KR20220097234A - Primer set for removing cross-contaminants related to polymerlase chain reaction - Google Patents

Abstract

The present invention relates to a primer set for removing the cross-contamination of a sample in a polymerase chain reaction (PCR) process, and more specifically, to a primer set which comprises: a forward primer comprising a first restriction enzyme recognition unit including a first binding unit and a restriction enzyme recognition sequence; and a reverse primer comprising a second restriction enzyme recognition unit including a second binding unit and a restriction enzyme recognition sequence.

Description

Primer set for removing cross-contamination related to polymerase chain reaction

The present invention relates to a primer set for removing cross-contamination of a sample in a polymerase chain reaction (PCR) process, specifically, a first restriction enzyme recognition comprising a first binding part and a restriction enzyme recognition sequence It relates to a primer set comprising a forward primer comprising a region, and a reverse primer comprising a second binding region and a second restriction enzyme recognition region comprising a restriction enzyme recognition sequence.

Polymerase Chain Reaction (PCR)-based molecular diagnosis is a sample derived from a human body or other organism such as blood, urine, saliva, etc. analysis method to determine Molecular diagnosis is made based on technology that can detect specific genes following symptom diagnosis and immunodiagnosis.

Molecular diagnosis is a very useful diagnostic method when culture tests are difficult or impossible, or when rapid diagnosis is difficult through culture tests, or when the transmission rate is very high and the appearance of strains such as the avian influenza virus occurs frequently. Therefore, it is important to develop biomarkers that can detect specific genotypes suitable for diagnosis of pathogenic microorganisms or viruses. Since biomarkers are based on genomic nucleotide sequences, PCR is currently a testing method used in almost all processes of manipulating and testing genetic material. The PCR method can amplify a large amount of genetic material having the same nucleotide sequence from a small amount of genetic material through a polymerase chain reaction.

In order to successfully perform molecular diagnosis, when a large amount of genetic material is amplified using genomes extracted from various biological samples, carryover contamination should not occur between the genomes of the samples. Currently, there are various methods for removing cross-contamination in the PCR method, but the convenient UDG system (Uracil DNA Glycosylase system) is mainly used.

The UDG system uses a dNTP mix containing dUTP but not dTTP and Uracil DNA Glycosylase (UDG). However, since the UDG system uses dUTP instead of dTTP, PCR efficiency is reduced, and a DNA sample with high G+C contents has a low rate of decontamination by UDG. Furthermore, PCR products containing Uracil may cause errors in further experiments using the same.

In addition, when the PCR method is performed using dUTP, there is a possibility that the Tm value of the PCR product may change, and in order to confirm the PCR result as the Tm value, it is inconvenient to continuously check whether the Tm value is kept constant.

Therefore, there is an urgent need to develop a method for removing cross-contamination that can easily remove cross-contamination under the existing general PCR conditions and solve the disadvantages of the method using the UDG system.

Accordingly, the present inventors have a reverse primer comprising a forward primer comprising a first restriction enzyme recognition portion comprising a first binding portion and a restriction enzyme recognition sequence, and a second restriction enzyme recognition portion comprising a second binding portion and a restriction enzyme recognition sequence A primer set comprising a was developed.

Accordingly, it is an object of the present invention to provide a primer set.

Another object of the present invention is to provide a composition for removing PCR cross contamination comprising a primer set and a restriction enzyme.

The present invention provides a forward primer comprising a first binding portion linked to a first restriction enzyme recognition portion at the 5' end; and a second binding part linked to a second restriction enzyme recognition part at the 5' end, and the first binding part and the second binding part relate to a primer set comprising a sequence that can be cleaved by a restriction enzyme, respectively, When PCR is performed using the primer set of the present invention, the previous PCR product that may be contaminated through air or the like in the next PCR sample can be simply removed with a restriction enzyme when performing the next PCR.

Hereinafter, the present invention will be described in more detail.

An example of the present invention includes a first restriction enzyme recognition portion comprising a first binding portion capable of specifically binding to a first target sequence and at least one or more restriction enzyme recognition sequences,

The first binding portion comprising a first restriction enzyme cleavage portion, the forward primer; and

and a second restriction enzyme recognition portion comprising a second binding portion capable of specifically binding to a second target sequence and at least one or more restriction enzyme recognition sequences,

The second binding portion comprises a second restriction enzyme cleavage portion, reverse primer; relates to a primer set comprising a.

In the present invention, the first restriction enzyme recognition unit may include a restriction enzyme recognition sequence capable of being recognized and bound by a restriction enzyme, but is not limited thereto.

In the present invention, the first restriction enzyme recognition unit may include at least one or more restriction enzyme recognition sequences.

In the present invention, the second restriction enzyme recognition unit may include a restriction enzyme recognition sequence capable of being recognized and bound by a restriction enzyme, but is not limited thereto.

In the present invention, the second restriction enzyme recognition unit may include at least one or more restriction enzyme recognition sequences.

In the present invention, the forward primer may include a first binding portion.

In the present invention, the first restriction enzyme recognition part may be connected to the 5' end of the first binding part.

In the present invention, the second restriction enzyme recognition part may be connected to the 5' end of the second binding part.

In the present invention, the first binding portion may include a first restriction enzyme cleavage portion.

In the present invention, the second binding portion may include a second restriction enzyme cleavage portion.

In one embodiment of the present invention, the first restriction enzyme recognition portion may include the same sequence as the second restriction enzyme recognition portion.

In the present invention, the restriction enzyme may recognize the restriction enzyme recognition sequence of the forward primer complementary to the template and cut the first restriction enzyme cut part included in the first binding part. The cleaved first restriction enzyme cleavage may have a sticky-end end or a blunt-end end.

In addition, the restriction enzyme may recognize the restriction enzyme recognition sequence of the reverse primer complementary to the template and cut the second restriction enzyme cleavage part included in the second binding part. The cleaved first restriction enzyme cleavage may have a sticky-end end or a blunt-end end.

In the present invention, the restriction enzyme recognition sequence may include a 3, 4, 5 or 6 nucleotide sequence, for example, may include a 5 nucleotide sequence, but is not limited thereto.

In the present invention, the first restriction enzyme recognition part may include one, two, or three or more restriction enzyme recognition sequences, but is not limited thereto.

In the present invention, the second restriction enzyme recognition part may include one, two, or three or more restriction enzyme recognition sequences, but is not limited thereto.

In the present invention, the first restriction enzyme recognition portion or the second restriction enzyme recognition portion may include two different restriction enzyme recognition sequences to be common to each other.

In one embodiment of the present invention, one of the two restriction enzyme recognition sequences may be GGATG recognized by Fok I, and the other may be GGTGA recognized by HphI.

In one embodiment of the present invention, the first restriction enzyme recognition portion may include two types of restriction enzyme recognition sequences partially overlapping each other.

In one embodiment of the present invention, the second restriction enzyme recognition part may include two kinds of restriction enzyme recognition sequences partially overlapping each other.

In one embodiment of the present invention, G, which is the last nucleotide sequence of GGATG recognized by Fok I, overlaps with G, which is the first nucleotide sequence of GGTGA recognized by HphI, and may consist of the nucleotide sequence of GGAT G GTGA. (The overlapping base G is underlined)

In one embodiment of the present invention, the restriction enzyme recognition sequence may be included in the 3' end of the first restriction enzyme recognition part.

In one embodiment of the present invention, when the restriction enzyme recognition sequence is included in the 3' end of the first restriction enzyme recognition part, compared to that not included in the 3' end, the first binding part complementary to the template is more can be cut

In one embodiment of the present invention, the restriction enzyme recognition sequence may be included in the 3' end of the second restriction enzyme recognition part.

In one embodiment of the present invention, when the restriction enzyme recognition sequence is included in the 3' end of the second restriction enzyme recognition part, compared to that not included in the 3' end, the second binding part complementary to the template is more can be cut

In the present invention, a template may mean a nucleic acid strand included in a PCR sample, but is not limited thereto.

In the present invention, the template may include a target sequence, but is not limited thereto.

In the present invention, the template may be DNA or RNA, but is not limited thereto.

In one embodiment of the present invention, the template may be a DNA or RNA sequence relating to a single nucleotide polymorphism (SNP) of the base encoding the 112th amino acid of the APOE gene (Apoprotein E).

The APOE gene may be guanine/cytosine-rich (GC rich). The guanine (G) and cytosine (C) content of the APOE gene may be about 74% based on the total number of bases of the APOE gene.

In one embodiment of the present invention, the template may be a DNA or RNA sequence relating to a single nucleotide polymorphism of the base encoding the 158th amino acid of the APOE gene.

The APOE gene is linked to the apo C-I, C-II and LDL receptor genes, and polymorphisms in this gene have been found to be associated with the development of various diseases such as hyperlipidemia and dementia. The human APOE gene is located on the long arm of chromosome 19, and according to the difference between the two SNPs (rs429358, rs7412), three homozygotes ε2/ε2, ε3/ε3, ε4/ε4 and ε2/ε3, ε2/ ε4, ε3/ε4 There can be three heterozygotes.

The target sequence is polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (Reverse transcription-PCR, RT-PCR), real-time RT-PCR), etc. It may be a possible nucleotide sequence.

In the present invention, the template, that is, the nucleic acid strand may be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), for example, it may be deoxyribonucleic acid, but is limited thereto it is not going to be

In one embodiment of the present invention, when the nucleic acid strand is DNA, the template may include a sense strand and an anti-sense strand.

In one embodiment of the present invention, the restriction enzyme recognition sequence may be included in the 3' end of the second restriction enzyme recognition part.

When the restriction enzyme recognition sequence is included in the 3' end of the second restriction enzyme recognition part, the second binding part complementary to the template may be further cleaved compared to that not included in the 3' end.

Through this, it is possible to prevent amplification of the first binding part and the second binding part complementary to the PCR sample without being cut.

In the present invention, the first restriction enzyme cleavage portion may be included in the first binding portion.

In the present invention, the second restriction enzyme cleavage portion may be included in the second binding portion.

In one embodiment of the present invention, the forward primer may amplify the sense strand by complementary binding to the sense strand of the template through the first binding portion.

In one embodiment of the present invention, the forward primer may amplify the antisense strand by complementary binding to the antisense strand of the template through the second binding portion.

In one embodiment of the present invention, the sense strand of the template may not include a nucleotide sequence complementary to a restriction enzyme recognition sequence.

In one embodiment of the present invention, the antisense strand of the template may not include a nucleotide sequence complementary to a restriction enzyme recognition sequence.

In one embodiment of the present invention, the first binding portion may be capable of specifically binding to a first target sequence consisting of a nucleotide sequence complementary thereto.

In one embodiment of the present invention, when the template is DNA, the first target sequence may be a sequence included in the sense strand of the template.

In one embodiment of the present invention, the second binding portion may be capable of specifically binding to a second target sequence consisting of a nucleotide sequence complementary thereto.

In one embodiment of the present invention, when the template is DNA, the second target sequence may be a sequence included in the antisense strand of the template.

In one embodiment of the present invention, when the template is RNA, the first target sequence and the second target sequence may be included in one template strand.

In one embodiment of the present invention, the first target sequence is a nucleotide sequence capable of binding with a forward primer in order to amplify the nucleotide sequence encoding the 112th amino acid (rs429358) or the 158th amino acid (rs7412) of the APOE protein. can be

In one embodiment of the present invention, the second target sequence is a nucleotide sequence capable of binding with a reverse primer in order to amplify the nucleotide sequence encoding the 112th amino acid (rs429358) or the 158th amino acid (rs7412) of the APOE protein. can be

As used herein, the term “primer” may refer to an oligonucleotide having a short free 3′ hydroxyl group.

Primers are generally capable of forming a base pair by binding to a template containing a nucleotide sequence complementary to the nucleotide sequence (annealing) and serving as a starting point for copying the template. .

As used herein, the term “complementary” may refer to a sequence relationship between two nucleic acid strands that are sufficiently complementary to anneal to form a stable double strand.

As used herein, the term “annealing” is used interchangeably with the term “hybridization” and is a base-pairing interaction of a nucleic acid with another nucleic acid that results in the form of a double-stranded, triple-stranded, or other higher-order structure. means action.

The primary interactions are base-specific interactions, such as A/T and G/C, by Watson/Crick and Hoogsteen-type hydrogen bonding. In certain embodiments, base-stacking and hydrophobic interactions may also contribute to double-stranded stability.

In the present invention, the primer set may include a forward primer and a reverse primer.

In one embodiment of the present invention, the forward primer may bind to the template through a first binding portion comprising a nucleotide sequence complementary to the first target sequence.

In a more specific example of the present invention, the forward primer may include a nucleotide sequence consisting of SEQ ID NO: 1 or 3.

In one embodiment of the present invention, the reverse primer may bind to the template through a second binding portion comprising a nucleotide sequence complementary to the second target sequence.

In a more specific example of the present invention, the reverse primer may include a nucleotide sequence consisting of SEQ ID NO: 2 or 4.

In one embodiment of the present invention, the forward primer containing the nucleotide sequence consisting of SEQ ID NO: 1 and the reverse primer containing the nucleotide sequence consisting of SEQ ID NO: 2 are a single gene of rs429358 (gene encoding the 112th amino acid) on the Apoprotein E gene. It may be a primer set for confirming single nucleotide polymorphism (SNP).

In one embodiment of the present invention, the forward primer containing the nucleotide sequence consisting of SEQ ID NO: 3 and the reverse primer containing the nucleotide sequence consisting of SEQ ID NO: 4 are a single gene of rs7412 (gene encoding the 158th amino acid) on the Apoprotein E gene. It may be a primer set for confirming a nucleotide polymorphism.

As used herein, the term "cross-contamination (carryover contamination)" may mean that the PCR product is mixed with a subsequent PCR sample through air or various routes, thereby causing false positive or false negative results of the subsequent PCR sample. .

When the primer set of the present invention is used, the restriction enzyme recognition part and restriction enzyme cut part are included in the PCR product, so even if the next PCR sample is contaminated by the previous PCR product (cross-contamination) through air, etc., the restriction enzyme in the next PCR sample Amplification of cross-contamination can be prevented simply by mixing.

The PCR method using the primer set of the present invention may use deoxynucleoside triphosphate (dNTP) to remove cross-contamination.

In the present invention, the PCR method may be hot start PCR, nested PCR, multiplex PCR, RT (reverse transcription) PCR or RT-nested PCR, etc., The present invention is not limited thereto.

In the present invention, since the PCR method does not use deoxyuridine triphosphate (dUTP), PCR efficiency can be improved compared to other cross-contamination removal methods using dUTP.

Another embodiment of the present invention comprises a first restriction enzyme recognition portion comprising a first binding portion capable of specifically binding to a first target sequence and at least one or more restriction enzyme recognition sequences,

The first binding portion comprising a first restriction enzyme cleavage portion, the forward primer;

and a second restriction enzyme recognition portion comprising a second binding portion capable of specifically binding to a second target sequence and at least one or more restriction enzyme recognition sequences,

The second binding portion comprises a second restriction enzyme cleavage portion, a reverse primer; And restriction enzyme; relates to a composition for removing PCR cross contamination comprising.

In the present invention, the composition comprises a forward primer comprising a first binding portion comprising a first restriction enzyme cleavage portion, and a first binding portion connected to a first restriction enzyme recognition portion at the 5' end; It may include a reverse primer including a second binding portion including a second restriction enzyme cleavage portion, and a second binding portion connected to a second restriction enzyme recognition portion at the 5' end.

In one embodiment of the present invention, the first binding portion is capable of specifically binding to a first target sequence comprising a nucleotide sequence complementary thereto, and the first target sequence may be a sequence included in the sense strand of the template.

In one embodiment of the present invention, the second binding portion is capable of specifically binding to a second target sequence comprising a nucleotide sequence complementary thereto, and the second target sequence may be a sequence included in the antisense strand of the template.

In one embodiment of the present invention, the first binding moiety is capable of specifically binding to a first target sequence, the first target sequence is included in the sense strand of the template, and the second binding moiety is specifically capable of binding to a second target sequence Possibly, the second target sequence may be included in the antisense strand of the template.

In the present invention, the template has a content of guanine (G) and cytosine (C) of 50 to 90%, 50 to 85%, 50 to 80%, 55 to 90%, 55 to 85% based on the total number of bases in the template , 55-80%, 60-90%, 60-85%, 60-80%, 65-90%, 65-85%, 65-80%, 70-90%, 70-85% or 70-80% may be, for example, may be 70 to 80%, but is not limited thereto.

In the present invention, the composition may include a restriction enzyme.

In the present invention, the restriction enzyme may cut a single-stranded template, a double-stranded template, or both, but is not limited thereto.

In the present invention, the restriction enzyme may be a Type II restriction enzyme.

In the present invention, the Type II restriction enzyme may be one that shows specificity for both the restriction enzyme recognition sequence and the restriction enzyme cut part of the restriction enzyme recognition part, and recognizes and cuts the restriction enzyme cut part separated from the restriction enzyme recognition sequence.

In the present invention, the Type II restriction enzyme is specifically selected from the group consisting of Type orthodox II, Type II S, Type II E, Type II F, Type II T, Type II G, Type II M, Type II B. It may be more than one species, for example, it may be a Type II S restriction enzyme, but is not limited thereto.

In the present invention, Type II restriction enzymes are HphI, Fok I, AcuI, BbsI, BbvI, BccI, BceAI, BciVI, BfuAI, BmrI, BpmI, BsaI, BseRI, BsmAI, BsmBI, BsrDI, EarI, EciI, FspEI, LpnPI, It may be one or more selected from the group consisting of MboII, MlyI, MmeI, MnlI, MspJI and SapI, for example, may be HphI and Fok I, but is not limited thereto.

In the present invention, the composition may further include one or more selected from the group consisting of Taq polymerase (Taq polymerase), a reaction buffer such as MgCl ₂ , dNTP and a stabilizer, but is not limited thereto, and sugar Other reagents known in the art may additionally be included.

In the present invention, the composition may not contain uracil DNA glycosylase (UDG).

The uracil DNA glycosylase (UDG) system is mainly used for amplifying thymine-rich templates. Since the thymine-rich template contains a lot of uracil in the PCR product, even if the subsequent PCR sample is contaminated by the PCR product or the RT-PCR product, cross-contamination can be removed by using uracil DNA glycosylation. However, since the Guanine/Cytosine-rich template contains only a small amount of uracil in the PCR product, the cross-contamination removal efficiency of uracil DNA glycosylase may decrease.

When the composition of the present invention is used, the forward primer and the reverse primer allow the PCR product to contain the restriction enzyme recognition part and the restriction enzyme cut part, so the next PCR sample is air, etc. to the previous PCR product or RT-PCR product (cross-contamination). Even if it is contaminated by the above, it is possible to prevent amplification of cross-contaminants simply by mixing restriction enzymes with the next PCR sample. In addition, it is possible to reduce errors in the analysis of mRNA samples or additional analysis of PCR products.

In another embodiment of the present invention, the forward primer may include a nucleotide sequence consisting of SEQ ID NO: 6.

In one embodiment of the present invention, the forward primer including the nucleotide sequence consisting of SEQ ID NO: 6 and the reverse primer including the nucleotide sequence consisting of SEQ ID NO: 7 are single-stranded RNA (ssRNA) of SARS-Cov-2 virus ) may be a primer set to confirm.

In another more specific example of the present invention, the forward primer may include a nucleotide sequence consisting of SEQ ID NO: 1, 3 or 6.

In another more specific example of the present invention, the reverse primer may include a nucleotide sequence consisting of SEQ ID NO: 2, 4 or 7.

In the present invention, the primer set or composition may further include a probe that allows the PCR amplification product to exhibit fluorescence.

In another embodiment of the present invention, the probe may include a nucleotide sequence consisting of SEQ ID NO: 8.

The present invention relates to a primer set comprising a forward primer and a reverse primer, and when PCR is performed using the primer set of the present invention, even if the next PCR sample is contaminated by the previous PCR product (cross-contamination) through air, etc., Amplification of cross-contaminants can be prevented simply by mixing restriction enzymes in the next PCR sample.

In addition, since the primer set of the present invention uses dNTP, PCR efficiency is improved compared to other cross-contamination removal methods using dUTP.

In addition, the composition for removing PCR cross-contaminants of the present invention can remove cross-contaminants present in PCR products without including uracil DNA glycosylase (UDG). error can be reduced.

Figure 1a is a schematic diagram showing the entire process of the primer of the present invention to remove cross-contamination.
Figure 1b is an enlarged schematic view showing the binding of the primer of the present invention to the template (template).
2 is a photograph of the result of polyacrylamide gel electrophoresis (PAGE) confirming whether or not the PCR product was cut after the PCR product was treated with the restriction enzyme HphI.
Figure 3a is a graph showing the results of PCR by distinguishing the 112 site PCR product subjected to polyacrylamide gel electrophoresis (PAGE) with and without restriction enzyme treatment.
Figure 3b is a graph showing the results of PCR by distinguishing the 158 site PCR product subjected to polyacrylamide gel electrophoresis (PAGE) with and without restriction enzyme treatment.
Figure 4a is a graph showing the measurement of the Ct value of the 112 site PCR product for each restriction enzyme processing unit.
Figure 4b is a graph showing the measurement of the Ct value of the 158 site PCR product for each restriction enzyme processing unit.
4c is a graph showing comparison of Ct values of PCR products for each restriction enzyme processing unit.
Figure 5a is a graph showing the results of PCR by dividing the 112 site PCR product was not treated with Fok I restriction enzyme (- Fok I) and treated (+ Fok I).
Figure 5b is a graph showing the results of PCR by dividing the 112 site PCR product was not treated with the HphI restriction enzyme (-HphI) and (+ HphI).
FIG. 5c is a graph showing the results of PCR by dividing the 158 site PCR product into a case where the HphI restriction enzyme was not treated (-HphI) and a case where the HphI restriction enzyme was treated (+ HphI).
Figure 6a is a graph showing the results of performing PCR by varying whether or not HphI restriction enzyme treatment on the ε4 plasmid, 112 site PCR product, or a mixture thereof.
Figure 6b is a graph showing the results of performing PCR by varying whether the HphI restriction enzyme treatment on the ε4 plasmid, the 158 site PCR product, or a mixture thereof.
7 is a graph confirming whether RT-PCR amplification of a synthetic RNA (EURM-019) RT-PCR product according to whether or not Fok I is added.
8 is a graph confirming whether RT-PCR amplification of the RT-PCR product of synthetic RNA (EURM-019) according to the amount of Fok I added.
9 is a graph confirming whether RT-PCR amplification according to whether or not Fok I is added to synthetic RNA, its PCR product, and a combination thereof.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

manufacturing example. Primer design

The entire process of the action of the primer of the present invention is schematically shown in Figure 1a. In addition, the binding of the primer of the present invention to the template (template) is shown in Figure 1b to enlarge and schematically.

As the template DNA sample, 10 ng (10 ^-9 g) of a human DNA sample and 10 fg (10 ^-15 g) of a plasmid sample were prepared. A total of three plasmids were used: a plasmid having the APOE ε2 genotype, a plasmid having the APOE ε4 genotype, and a plasmid having the APOE ε2/ε4 genotype simultaneously.

The primer has a recognition site that recognizes restriction enzymes Fok I and HphI, the recognition site is located at the 5' end of the primer, and the cleavage site to be cleaved by the restriction enzyme is The primers shown in Table 1 were designed so that the primers were located inside the binding site (priming sequence) that binds to the template.

112F-R is a forward primer for SNP copy of 112 site of APOE gene. 112R-R is a reverse primer for SNP copy of 112 site of APOE gene. 158F-R is a forward primer for SNP copy of APOE gene site 158. 158R-R is a reverse primer for SNP copy of 158 site of APOE gene. Among the primer sequences of SEQ ID NOs: 1 to 4, the HphI recognition sequence is underlined and the Fok I recognition sequence is italicized.

SEQ ID NO: designation order One 112F-R 5`-ACGGC GGAT G GTGA -GGGCACGGCTGTCCAAGGAG-3' 2 112R-R 5`-ACGGC GGAT G GTGA -CTCGCCGCGGTACTGCACCA-3' 3 158F-R 5`-ACGGC GGAT G GTGA -GCAAGCTGCGTAAGCGGCTCC-3' 4 158R-R 5`-ACGGC GGAT G GTGA -CTCGCGGATGGCGCTGAG-3'

Experimental Example 1. PCR product cleavage by HphI restriction enzyme

PCR (RotorGene-Q, Qiagen) was performed using human DNA as a template. For PCR, 1 unit of HotTaq DNA polymerase (Bioquest), Tris buffer (Bioquest), 0.2 mM dNTP, 5% DMSO, 1X SFCgreen I (SFC) were used, and primers were used. 0.2 uM of the 112F-R, 112R-R, 158F-R and 158R-R primers in Table 1 were used.

After treating the generated PCR product with the restriction enzyme HphI, it was checked whether the PCR product was cleaved through 12% polyacrylamide gel electrophoresis (PAGE), and the results are shown in FIG. 2 .

As can be seen in Figure 2, the PCR product length of 112 site (112F-R / 112R-R primers) is 123 bp, and the length of the PCR product of 158 site (158F-R / 158R-R primers) is 141 bp, but restriction enzymes When 2 units of HphI were treated, both ends of the PCR product were cut, and the PCR product at site 112 was shortened to 79 bp, and the PCR product at site 158 was shortened to 97 bp.

In order to check whether the shortened PCR product is normally amplified, 4 samples subjected to PAGE (with and without restriction enzyme treatment on the 112 site PCR product, those with and without restriction enzyme treatment on the 158 site PCR product) (a total of 4 samples) as a template to perform PCR, and the results are shown in FIGS. 3a and 3b.

As can be seen in Figures 3a and 3b, the PCR product shortened by the restriction enzyme HphI was not amplified at either site 112 or site 158.

Experimental Example 2. Confirmation of amplification using real-time PCR

First, when the PCR product obtained in Experimental Example 1 was diluted so that the Ct value was near 30, and then 0, 1, 2.5, 5, 7.5, and 10 units of restriction enzymes were added, the Ct values of the 112 site and the 158 site were compared. Thus, it is shown in Table 2 and FIGS. 4A to 4C. Figure 4a is a 112 stie PCR product, Figure 4b is a 158 site PCR product is added by restriction enzyme HphI unit. When 10 units of HphI were added to site 158, all PCR products were decomposed and amplification was not performed.

Threshold cycle (Ct) unit 0 One 2.5 5 7.5 10 112 site 31.65 32.73 33.49 35.79 36.68 44.72 158 site 31.69 32.68 33.45 36.25 41.46 unamplified

From Table 2 and Figures 4a to 4c, when 0, 1, 2.5 units of restriction enzymes were added, the Ct value was 33 or less, and contaminants were not sufficiently removed, and when 7.5 and 10 units of restriction enzymes were added, the Ct value was 36 or more. was also determined to be cut. Accordingly, it was determined that 5 units of restriction enzyme was the appropriate amount, and subsequent experiments were carried out.

After diluting the PCR product obtained in Experimental Example 1 so that the Ct value was near 30, 5 units of Fok I or HphI restriction enzyme were added to the PCR product (+) and those without addition (-) were compared.

First, the reaction was carried out at 37 ° C. for 60 minutes so that the restriction enzyme could react, and then the reaction was performed at 95 ° C. for 15 minutes to inactivate the restriction enzyme, and the PCR reaction was started. 1 unit of HotTaq DNA polymerase (Bioquest), Tris buffer (Bioquest), 0.2 mM dNTP, 5% DMSO, 1X SFCgreen I were used, and the primers were 112F- 0.2 uM of R, 112R-R, 158F-R and 158R-R primers were used, and PCR was repeated 45 times at 95 °C (30 sec), 68 °C (60 sec) cycle, and the results are shown in FIGS. 5a to 5c.

Figure 5a is when Fok I is added to the 112 site PCR amplification product (+ Fok I), Figure 5b is when HphI is added to the 112 site PCR amplification product (+ HphI), Figure 5c is HphI to the 158 site PCR amplification product It shows the PCR amplification result of (+ HphI) when .

As can be seen in Figures 5a to 5c, in the absence of restriction enzyme, the fluorescence starts to increase from 25 to 30 cycles, but when the restriction enzyme is treated, the fluorescence does not increase until 45 cycles. That is, the PCR product was cleaved by restriction enzymes and did not act as a template.

In other words, when there is a restriction enzyme, it was confirmed that the primer binding portion of the PCR product was partially cut off by the restriction enzyme, and amplification was not performed because the primer was not coupled to the template.

Experimental Example 3. Removal of PCR cross-contamination mixed in the sample

Using the PCR product obtained by amplifying the plasmid having the APOE ε2 genotype and the plasmid having the APOE ε4 genotype that is not amplified, artificially creating an environment in which the ε4 plasmid is contaminated with the ε2 PCR product, thereby affecting the mixed template was confirmed.

Using 10 fg APOE ε4 plasmid and APOE ε2 plasmid as templates, PCR was performed in the same manner as in Experimental Example 1, and the mixed template was used to distinguish between PCR products at 112 sites and PCR products at 158 sites.

All reactions were first performed by adding a restriction enzyme to the PCR product and reacting at 37 °C for 60 minutes, then at 95 °C for 15 minutes, and repeating the cycle of 95 °C (30 sec) and 68 °C (60 sec) 45 times. did SFCgreen I was used as the fluorescent dye (dye), and the mixed PCR product was used in an amount with a Ct value of about 30.

The PCR results of 112 sites are shown in Table 3 and FIG. 6a.

Ct ε4 plasmid 26.51 ε4 plasmid + ε2 PCR product 26.51 ε2 PCR product 30.93 ε4 plasmid + HphI 24.58 ε4 plasmid + ε2 PCR product + HphI 23.92 ε2 PCR product + HphI 40.63

And, the PCR results of the 158 site are shown in Table 4 and Figure 6b.

Ct ε4 plasmid 26.04 ε4 plasmid + ε2 PCR product 25.90 ε2 PCR product 28.59 ε4 plasmid + HphI 25.60 ε4 plasmid + ε2 PCR product + HphI 25.81 ε2 PCR product + HphI not amplified

As can be seen in Tables 3, 4 and 6a and 6b, when using ε4 plasmid alone (ε4 plasmid) or a mixture of ε4 plasmid and ε2 PCR product (ε4 plasmid + ε2 PCR product) as a template, the addition of HphI restriction enzyme and amplified regardless.

However, when only the ε2 PCR product (ε2 PCR product) was used as a template, amplification was made when no restriction enzyme was added, whereas amplification was not made or was very weakly amplified when a restriction enzyme was added.

From this, it was confirmed that the primer set of the present invention can prevent amplification by removing cross-contamination present in the subsequent PCR sample even if the subsequent PCR sample is contaminated due to cross-contamination such as a PCR product.

Experimental Example 4. Confirmation of removal of RT-PCR products mixed with RNA

(1) Removal of RT-PCR products by Fok I

To make an RT-PCR product that can be mixed with RNA amplification, real-time RT-PCR was performed using synthetic RNA and primers to which a restriction enzyme recognition site was added. The RNA sequence of SEQ ID NO: 5 used (Sequence of the synthetic IVT RNA positive control, 880 nucleotides), the primer sequences of SEQ ID NOs: 6 and 7, and the probe sequence of SEQ ID NO: 8 are shown in Table 5. In SEQ ID NOs: 6 and 7, Fok I restriction enzyme recognition sites are indicated in italics.

SEQ ID NO: designation order 5 EURM-019 5`-GGGAGACGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGGAUAUCUGCAGAAUUCGCCCUUAUUCAAGUAUUGAGUGAAAUGGUCAUGUGUGGCGGUUCACUAUAUGUUAAACCAGGUGGAACCUCAUCAGGAGAUGCCACAACUGCUUAUGCUAAUAGUGUUUUUAACAUUUGUCAAGCUGUCCGGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAUUGCAACUGAGGGAGCCUUGAAUACACCAAAAGAUCACAUUGGCACCCGCAAUCCUGCUAACAAUGCUGCAAUCGUGCUACAACUUCCUCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAGUGUGACAUACCCAUUGGUGCAGGUAUAUGCGCUAGUUAUCAGACUCAGACUAAUUCUCCUCGGCGGGCACGUAGUGUAGCUAGUCAACCUGCUUUUGCUCGCUUGGAUCCGAAUUCAAAGGUGAAAUUGUUAUCCGCUCACAAUUCCACACAACAUACGAGCCGGAAGCAUAAAGUGUAAAGCCUGGGGUGCCUAAUGA-3' 6 RE_RdRP_F 5`-ACGGC GGATG -GTGARATGGTCATGTGTGGCGG-3' 7 RE_RdRP_R 5`-ACGGC GGATG -CARATGTTAAASACACTATTAGCATA-3' 8 RdRp_P 5`-CAGGTGGAACCTCATCAGGAGATGC-SFCQ1-3'

Specific experimental conditions are as follows. In 20 uL RT-PCR, HotTaq DNA polymerase and MMLV reverse transcriptase (Moloney Murine Leukemia Virus reverse transcriptase), 0.2 mM dNTP, 0.5 uM each of forward primer (RE_RdRp_F) and reverse primer (RE_RdRp_R), 0.1 uM of 5'-FAM (Dye) and 3'-SFCQ1 (Quencher) attached probe (RdRp_P, SFC), and synthetic RNA (EURM-019) with Covid-19 sequence 10,000 copies (copies) ), and then real-time RT-PCR was performed.

For real-time RT-PCR, Qiagen's RotorGene-Q was used, and reaction conditions were first performed at 50 °C for 5 minutes and at 95 °C for 15 minutes, followed by 95 °C (15 sec), 58 °C (45 sec) process. was repeated 45 times, and the amplification was confirmed by measuring FAM fluorescence.

The results of confirming whether the RT-PCR product was amplified according to whether or not 1.5U Fok I was added after diluting the thus-made RT-PCR product to 10^6 and 10^9 are shown in FIGS. 7 and 6 indicated.

Template Ct RT-PCR product 10^6 26.10 RT-PCR product 10^9 36.47 RT-PCR product 10^6 + FokⅠ 1.5U - RT-PCR product 10^9 + FokⅠ 1.5U -

7 and Table 6, when 1.5 U of Fok I was added to these amplification dilutions, the RT-PCR product was not amplified.

Next, by varying the addition amount of Fok I to 0 U, 0.5 U, 1.0 U, 1.5 U, and 2.0 U conditions, the results of confirming the degree of amplification removal for the dilution of the RT-PCR product are shown in FIGS. 8 and 7 .

Unit Ct 0 U 37.39 0.5 U 46.80 1.0 U - 1.5 U - 2.0 U -

As can be seen in Figures 8 and 7, the RT-PCR product was removed with only about 1.0 unit of Fok I.

(2) Removal of RT-PCR products mixed with RNA by Fok I

After the synthetic RNA (EURM-019) and its RT-PCR product were individually added or added simultaneously, 1.0 unit of Fok I was treated to confirm whether the synthetic RNA or RT-PCR product was amplified or not, the results are shown in FIGS. 9 and 8 indicated.

Template Ct RNA 34.35 RT-PCR product 37.62 RNA & RT-PCR product 33.56 RNA + FokⅠ 37.61 RT-PCR product + FokⅠ - RNA & RT-PCR product + FokⅠ 38.01

As can be seen in FIGS. 9 and 8, when the synthetic RNA and the RT-PCR product are individually or simultaneously added and then treated with 1.0 unit of Fok I, the RT-PCR product, which is a cross-contamination, is selectively removed, The template, synthetic RNA, was amplified. In other words, it was confirmed that in the PCR using DNA as a template as well as in RT-PCR using RNA as a template, the removal of RT-PCR products contaminated during the RT-PCR process by restriction enzymes was simultaneously performed.

<110> Bioquest, Inc. <120> PRIMER SET FOR REMOVING CROSS-CONTAMINANTS RELATED TO POLYMERLASE CHAIN REACTION <130> PN200381P <150> KR 10-2020-0186795 <151> 2020-12-29 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> 112F-R <400> 1 acggcggatg gtgagggcac ggctgtccaa ggag 34 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> 112R-R <400> 2 acggcggatg gtgactcgcc gcggtactgc acca 34 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> 158F-R <400> 3 acggcggatg gtgagcaagc tgcgtaagcg gctcc 35 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 158R-R <400> 4 acggcggatg gtgactcgcg gatggcgctg ag 32 <210> 5 <211> 880 <212> RNA <213> Artificial Sequence <220> <223> EURM-019 <400> 5 gggagacgaa uugggcccuc uagaugcaug cucgagcggc cgccagugug auggauaucu 60 gcagaauucg cccuuauuca aguauugagu gaaaugguca uguguggcgg uucacuauau 120 guuaaaccag guggaaccuc aucaggagau gccacaacug cuuaugcuaa uaguguuuuu 180 aacauuuguc aagcuguccg gaagagacag guacguuaau aguuaauagc guacuucuuu 240 uucuugcuuu cgugguauuc uugcuaguua cacuagccau ccuuacugcg cuucgauugu 300 gugcguacug cugcaauauu guuaacguau aauggacccc aaaaucagcg aaaugcaccc 360 cgcauuacgu uugguggacc cucagauuca acuggcagua accagaaugg agaacgcauu 420 gcaacugagg gagccuugaa uacaccaaaa gaucacauug gcacccgcaa uccugcuaac 480 aaugcugcaa ucgugcuaca acuuccucaa ggaaauuuug gggaccagga acuaauca 540 caaggaacug auuacaaaca uuggccgcaa auugcacaau uugcccccag cgcuucagcg 600 uucuucggaa ugucgcgcau uggcauggaa gucacaccuu cgggaacgug guugaccuac 660 acaggugcca ucaaauugga gugugacaua cccauuggug cagguauaug cgcuaguuau 720 cagacuca cuaauucucc ucggcgggca cguaguguag cuagucaacc ugcuuuugcu 780 cgcuuggauc cgaauucaaa ggugaaauug uuauccgcuc acaauuccac acaacauacg 840 agccggaagc auaaagugua aagccugggg ugccuaauga 880 <210> 6 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> RE_RdRP_F <400> 6 acggcggatg gtgaratggt catgtgtggc gg 32 <210> 7 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> RE_RdRP_R <400> 7 acggcggatg caratgttaa asacactatt agcata 36 <210> 8 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> RdRp_P <400> 8 caggtggaac ctcatcagga gatgc 25

Claims (8)

A first binding portion capable of specifically binding to a first target sequence and a first restriction enzyme recognition portion comprising at least one restriction enzyme recognition sequence,
The first binding portion comprising a first restriction enzyme cleavage portion, a forward primer; and
and a second restriction enzyme recognition portion comprising a second binding portion capable of specifically binding to a second target sequence and at least one restriction enzyme recognition sequence,
A primer set comprising a; the second binding portion comprising a second restriction enzyme cleavage portion, a reverse primer. According to claim 1, wherein the first restriction enzyme recognition portion is connected to the 5' end of the first binding portion,
The second restriction enzyme recognition part is linked to the 5' end of the second binding part, the primer set. The method of claim 1, wherein the first restriction enzyme recognition part or the second restriction enzyme recognition part comprises two different restriction enzyme recognition sequences so as to be common to each,
The different restriction enzyme recognition sequences are partially overlapping, the primer set. The method of claim 1, wherein when the template is DNA,
wherein the first target sequence is included in the sense strand of the template,
The second target sequence is included in the antisense strand of the template, the primer set. The primer set according to claim 4, wherein the template has a content of guanine (G) and cytosine (C) of 50 to 90% based on the total number of bases of the template. The primer set according to claim 1, wherein the restriction enzyme is a Type II restriction enzyme. 7. The method of claim 6, wherein the Type II restriction enzyme is HphI, Fok I, AcuI, BbsI, BbvI, BccI, BceAI, BciVI, BfuAI, Bmrl, BpmI, BsaI, BseRI, BsmAI, BsmBI, BsrDI, EarI, EciI, FspEI , LpnPI, MboII, MlyI, MmeI, MnlI, MspJI and at least one selected from the group consisting of SapI, the primer set. The method of claim 1, wherein when the template is RNA,
The primer set, wherein the first target sequence and the second target sequence are included in one template strand.

Images