KR101918817B1 - Method for differentiation of hepatocyte derived from human stem cells and Hepatocyte - Google Patents

Abstract

The hepatocyte differentiation induction method of the present invention can effectively acquire a larger number of hepatocytes than the prior art. Specifically, step A, in which human precociousment stem cells are treated with TrypLE ^TM select in three steps to purify only highly purified undifferentiated stem cells, Treating the purified undifferentiated stem cells with Activin A and CHIR99021 simultaneously to obtain endodermal cells; Treating the obtained endodermal cells with retinoic acid (RA) to obtain a hepatocyte; And D stage in which hepatic stem cells are induced by suspending the obtained hepatic stem cells on a differentiation plate, attaching them to a 96-well plate capable of evaluating toxicity, treating HGF (hepatocyte growth factor) and DEX (Dexamethasone) A stem cell-derived hepatocyte differentiation method comprising the steps of:

Description

TECHNICAL FIELD The present invention relates to a stem cell-derived hepatocyte differentiation method and a hepatocyte-

The present invention relates to a method for inducing differentiation of human stem cells into hepatocytes and hepatocytes. More particularly, the present invention relates to a method of differentiation for securing a high yield of differentiated hepatocytes suitable for evaluation of in vitro cytotoxicity from human pluripotent stem cells, and hepatocytes differentiated by the method.

The development of biopharmaceuticals can be categorized into two phases: preclinical and clinical. Among these, the preclinical phase is biochemical experiments on animal models or living cells before confirming the stability and effects of candidate substances on humans, thus reducing the likelihood that new drugs will be withdrawn from clinical trials. However, in animal models, there is a problem that it is difficult to derive accurate results due to variations among individuals, strains, and genders. For this reason, primary cultured cells extracted from human organs are generally used, and human primary hepatocytes (hPHs) are widely used in the evaluation of hepatotoxicity for new drug candidates.

However, human invasive cultured hepatocytes also have various limitations in their use in the preclinical phase, and their limitations include: ① limited supply, ② high cost burden, ③ unevenness of liver function, and ④ short- Includes functional loss. Therefore, hepatocellular carcinoma cell line (HepG2), which is relatively easy to obtain and easy to cultivate in vitro, is used as a method for replacing primary cultured hepatocytes. However, such a hepatocellular carcinoma cell line is a cytochrome enzyme (CYP enzymes, hepatocyte-specific functional drug metabolizing enzymes, including GST enzymes, and ABC transporters and SLC transporters, which are responsible for drug absorption and release in liver cells. transporters) are very low in expression and activity. Therefore, there has been a problem in replacing primary cultured hepatocytes with a considerably insufficient amount. Therefore, pluripotent stem cells (PSCs), including human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs), may be used as alternative means for replacing primary cultured hepatocytes (Hepatocyte-like cells, HLCs), which are derived from hepatocyte-like cells, have been attracting attention as test materials for the entire clinical stage.

Since the pluripotent stem cells have self-renewal capacity capable of infinite proliferation and pluripotency capable of differentiation into all cells in vivo, stem cells differentiated from the pluripotent stem cells can be differentiated into stem cells, When used for liver toxicity evaluation, it is possible to solve the difficulty of cell supply which is the limit of primary cultured hepatocytes. In addition, unlike hepatocellular carcinoma cells, pre-differentiation stem cell-derived hepatocytes express hepatocyte-specific drug metabolizing enzymes and major membrane transporters, and thus can be used as a good material for hepatotoxicity testing in all clinical stages of new drug candidates.

Therefore, a high yield of hepatocyte-induced differentiation from pre-differentiating stem cells has been actively developed worldwide, and many hepatocyte-induced differentiation methods have been reported (Hey et al, Stem cells 26: 894 , 2008; Si-Tayeb et al, Hepatology 51: 297, 2010; Hannan et al., Nat Protoc 8 (2): 430, 2013). However, since the hepatocytes derived from the pluripotent stem cells produced by the conventional hepatocyte-induced differentiation method are phenotypically similar to adult hepatocytes, they are induced and differentiated from undifferentiated status, which is a very early stage of human embryogenesis In terms of function, hepatocytes are more similar to embryonic hepatocytes than adult hepatocytes. In fact, hepatic specific enzyme activity required for drug metabolism, which is the main function of adult hepatocytes, is higher than hepatocellular carcinoma cells but lower than human hepatic hepatocellular carcinoma cells. Therefore, in order to evaluate successful new drug screening and hepatotoxicity during the preclinical clinical trials, it is urgently required to develop a high yielding method for inducing high-function hepatocyte differentiation.

1. Hey et al, Stem cells 26: 894, 2008 2. Si-Tayeb et al, Hepatology 51: 297, 2010 3. Hannan et al., Nat Protoc 8 (2): 430, 2013

DISCLOSURE Technical Problem The present invention has been conceived to solve the above problems, and an object of the present invention is to provide a method of inducing differentiation to obtain hepatocytes suitable for hepatotoxicity evaluation in all clinical stages of a drug candidate substance.

It is an object of the present invention to provide a method for producing stem cells, which comprises steps A) and A) for purifying only highly purified undifferentiated stem cells by treating the human pre-differentiating stem cells with TrypLE ^TM select in three steps; Treating the purified undifferentiated stem cells with Activin A and CHIR99021 simultaneously to obtain endodermal cells; Treating the obtained endodermal cells with retinoic acid (RA) to obtain a hepatocyte; And D stage in which hepatic stem cells are induced by suspending the obtained hepatic stem cells on a differentiation plate, attaching them to a 96-well plate capable of evaluating toxicity, treating HGF (hepatocyte growth factor) and DEX (Dexamethasone) The present invention provides a method for differentiating stem cells derived from human stem cells.

In step B, BMP2 (bone morphogenetic protein 2) and bFGF (basic fibroblast growth factor) may be further treated to induce differentiation of mesenchymal stem cells into fully endodermically differentiated cells.

Further, before performing step C, the step of treating BMP4 (bone morphogenetic protein 4) with the complete endodermically obtained cell obtained in step B may be further included.

In step C, the obtained hepatic stem cells can be suspended in 96-well plates by floating the cells using TrypLE ^TM select for drug toxicity experiments.

Finally, the present invention may further comprise an E step of treating hepatocytes obtained through step D with HGF and DEX to mature hepatocytes.

On the other hand, the object of the present invention can be achieved by providing hepatocytes differentiated by the differentiation method as another category.

First, the hepatocytes derived from human pre-differentiation ability stem cells can be used instead of the primary cultured hepatocytes conventionally used in the evaluation of drug toxicity and safety, which is an essential evaluation step of the development of new drugs. Therefore, the hepatocyte differentiation method of the present invention is a novel target drug discovery, It has an effect that can be applied to all areas of drug development through research and safety research evaluation.

Second, the present invention has the effect of obtaining high-yielding hepatocytes from human pre-differentiating stem cells at a high yield (more than 95% of albumin-expressing hepatocytes) so as to be suitable for hepatotoxicity evaluation (test) in all clinical stages of a drug candidate substance .

Thirdly, the hepatocyte differentiation induction method of the present invention can effectively acquire a greater number of hepatocytes than the prior art.

Fourth, the drug toxicity evaluation (test) at the pre-clinical stage is performed using the high-function hepatocyte obtained through the present invention, so that accurate toxicity evaluation results can be obtained.

FIG. 1A is a diagram showing a method of culturing undifferentiated human pre-differentiating stem cells and a method of inducing differentiation of hepatocytes.
FIG. 1B is a schematic diagram showing a step of inducing differentiation into mature hepatocytes suitable for drug toxicity evaluation using human undifferentiated pluripotent stem cells purified with high purity.
FIG. 2 shows a process of obtaining pure undifferentiated stem cells through subculture during purification to obtain high purity human undifferentiated pluripotent stem cells before hepatocyte-induced differentiation,
3 is a comparative graph showing the number of hepatocytes obtained by the method for inducing hepatocyte differentiation according to the present invention,
FIG. 4A is a graph showing the morphology of the final differentiated hepatocytes and the fluorescent staining of the differentiated hepatocytes with hepatocyte-specific markers (albumin; ALB, alpha-fetoprotein; AFP)
FIG. 4B is a graph showing the results of flow cytometry for confirming the quantitative yield of hepatocytes obtained by the hepatocyte differentiation induction method of the present invention,
FIG. 5A is a graph showing the degree of maturation of hepatocytes obtained by the hepatocyte differentiation induction method of the present invention,
FIG. 5B is a graph showing the glycogen synthesis ability of 17-day-old hepatocytes final differentiation-induced in the present invention through PAS (periodic acid-Schiff) staining.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. It should be noted that the same components of the drawings are denoted by the same reference numerals and signs as possible even if they are shown on different drawings. In the following description of the present invention, detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

In order to obtain highly purified undifferentiated cells before hepatocyte-induced differentiation, human pre-differentiating stem cells, which are cultured in supporting nutrient cells, are cultured in the absence of supporting nutrition cells The present invention relates to a method for inducing the differentiation of endogenous pluripotent stem cells into pluripotent human pluripotent stem cells, inducing differentiation into hepatocytes and hepatic progenitor cells, and culturing under culturing conditions, And induction of differentiation and induction of differentiation into the final hepatocyte.

FIG. 1B is a schematic diagram showing a stepwise process of inducing differentiation into mature hepatocytes suitable for evaluation of drug toxicity using high-purity human undifferentiated pre-differentiating stem cells. As shown in FIG. 1B, the differentiation inducer used for hepatocyte- ; Activin A, CHIR99021, BMP2, bFGF / hepatocyte inducer, BMP4, FGF4 Rerinoic acid, Ascorbic cid, Nicotinamide, bFGF / mature hepatocyte inducer, HGF and Dexamethasone).

FIG. 2 shows a process in which only pure undifferentiated stem cells are obtained through subculture during purification to obtain high purity human undifferentiated pre-differentiating stem cells before hepatocyte-induced differentiation.

The method of inducing hepatocyte differentiation according to the present invention is a step A in which only high purity undifferentiated stem cells are purified by treating the human pre-differentiating stem cells with TrypLE ^TM select in three steps, Treating the purified undifferentiated stem cells with Activin A and CHIR99021 simultaneously to obtain endodermal cells; Treating the obtained endodermal-derived cells with retinoic acid (RA) to obtain a hepatocyte; And D) suspending the obtained hepatic stem cells on a differentiation plate, attaching the obtained hepatic stem cells to a 96-well plate capable of evaluating toxicity, treating HGF (hepatocyte growth factor) and DEX (Dexamethasone) to induce hepatocytes; .

Further, in step B, further treatment of bone morphogenetic protein 2 (BMP2) and basic fibroblast growth factor (bFGF) may be performed to induce differentiation of mesenchymal stem cells into totally endodermally differentiated cells have.

In addition, the method may further include treating BMP4 (bone morphogenetic protein 4) with the complete endodermically-derived cell obtained in step B before performing step C.

Then, in step C, the obtained hepatic stem cells are suspended in cells using TrypLE ^TM select for drug toxicity test, and then reattached to a 96-well plate.

In the meantime, the present invention may further comprise an E step of treating hepatocytes obtained through step D with HGF and DEX to mature hepatocytes.

In the human stem cell-derived hepatocyte differentiation method of the present invention, the stem cell is a human-derived cell capable of differentiating into hepatocytes in in vitro culture, preferably a pluripotent stem cell or a source cell of the cell .

Here, the term "precursor differentiation stem cell" refers to a cell capable of almost enduring or prolonged cell proliferation maintained in an undifferentiated state by in vitro culture, capable of differentiating into cells of all lineage of trichomes (ectoderm, mesoderm, endoderm) under appropriate conditions Means cells with ability. Present pre-differentiation stem cells are known as embryonic stem cells (hereinafter abbreviated as "ES cells"), embryonic stem cells (hereinafter referred to as "ES cells") isolated from early embryos derived from mammals such as mouse, monkey, embryonic germ cells (hereinafter abbreviated as "EG cells") and pluripotent adult progenitor cells (hereinafter referred to as "MAPC") isolated from adult bone marrow ).

In the human stem cell-derived hepatocyte differentiation method of the present invention, the pluripotent stem cells are derived from ES cells, induced pluripotent stem cells (iPSC), EG cells, which are similar to embryonic stem cells prepared through the reprogramming of various somatic cells, Or MAPC, preferably a ES cell, more preferably a human ES cell.

In addition, the cells usable in the present invention are not limited to the above three species, and include all the pluripotent stem cells derived from human embryo, fetus, umbilical cord blood, adult tissues such as adult organs or bone marrow, or blood. As a specific example, stem cells (Sharda & Zahner, International Patent Publication No. 02/051980) obtained by treating medicinal agents such as 5-azacytidine (hereinafter abbreviated as "AZC" (Abuljadayel, Curr. Med. Res. Opin. 19: 355, 2003) or adult stem cells derived from adult cells (Li et al, Nature Med ., Advance online publication). In this case, the ES cell-like trait refers to a cell having a surface (antigen) marker specific to an ES cell, an ES cell specific gene, a teratoma forming function, or a chimeric mouse capable , And the like.

On the other hand, 'feeder' or 'feeder cell' is a term used to describe a type of cell that provides an environment in which a second type of cell can co-cultivate with another type of cell.

≪ Culture of undifferentiated human stem cells >

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs) continue to undifferentiate through co-culture with feeder layers. Specifically, human embryonic stem cells are cultured on supporting nutrient cells made of mouse embryonic fibroblasts (MEFs) in which cell division is inactivated by treating mitomycin-C (10 μg / ml) The medium used for the culture is DMEM / F12 medium containing 20% knockout serum replacement (Invitrogen Life Technologies, USA), 8 ng / ml bFGF, 1% non essential amino acid and 100 mM beta mercaptoethanol. The cells are cultured in an incubator under standard conditions (37 ° C, 5% CO 2 and saturated humidity) and medium replacement is performed daily. The hESCs and iPSCs are subcultured once every 6 to 8 days. To maintain undifferentiated state during subculture, some undifferentiated hESCs and iPSCs are transferred to new supporting nutrition cells containing the same culture medium as above, and some undifferentiated hESCs and iPSCs Are transferred to a 60 mm culture dish coated with Matrigel for hepatocyte-induced differentiation and cultured using mTeSR1 (STEMCELL technologies) medium.

When hESCs and iPSCs cultured on nutrient-free cells on a 60 mm culture dish form colonies on an area of about 80% on the culture dish, the cultured hESCs and iPSCs are cultured on a TrypLE ^™ select (Invitrogen ) For 1 minute to remove some of the differentiated cells. Then, trypLE ^TM select is treated again for 3 minutes to disperse the cultured hESCs and iPSCs into single cells, and centrifuged at 1000 rpm for 5 minutes to isolate and collect only the cells. Harvested with hESCs and iPSCs is matrigel after coated with 5 X 10 ⁶ cells to the coated 100mm culture dishes, to 10μM Y-27632 (ROCK inhibitor) of protein kinase inhibitor is added to mTeSR1 medium 1 days 37 ℃ 5% CO ₂ After culturing in a conditioner, the cells are further cultured in mTeSR1 medium containing no Y-27632 (ROCK inhibitor) for 1 day, and hepatocyte differentiation is performed.

≪ Induction differentiation into hepatocytes >

Table 1 summarizes the details of required reagents and treatment periods in the induction of hepatocyte differentiation.

step Combination badge Processing time One
2 [mu] M CHIR99021 (Tocris), 100 ng / ml Activin (R [alpha] D) RPMI 1 d 20ng / ml BMP2 (Peprotech), 5ng / ml bFGF (Peprotech) RPMI + B27 2 d
2

20 ng / ml BMP4 (Peprotech) RPMI + B27 2 d 2 [mu] M Retinoic acid (Sigma) DMEM + B27 2 d 1 ng / ml bFGF (Peprotech), 100 μM Ascorbic acid (Sigma), 1 mM nicotinamide (Sigma) DMEM + B27 4 d 3
20ng / ml HGF (Peprotech) ITS 2 d 10-6M Dexamethasone (DEX, Sigma) L15 + B27 2 d

① Step 1: Before undifferentiation Ability to distinguish  Endodermal cells of stem cells and Abdomen  Induction of differentiation of whole cell

During the process of human development, the internal organs, including the digestive tract, liver and lung, are formed from endoderm cells. Therefore, in order to differentiate the pluripotent stem cells into hepatic progenitor cells and hepatocytes in the in vitro differentiation induction method, it is essential to acquire highly efficient endoderm cells as a first step. Therefore, in the present invention, hESCs and iPSCs were induced to differentiate into endothelial cells and dorsal haematopoietic cells in one stage of differentiation. Specifically, hESCs and iPSCs cultured for 2 days without supporting nutrition cells in a 100 mm culture dish are cultured in RPMI medium containing 2 μM CHIR99021 and 100 ng / ㎖ AA (activin A) for 1 day after removing the mTeSR1 medium. Thereafter, the culture is further induced for 2 days in RPMI medium containing 20ng / ml BMP2 and 5ng / ml bFGF.

② Stage 2: Endoderm cells Hepatocyte ( hepatoblasts ) And liver As a precursor cell  Induction of differentiation

The endogenous cells obtained in step 1 are further cultured for 8 days to induce differentiation into hepatic and hepatic progenitor cells. Specifically, for the hepatocyte differentiation, differentiation-induced endodermal cells were incubated for 2 days in RPMI medium supplemented with 20 ng / ml BMP4 and B27 adjuvant, followed by addition of 2 μM retinoic acid and B27 adjuvant for 2 days After induction of differentiation in the DMEM medium, for the differentiation into hepatocyte progenitor cells, DMEM medium was further induced to differentiate for 4 days in a medium containing 1 ng / ml bFGF, 100 μM ascorbic acid and 1 mM nicotinamide .

③ Step 3: Differentiation into the final hepatocyte

For the final hepatocyte differentiation from the differentiated hepatocyte precursor cells in stage 2, 20 ng / ml HGF was added to DMEM / F12 supplemented with ITS and B27 adjuvant for 4 days to induce differentiation. After the differentiation, the differentiated hepatocytes were treated with TrypLE ^TM select to form a platform suitable for final drug development and drug toxicity evaluation (experiment), and single-celled and cultured in a 96-well culture vessel pre-coated with type 1 collagen at 1 × 10 ⁵ cells / well. Then, 10 ng / ml Oncostatin M and 10-6 M Dexamethasone are added to DMEM / F12 supplemented with ITS and B27 adjuvant and cultured for 6 days. Hepatocyte-specific markers such as ALB, ASGPR1, NTCP and MRP1 were identified by flow cytometry, and PAS activity was evaluated for hepatocyte functional assay.

<Method of differentiation analysis>

Immunofluorescence  process of dyeing

The final differentiated hepatocytes in a 96-well plate were treated with PBS containing 4% PFA (paraformaldehyde), fixed at room temperature for 20 minutes, and washed three times with PBS. The cells were then blocked and perforated by treatment with PBS containing 0.3% Triton X-100 / PBS and 10% serum, and the primary antibody was diluted according to the treatment ratio and reacted at 4 ° C for 12-16 hours. Homologous mouse IgG or normal donkey serum was used as a negative control, but no fluorescence was detected in the negative control. The primary antibody against ALB (1: 400), AFP (1: 400) was diluted. After washing three times with PBS, a secondary antibody diluted 1: 400 with FITC (fluorescein isothiocyanate) or TRITC (rhodamine) was added, and reacted at room temperature for 1 hour and 30 minutes. Next, the nuclei of the cells were stained using 1 / / ml DAPI (4 ', 6-diamidino-2-phenylindole). Between each step, cells and sections were washed with phosphate-buffered saline (PBS).

Flow cell  analysis

The final differentiated hepatocytes were separated into single cells by adding TrypLE ^™ select, and fixed with 4% paraformaldehyde (PFA) for 20 min at 4 ° C. The cells were washed with FACS washing buffer (BD) and treated with ALB, ASGPR 1, NTCP and MRP1 antibodies, respectively, which were known as primary mature hepatocyte markers, and reacted at 4 ° C for 30 minutes. After 3 washing steps, the secondary antibody was reacted at 4 ° C for 30 minutes. The washed cells were then analyzed using a BD-FACS Calibur Flow Cytometer (FACS Calibur, USA). Three independent experiments were performed for each marker. Experimental results were analyzed using Flowjo software. In the case of ALB, the degree of differentiation was confirmed by a cell separator (FACS).

PAS (Periodic Acid- Schiff ) dyeing

The final differentiated hepatocytes were fixed with a solution containing 4% formalin and 95% ethanol, and reacted with PAS (Periodic Acid Schiff) solution at room temperature for 5 minutes. After several washes with distilled water, the cells were treated with Schiff's reagent for 15 minutes, washed in running water for 5 minutes, and then stained with hematoxylin for 90 seconds at room temperature. Intracellular glycogen particles (purple) were detected with an optical microscope (Carl Zeiss). Both the 2D cultured HLCs cells and the 3D cultured spoloids showed good accumulation of glycogen.

Reverse transcription PCR  And quantitative PCR

From the hepatocytes and the final differentiated hepatocytes, TRIzol reagent was used to obtain cells that were repeatedly exposed to a living body foreign substance, and a reverse transcription procedure using a reverse transcription system (Promega Corp., USA) was performed. PCR amplification conditions were 94 ° C for 5 minutes, 35 cycles (94 ° C for 30 seconds, 50-57 ° C for 30 seconds and 72 ° C for 30 seconds) and 72 ° C for 10 minutes.

RT-PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems, USA). The PCR reactions consisted of 12.5 μl of SYBR Green PCR Master Mix, 25 μl each containing 0.8 μl of 10 mM primer, 10.4 μl of distilled water and 0.5 μl of template cDNA, and amplification was confirmed under conditions appropriate for each primer. Relative expression levels of each gene were normalized using GAPDH. The sequences of the primers used here are shown in Table 2.

gene The forward direction (5 '- &gt; 3' The forward direction (5 '- &gt; 3' Product size (bp) ALB
AFP
HNF4a
CYP3A4
GAPDH CTAGGAAAAGTGGGCAGCAAATG
CCCGAACTTTCCAAGCCATA
ACTACATCAACGACCGCCAGT
GTGGTGAATGAAACGCTCAG
GCTCTCTGCTCCTCCTGTTC GCGTTTCTCATGCAACACACAT
TACATGGGCCACATCCAGG
ATCTGCTCGATCATCTGCCAG
CACCCCTTTGGGAATGAACA
CCATGGTGTCTGAGCGATGT 114
100
102
102
80

<Analysis result>

FIG. 3 is a graph showing the number of hepatocytes obtained by the hepatocyte differentiation induction method of the present invention, and is a graph obtained by the method of inducing hepatocyte differentiation (1 ^st protocol, The number of hepatocytes obtained by the number of hepatocytes and the method for inducing hepatocyte differentiation according to the present invention (2 ^nd protocol) are shown in comparison. As a result of comparing the number of hepatocytes obtained from the same culture dish area in three different experiments, which were final differentiated by each hepatocyte differentiation induction method, the method of inducing hepatocyte differentiation according to the induction method of the present invention, It can be confirmed that the ratio of hepatocyte to hepatocyte-derived hepatocytes increased about 5 times.

4A is a graph showing the final differentiated hepatocyte morphology and differentiated hepatocytes by fluorescent staining with hepatocyte-specific markers (albumin, ALB, alpha-fetoprotein; AFP) It can be confirmed that hepatocyte differentiation from stem cells is effectively differentiated.

4B is a graph showing the results of flow cytometry for confirming the yield of quantitative differentiation of hepatocytes obtained by the hepatocyte differentiation induction method of the present invention, wherein hepatocytes expressing adult hepatocyte markers ALB and ASGPR1 are 98% or more, hepatocyte functional , 83.7% of the hepatocytes expressing NTCP and 53.5% of the hepatocytes expressing MRP2, respectively. As a result, the hepatocytes differentiated by the hepatocyte differentiation induction method of the present invention are high-purity highly functional hepatocytes.

FIG. 5A is a graph showing the degree of maturation of hepatocytes obtained by the hepatocyte differentiation induction method of the present invention. As a result of comparing the RNA expression patterns of differentiated hepatocytes through real-time PCR, The expression of AFP, a marker of immature hepatocyte, and ALB, a marker of adult hepatocyte, were significantly increased after the differentiation (Day 17), and CYP 3A4, a representative drug metabolizing enzyme of hepatocytes, was also significantly increased.

5B is a graph showing glycogen synthesis ability of 17 day hepatocytes final differentiation induced in the present invention through PAS (periodic acid-Schiff) staining. As shown in FIG. 5B, most hepatocytes induced and differentiated by the hepatocyte differentiation method of the present invention are glycogen Functional hepatocytes with synthetic ability.

In summary, the present application has an effect that the yield of hepatocytes can be increased five-fold compared to that of the prior art (including Applicant's No. 10-2015-0113616 of the present applicant). Specifically, in the conventional patent, Activin A was treated for 3 days and cell death during differentiation was high. In the present invention, Activin A was treated for 1 day, and BMP2 and bFGF were used to induce endoderm cells. It is possible to obtain 1 X 10 ⁷ cells / T75 flask which is 5-fold increased as compared with 2 x 10 ⁶ cells / T75 flask of hepatocytes obtained in the conventional method by increasing cell proliferation as well as reducing cell death.

While the present invention has been described in connection with what is presently considered to be the most practical and preferred embodiment, it is to be understood that the invention is not limited to the disclosed embodiments. Further, it is obvious that various modifications and variations can be made without departing from the scope of the technical idea of the present invention by anyone having ordinary skill in the art.

Claims (6)

As a pre-induction stage of hepatocyte differentiation, step A is a step of treating human precursor stem cells with TrypLE ^TM select in three steps to purify only highly purified undifferentiated stem cells;
The purified undifferentiated stem cells were treated with Activin A and CHIR99021 alone at the same time for 1 day. BMP2 (bone morphogenetic protein 2) and bFGF (bFGF) were induced to induce differentiation of mesenchymal stem cells into fully endodermically differentiated cells basic fibroblast growth factor) for 2 days to obtain endodermal cells;
Treating the obtained endodermal-derived cells with retinoic acid (RA) to obtain a hepatocyte;
A step D for suspending the obtained hepatic stem cells on a differentiation plate, attaching the obtained hepatic stem cells to a 96-well plate capable of evaluating toxicity, treating HGF (hepatocyte growth factor) and DEX (Dexamethasone) to induce hepatocytes; And
And E step of treating the hepatocytes obtained through the step D with HGF and DEX to mature hepatocytes,
Before performing step C,
Further comprising the step of treating BMP4 (bone morphogenetic protein 4) with the complete endodermically-derived cells obtained in the step B for 2 days.
delete delete The method of claim 1,
In the step C,
The obtained hepatic stem cells are suspended in cells using TrypLE ^TM select for drug toxicity test and then reattached to a 96-well plate.
delete delete

Images