CN110564820A - controllable nucleic acid hairpin structure restriction mutation site detection method and kit - Google Patents
controllable nucleic acid hairpin structure restriction mutation site detection method and kit Download PDFInfo
- Publication number
- CN110564820A CN110564820A CN201910897056.4A CN201910897056A CN110564820A CN 110564820 A CN110564820 A CN 110564820A CN 201910897056 A CN201910897056 A CN 201910897056A CN 110564820 A CN110564820 A CN 110564820A
- Authority
- CN
- China
- Prior art keywords
- sequence
- hairpin structure
- mutation site
- nucleic acid
- restriction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a controllable nucleic acid hairpin structure restriction mutation site detection method and a kit, belonging to the field of biomedicine. The nucleic acid hairpin structure comprises at least 4 consecutive complementary paired base pairs, and the restriction mutation site is located at any position within the nucleic acid hairpin structure. Continuously hybridizing a blocker sequence, complementary pairing bases of the hairpin structure sequence where the restriction mutation site is located and adjacent bases of the complementary pairing bases to release the restriction mutation site; hybridizing the hybridization probe with the released restriction mutation site, and detecting a hybridization signal. The invention can effectively detect the restriction mutation site in the nucleic acid hairpin structure, has simple detection method and detection rate which can be up to 100 percent, and has important significance for the development of clinical molecular diagnosis kits.
Description
Technical Field
The invention relates to a controllable nucleic acid hairpin structure restriction mutation site detection method and a kit, belonging to the field of biomedicine.
Background
The molecular diagnosis technology comprises methods of gene chip, gene sequencing, PCR, qPCR, fluorescence in situ hybridization and the like. The principle behind the successful implementation of molecular diagnostic techniques is based on nucleic acid hybridization, i.e., the complementary pairing between A-T, A-U, G-C within a nucleic acid. In the original nucleic acid sequence of organism, some secondary structures will also be formed by itself, for example, the structure formed by the DNA single-stranded molecules through the mutual reverse folding to make the complementary base pairs meet and form hydrogen bond, which is also called hairpin structure.
According to the thermodynamic principle of bioinformatics system, the rate and success rate of complementary pairing of two nucleic acid sequences are related to the distance, length and other factors of the two sequences. Thus, adjacent nucleic acid sequences will form a hairpin structure at a much faster rate than a free hybridization probe will hybridize to the target sequence.
According to the above principle, in the nucleic acid hybridization process, if the target sequence of a mutation site can exactly form a hairpin structure, primers or probes hybridized with the mutation site hardly compete for the hairpin structure, thereby causing the hybridization failure and further causing the phenomena of mutation and the like to be undetected.
Disclosure of Invention
Therefore, the invention aims to provide a novel controllable detection method and a kit for restriction mutation sites in a nucleic acid hairpin structure, so as to solve the problem that the mutation cannot be detected due to the failure of hybridization of a primer or a probe and the mutation sites caused by the hairpin structure formed in a nucleic acid target sequence.
In order to achieve the above object, the present invention provides a method for detecting a restriction mutation site in a controllable nucleic acid hairpin structure, the nucleic acid hairpin structure comprising at least 4 consecutive complementary paired base pairs, the restriction mutation site being located at any position within the nucleic acid hairpin structure, the method comprising the steps of:
Designing a blocker sequence and a hybridization probe according to the nucleic acid hairpin structure, wherein the blocker sequence comprises a first sequence capable of hybridizing with complementary pairing base of the hairpin structure sequence where the restriction mutation site is located and a second sequence capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and the first sequence and the second sequence do not form a hairpin structure; the hybridization probe is a sequence which can be complementarily paired with the restriction mutation site;
Continuously hybridizing the blocker sequence with complementary pairing bases of the hairpin structure sequence where the restriction mutation site is located and adjacent bases of the complementary pairing bases to release the restriction mutation site;
Hybridizing the hybridization probe with the released restriction mutation site, and detecting a hybridization signal.
further, the blocker sequence is an exogenous blocker sequence.
Further, the exogenous blocker sequence length is at least 3 nt longer than the nucleic acid hairpin structure length.
Further, the length of the exogenous blocker sequence ranges from 10nt to 40 nt.
Further, the blocker sequence is an endogenous blocker sequence.
Further, in the endogenous blocker sequence, the sum of the lengths of the first sequence and the second sequence is between 5 and 20 nt.
Further, the endogenous blocker sequence also comprises an amplification primer sequence, the length of the amplification primer sequence is between 15 nt and 40nt, and the proportion of the bases G and C is between 30 percent and 80 percent.
Furthermore, the hybridization probe is 10-40nt in length and comprises a fluorescent source.
Further, the hybridization probe is selected from one of a Taqman fluorescent probe, a molecular beacon probe, a bDNA cascade amplification probe and a biochip probe.
in addition, the invention also provides a controllable nucleic acid hairpin structure restriction mutation site detection kit, which comprises a blocker sequence and a hybridization probe, wherein the blocker sequence comprises a first sequence capable of hybridizing with complementary pairing base of the hairpin structure sequence where the restriction mutation site is located and a second sequence capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and the first sequence and the second sequence do not form a hairpin structure; the hybridization probe is a sequence that can be complementarily paired with the restriction mutation site.
The invention enables the complementary pairing base of the sequence of the blocker and the hairpin structure sequence of the restriction mutation site and the adjacent base of the complementary pairing base to be continuously hybridized to release the restriction mutation site, so that the hybridization probe can be hybridized with the released restriction mutation site, and then the restriction mutation site in the nucleic acid hairpin structure can be effectively detected by detecting the hybridization signal, thereby avoiding the occurrence of the phenomena that the primer or the probe fails to be hybridized with the mutation site and further the mutation can not be detected due to the hairpin structure formed in the nucleic acid target sequence.
Drawings
FIG. 1 is a schematic representation of the reaction of an exogenous blocker sequence of the present invention with a template containing a nucleic acid hairpin restriction mutation site;
FIG. 2 is a schematic representation of the reaction of an endogenous blocker sequence of the present invention with a template containing a nucleic acid hairpin restriction mutation site;
FIG. 3 shows the CYP2D6 gene sequence and restriction mutation site of an embodiment of the invention;
FIG. 4 shows the detectable rate of restriction mutation sites of the CYP2D6 gene of an embodiment of the invention added with exogenous blocker sequences of different lengths;
FIG. 5 shows the detection rates of restriction mutation sites of the CYP2D6 gene according to the embodiment of the invention added with endogenous blocker sequences of different lengths.
Detailed Description
The invention is further described with reference to specific examples. The following examples are only for illustrating the technical solutions of the present invention more clearly, and the protection scope of the present invention is not limited thereby.
Detection method
The invention provides a method for detecting a controllable nucleic acid hairpin structure restriction mutation site, wherein the nucleic acid hairpin structure comprises at least 4 continuous complementary paired base pairs, and the restriction mutation site is positioned at any position in the nucleic acid hairpin structure. The detection method comprises the following steps:
Designing a blocker sequence and a hybridization probe according to the nucleic acid hairpin structure, wherein the blocker sequence comprises a first sequence capable of hybridizing with complementary pairing base of the hairpin structure sequence where the restriction mutation site is located and a second sequence capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and the first sequence and the second sequence do not form a hairpin structure; the hybridization probe is a sequence which can be complementarily paired with the restriction mutation site;
Continuously hybridizing the blocker sequence with complementary pairing bases of the hairpin structure sequence where the restriction mutation site is located and adjacent bases of the complementary pairing bases to release the restriction mutation site;
Hybridizing the hybridization probe with the released restriction mutation site, and detecting a hybridization signal.
wherein, the block sequence comprises the following 2 structures:
(1) exogenous blocker sequence: the length of the exogenous blocker sequence is at least 3 nt longer than that of the hairpin structure where the restriction mutation site is located, and the length range of the proposed sequence is 10-40 nt; the exogenous blocker sequence comprises a sequence M capable of hybridizing with complementary pairing base of the hairpin structure sequence at the restriction mutation site and a sequence N capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence at the restriction mutation site, wherein the sequence M and the sequence N do not form a hairpin structure.
FIG. 1 shows the reaction process of exogenous blocker sequence with template containing nucleic acid hairpin structure restriction mutation site, wherein the probe used is molecular beacon.
(2) endogenous blocker sequence: the endogenous blocker sequence comprises an amplification primer sequence F, a sequence E capable of hybridizing with complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and a sequence D capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, wherein the sequence D and the sequence E do not form a hairpin structure.
FIG. 2 shows the reaction process of endogenous blocker sequence and template containing nucleic acid hairpin structure restriction mutation site, wherein the probe used is molecular beacon.
Further, the sum of the length of the sequence D and the length of the sequence E is preferably controlled to be 5 to 20 nt. Since the nucleic acid hairpin structure comprises at least 4 base pairs, sequence E is at least 4nt in length and sequence D is at least 1nt in length.
Further, the length of the amplification primer sequence F is preferably controlled to be 15 to 40nt, and the content of the bases G and C is preferably 30 to 80%. Experiments show that if the length of the amplification primer sequence F is too short, the reaction is difficult to occur; if too long, the cost is too high and the specificity is poor.
The hybridization probe is 10-40nt in length and includes a fluorescence source for subsequent fluorescence detection.
The hybridization probe can adopt any one of Taqman fluorescent probe, molecular beacon probe, bDNA cascade amplification probe, biochip probe and the like.
II, reaction system
Aiming at the detection method, the invention provides a reaction system for detecting the restriction mutation site of the hairpin structure of the nucleic acid. The reaction system comprises the following components: the kit comprises the blocker sequence, the hybridization probe, a reaction mixed buffer solution and a set of signal amplification system.
Wherein the reaction mixed buffer solution contains Mg2+Solution, Na+Solution and deionized water.
The signal amplification system employs the prior art, and may be any one system selected from a PCR amplification system, a single-stranded nucleic acid amplification system, and a bDNA cascade hybridization system.
Third, detecting the sample
the target sequence of the mutation site to be detected in the present invention may be either DNA or RNA.
The source of the detection sample can be any biological sample containing nucleic acid sequences, such as blood, tissue, feces, saliva and the like.
Fourth, specific embodiments
Specific examples are given below, wherein the raw materials of the reagents referred to in the examples are commercially available raw materials, and the reagents are prepared by conventional methods, except for the sources specifically noted. The experimental methods and test means which are not detailed in the examples are all the conventional methods and means in the field, and the experimental conditions which are not indicated are all the conventional conditions in the field.
Example 1
The detection gene aiming at the personalized tamoxifen medication: restriction mutation sites of the CYP2D6 gene (figure 3) adopt exogenous blocker sequences with different lengths to carry out detection experiments.
The sequence of the CYP2D6 gene template (5 '→ 3') is as follows:
GCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCC（SEQ ID NO:1）。
Wherein, the mutation site 50 is marked by underlining, and the mutation site 50 is positioned in the hairpin structure after the CYP2D6 gene template forms the hairpin structure by itself, as shown in FIG. 3.
the exogenous blocker sequence involved in the experiment is shown as SEQ ID NO 2 ~ 6 in Table 1.
in this example, the concentration of the CYP2D6 gene template used is 0.06 μ M, the concentration of each exogenous blocker sequence is 0.06 μ M, and Mg2+The concentration is 2mM, Na+The concentration is 100mM, the hybridization probe adopted is a molecular beacon probe, and the sequence is as follows: gcccaaCCTGGTGGGTAGCGTttgggc (SEQ ID NO: 12), the remainder was made up to 20 μ L of deionized water. The method system used in the experiment was a linear PCR amplification system, and the one-way primers used were PO4-TCTGGTAGGGGAGCCTCAG (SEQ ID NO: 13). And respectively adding each exogenous block sequence to a target spot through PCR reaction, thereby modifying the sequence structure and realizing the detection capability.
TABLE 1 exogenous blocker sequence used in restriction mutation site detection experiment of CYP2D6 gene
| Name (R) | Remarks for note | Sequence of |
| SEQ ID NO:2 | 11 nt external source packer | GGTCCaccagg |
| SEQ ID NO:3 | 13 nt external source packer | CAGGTCCaccagg |
| SEQ ID NO:4 | 15 nt external source packer | ATCAGGTCCaccagg |
| SEQ ID NO:5 | 17 nt external source packer | GCATCAGGTCCaccagg |
| SEQ ID NO:6 | 19nt external source packer | GTGCATCAGGTCCaccagg |
note that in SEQ ID 2 ~ 6, the lower ~ case letters represent the sequence M of the exogenous block sequence, and the upper ~ case letters represent the sequence N of the exogenous block.
The experimental result is shown in fig. 4, and it can be seen from fig. 4 that the detectable rate of the restriction mutation site of the CYP2D6 gene is only about 10% without adding the exogenous blocker sequence, but the detectable rate of the restriction mutation site of the CYP2D6 gene is obviously improved with the increase of the length of the exogenous blocker sequence, and the detectable rate is close to 100% when the length of the exogenous blocker sequence is 19 nt.
Example 2
The detection gene aiming at the personalized tamoxifen medication: restriction mutation sites of CYP2D6 gene (figure 3) are detected by endogenous blocker sequences with different lengths.
The sequence of the CYP2D6 gene template (5 '→ 3') is as follows:
GCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCC（SEQ ID NO:1）。
Wherein, the mutation site 50 is marked by underlining, and the mutation site 50 is positioned in the hairpin structure after the CYP2D6 gene template forms the hairpin structure by itself, as shown in FIG. 3.
endogenous blocker sequences used in the experiment are shown in SEQ ID NO 7 ~ 11 in Table 2.
In this example, the concentration of the CYP2D6 gene template used was 0.06 μ M, and the concentration of each endogenous blocker sequence was also 0.06 μ M, Mg2+The concentration is 2mM, Na+the concentration is 100mM, the adopted fluorescent probe is a molecular beacon probe, the sequence is gcccaaCCTGGTGGGTAGCGTttgggc (SEQ ID NO: 12), the rest is supplemented with deionized water to 20 mu L, the method system used in the experiment is a PCR amplification system, the used forward primers are amplification primer sequences (capital letters) of endogenous blocker sequences shown in SEQ ID NO:7 ~ 11 in Table 2 respectively, the reverse primer is PO4 ~ TCTGGTAGGGGAGCCTCAG (SEQ ID NO: 13), and the endogenous blocker sequences are added to the target spot through PCR reaction respectively, so that the sequence structure is reformed, and the detection capability is realized.
TABLE 2 endogenous blocker sequences used in restriction mutation site detection experiments of CYP2D6 gene
| Name (R) | Remarks for note | Sequence of |
| SEQ ID NO:7 | Endogenous blocker with sequence E being 4nt in length | caccGCTCCTGGTGGACCTGATGC |
| SEQ ID NO:8 | Endogenous blockers with sequences E and D of 6 nt in length | t ccaccGCTCCTGGTGGACCTGATGC |
| SEQ ID NO:9 | Endogenous blocker with 7 nt length sum of sequences E and D | gt ccaccGCTCCTGGTGGACCTGATGC |
| SEQ ID NO:10 | Endogenous blockers with sequences E and D of 8 nt in length | ggt ccaccGCTCCTGGTGGACCTGATGC |
| SEQ ID NO:11 | Endogenous blockers with sequences E and D of 10nt in length | caggt ccaccGCTCCTGGTGGACCTGATGC |
Note that in the SEQ ID Nos. 7 ~ 11, lower ~ case letters represent the sequence E of the endogenous block, lower ~ case italic underlined letters represent the sequence D of the endogenous block, and upper ~ case letters represent the sequence F.
The experimental result is shown in fig. 5, and it can be seen from fig. 5 that the detection rate of the restriction mutation site of the CYP2D6 gene is less than 20% without adding the endogenous blocker, and the detection rate is not significantly changed when the endogenous blocker having a length of 4nt of the sequence E is added because the blocker having a length of 4nt of the sequence E does not contain the sequence D. However, with the increase of the length of the endogenous blocker containing the F, D, E fragment, the detection rate of the restriction mutation sites of the CYP2D6 gene is obviously improved, and when the length of the sequences E and D is 10nt, the detection rate is about 100%.
The present invention has been disclosed in terms of the preferred embodiment, but is not intended to be limited to the embodiment, and all technical solutions obtained by substituting or converting equivalents thereof fall within the scope of the present invention.
Sequence listing
<110> Suzhou Wei Biotechnology Ltd
<120> method and kit for detecting restriction mutation sites of controllable nucleic acid hairpin structure
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 60
<212> DNA
<213> Homo sapiens
<400> 1
gctcctggtg gacctgatgc accggcgcca acgctgggct gcacgctacc caccaggccc 60
<210> 2
<211> 11
<212> DNA
<213> Homo sapiens
<400> 2
ggtccaccag g 11
<210> 3
<211> 13
<212> DNA
<213> Homo sapiens
<400> 3
caggtccacc agg 13
<210> 4
<211> 15
<212> DNA
<213> Homo sapiens
<400> 4
atcaggtcca ccagg 15
<210> 5
<211> 17
<212> DNA
<213> Homo sapiens
<400> 5
gcatcaggtc caccagg 17
<210> 6
<211> 19
<212> DNA
<213> Homo sapiens
<400> 6
gtgcatcagg tccaccagg 19
<210> 7
<211> 24
<212> DNA
<213> Homo sapiens
<400> 7
caccgctcct ggtggacctg atgc 24
<210> 8
<211> 26
<212> DNA
<213> Homo sapiens
<400> 8
tccaccgctc ctggtggacc tgatgc 26
<210> 9
<211> 27
<212> DNA
<213> Homo sapiens
<400> 9
gtccaccgct cctggtggac ctgatgc 27
<210> 10
<211> 28
<212> DNA
<213> Homo sapiens
<400> 10
ggtccaccgc tcctggtgga cctgatgc 28
<210> 11
<211> 30
<212> DNA
<213> Homo sapiens
<400> 11
caggtccacc gctcctggtg gacctgatgc 30
<210> 12
<211> 27
<212> DNA
<213> Homo sapiens
<400> 12
gcccaacctg gtgggtagcg tttgggc 27
<210> 13
<211> 19
<212> DNA
<213> Homo sapiens
<400> 13
tctggtaggg gagcctcag 19
Claims (10)
1. A method for detecting a restriction mutation site of a controllable nucleic acid hairpin structure, wherein the nucleic acid hairpin structure comprises at least 4 base pairs that are in consecutive complementary pairings, the method comprising the steps of:
Designing a blocker sequence and a hybridization probe according to the nucleic acid hairpin structure, wherein the blocker sequence comprises a first sequence capable of hybridizing with complementary pairing base of the hairpin structure sequence where the restriction mutation site is located and a second sequence capable of hybridizing with adjacent base of the complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and the first sequence and the second sequence do not form a hairpin structure; the hybridization probe is a sequence which can be complementarily paired with the restriction mutation site;
Continuously hybridizing the blocker sequence with complementary pairing bases of the hairpin structure sequence where the restriction mutation site is located and adjacent bases of the complementary pairing bases to release the restriction mutation site;
Hybridizing the hybridization probe with the released restriction mutation site, and detecting a hybridization signal.
2. the method for detecting the controllable nucleic acid hairpin structure restriction mutation site of claim 1, wherein the blocker sequence is an exogenous blocker sequence.
3. the method for detecting the restriction mutation site of the controllable nucleic acid hairpin structure of claim 2, wherein the length of the exogenous blocker sequence is at least 3 nt longer than that of the nucleic acid hairpin structure.
4. The method for detecting the controllable nucleic acid hairpin structure restriction mutation site of claim 3, wherein the exogenous blocker sequence has a length in the range of 10-40 nt.
5. The method for detecting the controllable nucleic acid hairpin structure restriction mutation site of claim 1, wherein the blocker sequence is an endogenous blocker sequence.
6. The method for detecting the hairpin structure restriction mutation site of claim 5, wherein the sum of the lengths of the first and second sequences in the endogenous blocker sequence is between 5 and 20 nt.
7. The method for detecting the hairpin structure restriction mutation site of a controllable nucleic acid as claimed in claim 5, wherein the endogenous blocker sequence further comprises an amplification primer sequence, the length of the amplification primer sequence is between 15 and 40nt, and the proportion of the basic groups G and C is between 30 and 80 percent.
8. The method for detecting the restriction mutation site of the controllable nucleic acid hairpin structure of claim 1 wherein the hybridization probe is 10-40nt in length and contains a fluorescent source.
9. The method for detecting the restriction mutation site of the controllable nucleic acid hairpin structure of claim 8 wherein the hybridization probe is selected from one of Taqman fluorescent probe, molecular beacon probe, bDNA cascade amplification probe and biochip probe.
10. A controllable nucleic acid hairpin structure restriction mutation site detection kit is characterized by comprising a blocker sequence and a hybridization probe, wherein the blocker sequence comprises a first sequence capable of hybridizing with complementary pairing base of a hairpin structure sequence where a restriction mutation site is located and a second sequence capable of hybridizing with adjacent base of complementary pairing base of the hairpin structure sequence where the restriction mutation site is located, and the first sequence and the second sequence do not form a hairpin structure; the hybridization probe is a sequence that can be complementarily paired with the restriction mutation site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910897056.4A CN110564820B (en) | 2019-09-23 | 2019-09-23 | Method and kit for detecting restriction mutation sites of controllable nucleic acid hairpin structure |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910897056.4A CN110564820B (en) | 2019-09-23 | 2019-09-23 | Method and kit for detecting restriction mutation sites of controllable nucleic acid hairpin structure |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110564820A true CN110564820A (en) | 2019-12-13 |
| CN110564820B CN110564820B (en) | 2023-05-26 |
Family
ID=68781749
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910897056.4A Active CN110564820B (en) | 2019-09-23 | 2019-09-23 | Method and kit for detecting restriction mutation sites of controllable nucleic acid hairpin structure |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564820B (en) |
-
2019
- 2019-09-23 CN CN201910897056.4A patent/CN110564820B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| KI SOO PARK 等: "Simple and Universal Platform for Logic Gate Operations Based on Molecular Beacon Probes", 《SMALL》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110564820B (en) | 2023-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0310229B1 (en) | Selective amplification of target polynucleotide sequences | |
| CN101528763B (en) | Methods and substances for isolation and detection of small polynucleotides | |
| US20210363570A1 (en) | Method for increasing throughput of single molecule sequencing by concatenating short dna fragments | |
| CN107109473B (en) | Sequence conversion and signal amplification DNA having multiple DNA spacer sequences and detection method using the same | |
| JP2019524103A (en) | RNA detection kit and method | |
| US20200299764A1 (en) | System and method for transposase-mediated amplicon sequencing | |
| WO2019191122A1 (en) | Integrative dna and rna library preparations and uses thereof | |
| KR20160098097A (en) | A kit and method for detecting miDNA | |
| CN108060213B (en) | Probe and kit for detecting SNP (single nucleotide polymorphism) sites by recombinase-mediated isothermal amplification method based on probe guidance | |
| KR20230128411A (en) | Preparation of nucleic acid libraries from rna and dna | |
| EP2013366B1 (en) | Sequencing of the L10 codon of the HIV gag gene | |
| CN110564820A (en) | controllable nucleic acid hairpin structure restriction mutation site detection method and kit | |
| CN102424833A (en) | Chip and method for real-time PCR (polymerase chain reaction) gene detection at polygenic mutation site | |
| US11920190B2 (en) | Method of amplifying and determining target nucleotide sequence | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| KR102343373B1 (en) | Method for multiplex detection of miRNA and miRNA detection kit using the same | |
| CN112501166A (en) | Chemically modified high-stability RNA, kit and method | |
| CN113302301A (en) | Method for detecting analytes and compositions thereof | |
| KR101545935B1 (en) | Composition for identifying primate species or primate individual marker using minisatellite of SCK/SLI gene | |
| US20230242971A1 (en) | Removal of excess oligonucleotides from a reation mixture | |
| CN117625768A (en) | Universal digital PCR detection system and application thereof | |
| KR20220097234A (en) | Primer set for removing cross-contaminants related to polymerlase chain reaction | |
| KR100844010B1 (en) | Method for Simultaneous Amplification of Multi-gene | |
| CN114606293A (en) | High-specificity nucleic acid hybridization method based on double-stranded nucleic acid target | |
| CN114622001A (en) | Method for enhancing specificity, sensitivity and accuracy of polymerization reaction and nucleic acid detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |