL; the concentration of L-serine in the culture solution VI is 10.5 mug/mL; the concentration of the penicillin in the culture solution VI is 100U/ml; the concentration of streptomycin in culture solution VI is 100 mug/ml; the concentration of the vitamin C in the culture solution VI is 50ng/ml; the concentration of the human interleukin-3 in the culture solution VI is 10ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VI is 50ng/ml;

The culture solution VII consists of a B27 additive added with insulin, L-glutamine or a substitute thereof, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-proline, L-serine, penicillin, streptomycin, vitamin C, human macrophage colony stimulating factor and a cell basal culture solution; the volume percentage of the insulin-added B27 additive in the culture solution VII is 2%; the concentration of the L-glutamine or the substitute thereof in the culture solution VII is 2mM; the concentration of glycine in the culture solution VII is 7.5 mug/mL; the concentration of the L-alanine in the culture solution VII is 8.9 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.2 mug/mL; the concentration of the L-aspartic acid in the culture solution VII is 13.30 mug/mL; the concentration of the L-glutamic acid in the culture solution VII is 14.70 mug/mL; the concentration of the L-proline in the culture solution VII is 11.50 mug/mL; the concentration of the L-serine in the culture solution VII is 10.5 mug/mL; the concentration of the penicillin in the culture solution VII is 100U/ml; the concentration of streptomycin in the culture solution VII is 100 mug/ml; the concentration of the vitamin C in the culture solution VII is 50ng/ml; the concentration of the human macrophage colony stimulating factor in the culture solution VII is 50ng/ml;

The cell basal culture solution is RPMI 1640 basal culture solution;

the substitute is GlutaMAX ™ supply.

2. A kit for differentiating hematopoietic stem cells into macrophages, comprising culture broth VI and culture broth VII;

The cell basal culture solution is RPMI 1640 basal culture solution;

the substitute is GlutaMAX ™ supply.

3. The kit of claim 1 or 2, wherein: the kit also comprises a culture solution I;

the culture solution I consists of Y27632 and a stem cell culture solution; the concentration of Y27632 in the culture solution I is 5 mu M; the stem cell culture solution is TeSR-E8 culture solution.

4. A method of differentiating pluripotent stem cells into macrophages comprising the steps of:

(2) Inoculating pluripotent stem cells into the culture solution II of claim 1, and culturing for 0.5-1.5 days;

(3) Changing the culture solution in the step (2) into the culture solution III in the claim 1, and culturing for 1.5-2.5 days;

(4) Transferring the cells in the step (3) into the culture solution IV in the claim 1, and culturing for 1.5-2.5 days;

(5) Changing the culture solution in the step (4) into the culture solution V in the claim 1, and culturing for 2-4 days;

(6) Transferring the cells obtained in the step (5) into the culture solution VI according to any one of claims 1 to 3, and culturing for 4 to 6 days;

(7) Transferring the cells obtained in the step (6) to the culture solution VII described in any one of claims 1 to 3, and culturing for 2 to 4 days.

5. The method according to claim 4, wherein: the method also comprises the following steps (1) before the step (2): pluripotent stem cells are cultured by inoculating them in the culture medium I according to claim 3.

6. The method according to claim 5, wherein: the step (1) is as follows: (a) Inoculating pluripotent stem cells into the culture solution I of claim 3 for culturing for 0.5-1.5 days; (b) Replacing the culture solution in the step (a) with the stem cell culture solution in claim 3 for 0.5-1.5 days.

7. A method of differentiating hematopoietic stem cells into macrophages comprising the steps of:

(1) Inoculating hematopoietic stem cells into the culture solution VI according to any one of claims 1 to 3, and culturing for 4 to 6 days;

(2) Transferring the cells obtained in the step (1) to the culture solution VII described in any one of claims 1 to 3, and culturing for 2 to 4 days.

8. Use of a kit according to any one of claims 1-3 for the preparation of macrophages.

9. The use according to claim 8, characterized in that: the application is to prepare the macrophage by taking the pluripotent stem cells or the hematopoietic stem cells as starting cells.