CN110564761B

CN110564761B - Application of wheat WLHS1 gene in regulation and control of development of ears and grains of plants

Info

Publication number: CN110564761B
Application number: CN201910899664.9A
Authority: CN
Inventors: 李爱丽; 贾美玲; 耿帅锋; 毛龙
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2019-09-23
Filing date: 2019-09-23
Publication date: 2021-03-16
Anticipated expiration: 2039-09-23
Also published as: CN110564761A

Abstract

The invention relates to the technical field of plant molecular biology, in particular to application of a wheat WLHS1 gene in regulation and control of development of ears and grains of plants. The WLHS1 gene is found to have the function of regulating the development of wheat ears and grains, and can regulate the number of small ears per ear and the number of grains per ear. The overexpression of the WLHS1 gene in wheat can obviously increase the number of small ears per ear and the number of seeds per ear of wheat, and provides a new idea for increasing the yield of wheat.

Description

Application of wheat WLHS1 gene in regulation and control of development of ears and grains of plants

Technical Field

The invention relates to the technical field of plant molecular biology, in particular to application of a wheat WLHS1 gene in regulation and control of development of ears and grains of plants.

Background

Wheat is an important food crop, and about 40% of all people worldwide use wheat as a main food. Meanwhile, wheat is one of the three grains, the yield of the wheat is almost all edible, and the wheat is the grain crop which has the second yield to corn in the world. With the increase of the consumption level of Chinese residents, higher requirements on the yield and the quality of wheat are also put forward. The three elements of the wheat yield are the ear number, the grain number and the grain weight in unit area, and the relationship of the three elements is coordinated, so that the method has important significance in improving the wheat yield. The grain number of the ear is mainly controlled by the development condition of wheat floral organs, and is the final embodiment of floret differentiation and fructification. Therefore, the method has important significance for the research on the early development of the wheat head.

MADS-box genes are a class of genes that play an important role in plant growth and development. Plays an important role in regulating and controlling the growth and reproductive stage transformation of plants, the development of flower organs, fruits and other development processes. The MADS-box gene generally has four domains: respectively M, I, K and C. The M region is a highly conserved MADS-box region located N-terminal to the coding region of the gene and has the function of binding DNA, protein dimerization and binding to other factors. Another secondary conserved region is the K region, which is named for its high homology to keratin (keratin), which has 70 amino acids and whose secondary structure is a coiled-coil (coiled-coil) structure composed of three alpha helices (K1, K2, K3) and is involved in mediating protein-protein interactions. Between the M region and the K region, there is a less conserved spacer region of about 30 amino acids, called the I region (transcription), which facilitates the binding of dimeric transcription factors to DNA. Downstream of the K region, is the C region of the domain (carboxyl-terminal) with the most varied sequence and length, composed mainly of hydrophobic amino acids, although the variation in the C-terminus is large, the different classes of MADS-box genes often contain some conserved motifs (motifs) that play an important role in the formation of protein complexes and activation of transcription.

At present, the MADS-box gene family has little analysis and research on the structure and function of wheat, and the biological function and molecular mechanism of the gene family in wheat are not clear. The WLHS1 gene is located on the fourth homologous group of wheat, and belongs to the MADS-box gene family, SEP-like gene.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention aims to provide the application of the WLHS1 gene in regulation and control of the development of ears and grains of plants.

In order to achieve the purpose, the technical scheme of the invention is as follows:

in a first aspect, the invention provides the use of a WLHS1 protein or a gene encoding the same in modulating panicle or grain development in a plant.

In a second aspect, the invention provides the use of a WLHS1 protein or a gene encoding it in the regulation of seed number per ear in plants.

In a third aspect, the invention provides an application of WLHS1 protein or a coding gene thereof in regulating and controlling the spikelet number of a plant.

In a fourth aspect, the invention provides the application of the WLHS1 protein or the coding gene thereof in plant genetic breeding, plant germplasm resource improvement or construction of transgenic plants.

The WLHS1 protein or the coding gene thereof can be applied in the form of WLHS1 protein or the coding gene thereof, or in the form of expression cassettes, vectors, engineering bacteria, host cells or transgenic plant cells containing WLHS1 gene.

In the invention, the sequence of the WLHS1 protein is any one of the following sequences:

(1) an amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3;

(2) the amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acids in the amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3;

(3) an amino acid sequence of protein which has at least 70 percent of homology with any one of the amino acid sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 and has the same function.

Preferably, the above homology is at least 80%; more preferably at least 90%; most preferably 99%.

The WLHS1 gene is located on the fourth homologous group of wheat, and belongs to the MADS-box gene family, SEP-like gene. The sequence of WLHS1 gene in wheat 4A homologous chromosome is shown in SEQ ID NO.4, and the coding protein sequence is shown in SEQ ID NO. 1; the sequence of wheat 4B homologous chromosome is shown as SEQ ID NO.5, and the sequence of its coded protein is shown as SEQ ID NO. 2; the sequence of wheat 4D homologous chromosome is shown as SEQ ID NO.6, and the sequence of its coded protein is shown as SEQ ID NO. 3. The skilled person can substitute, delete and/or add one or more amino acids according to the amino acid sequence of WLHS1 disclosed in the present invention by using conservative substitution of amino acids and other technical means routine in the art, without affecting the activity thereof, to obtain the mutant of the WLHS1 protein.

In the invention, the sequence of the coding gene of the WLHS1 protein is any one of the following genes:

(1) the nucleotide sequence shown in any one of SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 or a complementary sequence thereof;

(2) the coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more basic groups into the nucleotide sequence shown in any one of SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.

The WLHS1 gene can be any nucleotide sequence capable of coding the WLHS1 protein. In view of codon degeneracy and codon preference of different species, one skilled in the art can use sequences of WLHS1 gene as appropriate for expression in a particular species.

Preferably, in the above application, the plant is a monocotyledon. More preferably wheat.

Experiments prove that after the WLHS1 gene is over-expressed in a plant, the number of spikelets per spike and the number of seeds per spike of the plant are obviously increased.

In a fifth aspect, the present invention provides a method of modulating development of ears or grain in a plant by modulating expression of a WLHS1 gene in said plant; the sequence of the WLHS1 gene is any one of the following sequences:

Preferably, in the above method, the plant is a monocotyledon; more preferably wheat.

Preferably, the ear or grain development of the regulatory plant is to increase the number of spikelets per ear or the number of seeds per ear of the plant, and the expression of the regulatory WLHS1 gene is to overexpress the WLHS1 gene in the plant.

Preferably, the over-expressing WLHS1 gene is an over-expression vector plasmid carrying the WLHS1 gene introduced into the plant.

In a preferred embodiment of the present invention, when overexpression of the WLHS1 gene is performed, the WLHS1 gene is transcribed by the 35S promoter.

As a preferred embodiment of the present invention, the overexpression vector plasmid is a CUB plasmid.

In a sixth aspect, the invention provides specific primers for cloning the WLHS1 gene, the sequences of which are shown as SEQ ID NO.7-8 or SEQ ID NO. 9-10.

In a seventh aspect, the invention provides application of the specific primer for cloning WLHS1 gene in constructing over-expression vector plasmid of wheat WLHS1 gene.

In an eighth aspect, the invention provides a construction method of WLHS1 gene overexpression vector plasmid, which is obtained by connecting the WLHS1 gene obtained by amplification with an overexpression vector plasmid.

Specifically, the construction method of the WLHS1 gene overexpression vector plasmid comprises the following steps:

(1) using wheat cDNA as a template, and amplifying a WLHS1 gene by using primers shown as SEQ ID NO. 9-10;

(2) connecting the WLHS1 gene obtained in the step (1) with a vector pAHC25-TiDPK1-6 XMYC to obtain an over-expression intermediate vector WLHS1-pAHC25-6 XMYC;

(3) WLHS1-pAHC25-6 XMYC is used as a template, and a WLHS1 fragment fused with 6 XMYC is amplified by using primers shown in SEQ ID NO. 13-14;

(4) connecting the WLHS1 fragment fused with 6 XMYC with an overexpression vector CUB to obtain a WLHS1 gene overexpression vector plasmid.

The beneficial effects of the invention at least comprise:

the WLHS1 gene is found to have the function of regulating the development of wheat ears and grains, and can regulate the number of wheat ears per ear or the number of grains per ear. The overexpression of the WLHS1 gene in wheat can obviously increase the number of small ears per ear and the number of seeds per ear of wheat, and provides a new idea for increasing the yield of wheat.

The invention also provides a specific primer for cloning and detecting the WLHS1 gene and a construction method of WLHS1 gene overexpression vector plasmid, and provides a technical basis for the application of WLHS 1.

Drawings

FIG. 1 is a map of pAHC25-TiDPK 1-6X MYC vector in example 2 of the present invention.

FIG. 2 is a map of the CUB vector in example 3 of the present invention.

FIG. 3 is a diagram showing the results of PCR identification of positive plants of T1 generation of Fielder wheat transgenic for WLHS1-D gene in example 4 of the present invention, in which WT is a wild-type Fielder used as a negative control, 1-16 are plants of T1 generation, and the band of 750bp in the diagram represents the band of exogenous WLHS1-D gene sequence.

FIG. 4 is the result of phenotypic analysis of spikelets and kernels of T3 generation of transgenic WLHS1-D gene Fielder plants in example 4 of the present invention, wherein A is the phenotypic analysis chart of spikelet number; b is a phenotypic analysis chart of seed number; WT represents the Fielder wild type, 1, 2, 3 represent T3 generation Fielder plants transformed with WLHS1-D gene, respectively.

FIG. 5 is a statistical result of spikelet number (spike number per spike) of T3 generation Fielder plants of transgenic WLHS1-D gene in example 4 of the present invention, wherein WT represents the spikelet number of the Fielder plants, L-1, L-2, L-3 represent the spikelet number of T3 generation plants of transgenic WLHS1-D gene Fielder plants, respectively, and sample amount n =20, which represents the difference is very significant.

FIG. 6 is a statistical result of the number of seeds per ear (gain number period) of T3 generation Fielder plants transformed with WLHS1-D gene in example 4 of the present invention, wherein WT represents the number of seeds per ear of the Fielder plants, L-1, L-2, L-3 represent the number of seeds per ear of T3 generation plants transformed with WLHS1-D gene Fielder plants, respectively, and the sample amount n =20, which represents the very significant difference.

FIG. 7 is the result of analysis of expression level of WLHS1-D gene in T3 generation plants transformed with WLHS1-D gene Fielder in example 4 of the present invention, in which WT represents the Fielder wild type, and 1, 2, 3, 5, 6 represent T3 generation plants transformed with WLHS1-D gene Fielder, respectively.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 cloning of wheat WLHS1 Gene

Using cDNA of young ears of Chinese spring (Triticum aestivum L.) as a template, cloning WLHS1 gene (WLHS 1-D) located on wheat 4D homologous chromosome, and the specific method comprises the following steps:

(1) extracting total RNA of wheat young ears: extracting total RNA of young ears in spring of China by using a miniKit kit (QIAGEN);

(2) synthesis of first fragment of WLHS1 gene cDNA: following the instructions for reverse transcriptase M-MLV (Promega);

(3) cloning the coding region sequence of WLHS 1; and (3) carrying out PCR amplification on the WLHS1 gene by using the young ear cDNA of the Chinese spring (Triticum aestivum L.) obtained in the step (2) as a template and using a specific primer (SEQ ID NO. 7-8) for amplifying the WLHS1 gene.

SEQ ID NO. 7: a forward primer: GAGATGGGTCGGGGGAAG, respectively;

SEQ ID NO. 8: reverse primer: GTCACCGAAGTACAAATACATTAGC are provided.

Reaction procedure for PCR amplification: 94 ℃ for 10 min; 94 deg.C, 30s, 56 deg.C, 30s, 72 deg.C, 1min, 35 cycles; 72 ℃ for 10 min.

Reaction system for PCR amplification (product of all-open type gold Co.): 5 × TransStart FastPfu buffer 10 μ l, dNTP 4 μ l, TransStart FastPfu DNA polymerase 1 μ l, forward primer (10 μ M) 2 μ l, reverse primer (10 μ M) 2 μ l, cDNA template 5 μ l, double distilled water make up to 50 μ l.

After the PCR product is cut, recovered and purified, the product is cloned and connected to a pEASY-Blunt Zero Cloning Kit provided by Beijing all-purpose gold biotechnology limited according to a pEASY-Blunt Zero Cloning Kit Cloning method, the connection product is transformed into Escherichia coli DH5 alpha, the amplification is carried out in the vector, and the WLHS1 gene is obtained by sequencing and screening of positive clone.

Example 2 construction of an intermediate vector for overexpression of the WLHS1 Gene

Before constructing an overexpression vector of the WLHS1-D gene, firstly connecting the WLHS1 gene with a pAHC25-TiDPK1-6 XMYC vector (a plasmid map is shown in figure 1) to construct an overexpression intermediate vector of the WLHS1-D gene, and the specific method is as follows:

(1) designing a primer: designing a full-length cloning Primer of WLHS1 cDNA by using Primer premier 5.0 software, wherein a forward Primer ch-WLHS1-F1 has a SpeI restriction enzyme site, and a reverse Primer ch-WLHS1-R1 has an EcoKI restriction enzyme site;

SEQ ID NO.9：ch-WLHS1-F1：GGACTAGTATGGGTCGGGGGAAGGTG；

SEQ ID NO.10：ch-WLHS1-R1：CCGAGCTCTCAGAAGCCACGTGATCT；

(2) amplification of WLHS1 fragment: extracting total RNA from young ears of spring wheat in China by using TRIzol Reagent, and performing reverse transcription on the total RNA into cDNA by using a reverse transcription kit of the whole gold company after the concentration is measured; PCR amplifying a WLHS1-D fragment with SpeI and EcoKI enzyme cutting sites by using a forward primer ch-WLHS1-F1, a reverse primer ch-WLHS1-R1 and high-fidelity enzyme and cDNA obtained by reverse transcription as a template;

the reaction procedure for PCR amplification was as follows: at 95 ℃ for 10 min; 95 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 30 cycles; 72 ℃ for 10 min;

verifying the PCR amplified product by using 1% agarose gel electrophoresis, and recovering the PCR product by using a gel recovery kit;

(3) enzyme digestion: carrying out double enzyme digestion on the pAHC25-6 XMYC vector by SpeI and EcoKI and the WLHS1-D fragment with SpeI and EcoKI enzyme digestion sites obtained by purification in the step (2), and recovering the linearized vector and the target fragment by using a glue recovery kit;

(4) connecting: the reaction system is as follows: mu.L of the target fragment, 2. mu.L of linearized vector, 1. mu.L of T4 ligase, 1. mu.L of Buffer ligated with T4, and extension of the target fragment with ddH₂O to 10. mu.L, and ligation was performed overnight at 16 ℃;

(5) and (3) vector transformation: adopting a heat shock transformation method, carrying out heat shock on the ligation product and a mixture of competent escherichia coli in a water bath kettle at 42 ℃ for 45s, adding 0.5ml of LB liquid culture medium without resistance, and activating bacteria at 37 ℃ and 220rpm for 45 min;

(6) coating a plate: centrifuging the activated bacterial liquid for a short time, removing 0.4ml of supernatant, and fully and uniformly mixing; uniformly spreading on a solid LB plate containing kanamycin resistance, standing for 10min, and then placing in a constant-temperature incubator at 37 ℃ for culturing for 10-16 h;

(7) screening and identifying positive clones: picking the single clone into a new 1.5ml centrifuge tube (about 0.5ml of liquid LB containing kanamycin resistance), and then putting the single clone into a shaker at 37 ℃ and 220rpm for culturing for 4-8 h; taking the bacterial liquid as a template, carrying out PCR amplification by using specific detection primers UBI-F (SEQ ID NO. 11) and NOS-R (SEQ ID NO. 12), and then carrying out electrophoresis detection by using 1% agarose gel, wherein a target fragment appears, a single band is identified as a positive clone, and the others are negative clones;

SEQ ID NO.11: UBI-F：TTTAGCCCTGCCTTCATACGCT；

SEQ ID NO.12: NOS-R：TGTATAATTGCGGGACTCTAATC。

(8) sequencing and result alignment: sequencing the positive clone bacteria liquid, comparing sequencing results and analyzing the accuracy of the sequence. And extracting plasmids from the bacterial liquid with correct sequencing to obtain an over-expression intermediate vector WLHS1-pAHC25-6 xMYC of the WLHS1 gene.

Example 3 construction of overexpression vector plasmid for WLHS1 Gene

On the basis of the WLHS1 gene overexpression intermediate vector WLHS1-pAHC25-6 XMYC constructed in example 2, a CUB vector (a plasmid map is shown in figure 2) is further taken as a starting vector to construct an overexpression vector plasmid of the WLHS1 gene, and the specific method is as follows:

(1) using an overexpression intermediate vector WLHS1-pAHC25-6 XMYC of the WLHS1 gene constructed in example 2 as a template, and using primers ch-WLHS1-F2 and ch-WLHS1-R2 (ch-WLHS 1-F2 has a BamHI restriction site, and ch-WLHS1-R2 does not have a restriction site) to amplify a fusion gene fragment with 6 XMYC and WLHS1-D gene fragments;

SEQ ID NO.13：ch-WLHS1-F2：GCGGATCCGACGGTATCGATTTAAAGC；

SEQ ID NO.14：ch-WLHS1-R2：TCAGAAGCCACGTGATCTCTGTTTG；

(2) enzyme digestion, ligation, transformation and screening, identification and sequencing of positive clones are the same as the method in steps (3) - (8) of example 2, and the overexpression vector plasmid ch-WLHS1-CUB of the WLHS1 gene is constructed.

(3) Culturing C58C1, which is the susceptible state of the ch-WLHS1-CUB transformed agrobacterium at 28 ℃ for 2 days, picking a monoclonal from a transformation plate, performing shake culture in a liquid culture medium, and performing PCR verification; after shaking greatly, extracting plasmid, transforming colibacillus and sequencing again;

(4) adding glycerol into the bacterial liquid of the agrobacterium tumefaciens strain which is correctly identified, uniformly mixing, and storing in a refrigerator at the temperature of minus 80 ℃ for later use.

Example 4 construction and trait analysis of WLHS1 transgenic wheat

By utilizing an agrobacterium-mediated method, the agrobacterium carrying the ch-WLHS1-CUB overexpression vector plasmid constructed in the embodiment 3 is transformed into wheat callus to construct WLHS1 gene-transformed wheat, and the specific method is as follows:

1. inducing callus

(1) Shearing immature seeds of Fielder wheat in a clean bench, sterilizing in 20ml 70% alcohol for 30s, and cleaning with sterile water for 3 times; then adding 20ml of 1.3% sodium hypochlorite solution, slightly inverting the centrifuge tube to sterilize for 4min, and cleaning with sterile water for 3 times;

(2) peeling off the hull under a microscope by using a pointed-end forceps, taking the Fielder immature embryo with the length of preferably less than 0.3mm, otherwise, reducing the callus induction probability;

(3) placing the young embryo on an induction callus culture medium, placing 10-20 plates on each plate, placing in a culture room at 25 ℃ for dark culture for 3 weeks, cutting off the young embryo if a stem grows out, or otherwise affecting the induction callus;

(4) selecting cream-yellow compact callus, each piece can be divided into 2-4 small pieces, transferring to new callus induction culture medium, and dark culturing in 25 deg.C culture room for 2 weeks;

(5) continuously selecting the compact milk yellow callus for propagation, dividing each callus into 3-5 pieces, transferring to a new callus induction culture medium, and culturing in dark at 25 deg.C for 1 week.

2. Transformation callus

(1) Coating 200 μ l overnight cultured Agrobacterium with ch-WLHS1-CUB overexpression vector plasmid on MGL culture medium plate, sealing with sealing film, inverting in 28 deg.C incubator, and culturing in dark for 2 days;

(2) scraping the agrobacterium on the solid plate, and suspending the agrobacterium in a centrifugal tube by using 10ml of suspension culture medium;

(3) culturing at 28 deg.C with shaking table at 220rpm for 45min, and adjusting OD of bacterial liquid with suspension culture medium₆₀₀＝1；

(4) Placing the callus in the bacterial liquid, shaking at room temperature for 5min, and removing the bacterial liquid; placing the callus on sterile paper, and placing in an ultra-clean workbench for 6min to dry;

(5) the calli were placed on a co-medium and cultured in the dark at 25 ℃ for 2 days.

3. Screening callus

(1) Transferring the co-cultured callus to a screening culture medium, and performing dark culture at 25 ℃ for 3 weeks;

(2) the normally surviving resistant callus needs to be screened again, and the amount of Hygromycin B in each liter of screening culture medium is changed to 0.6 ml; dark culture at 25 ℃ for 3 weeks.

4. Differentiation

(1) Transferring the hygromycin-resistant callus to a differentiation medium, and culturing for 2 weeks under the condition of 16h illumination at 25 ℃;

(2) the sprouts with smaller size can be transferred to a new differentiation medium and cultured for 2 weeks under 16h illumination at 25 ℃.

5. Rooting and transplanting

(1) Transferring the differentiated buds to a rooting culture medium, cutting off redundant calluses at the base of the buds, and continuously culturing for 2 weeks under the conditions of 25 ℃ and 16h of illumination.

(2) Selecting seedlings with longer roots, transplanting the seedlings into soil, covering the seedlings with a preservative film to avoid water evaporation, culturing the seedlings at 22 ℃ under 16-hour illumination, and removing the preservative film after 3 days.

The formula of the culture medium used in the method is as follows:

induction callus medium (pH 5.8): 100ml of 10 XMS macroelements, 10ml of 100 XMS microelements, 10ml of 100 xFe-EDTA, 30g of Sucrose, 2.5ml of 2,4-D (1 mg/ml), CuSO₄(1 mg/ml) 0.6ml, Phytagel 2g, sterile water to 990ml, 100 XM 5vitamins (added after sterilization) 10 ml.

MGL medium (pH 7.2): tryptone 5g, Yeast extract 2.5g, NaCl 5.2g, Mannitol10g, L-glutamine acid sodium salt 2.32g, KH₂PO₄0.5g，MgSO4·7H₂O0.2 g, Agar 10g, sterile water to 1L, Biotin (1 mg/ml, added after sterilization) 2. mu.l, Acetostyringone (30 mg/ml, added after sterilization) 1 ml.

Agrobacterium suspension medium (pH 5.5): 100ml of 10 XMS macroelements, 10ml of 100 XMS microelements, 10ml of 100 xFe-EDTA, 10g of Sucrose, 10g of Mannitol, sterile water to 1L, 1.5ml of Acetosyringone (30 mg/ml, added after sterilization).

Co-culture medium (pH 5.8): 100ml of 10 XMS macroelement, 10ml of 100 XMS microelement, 10ml of 100 xFe-EDTA, 30g of Sucrose, 2,4-D (1 mg/ml) 2.5ml, 2g of Phytagel, 990ml of sterile water, 10ml of 100 XM 5vitamins (added after sterilization), 2ml of Acetosyringone (30 mg/ml, added after sterilization).

Callus screening medium (pH 5.8): 100ml of 10 XMS macroelements, 10ml of 100 XMS microelements, 10ml of 100 xFe-EDTA, 30g of Sucrose, 2.5ml of 2,4-D (1 mg/ml), CuSO₄(1 mg/ml) 0.6ml, Phytagel 2g, sterile water make up to 990ml, Hy0.8ml of gromycin B (50 mg/ml, added after sterilization), 0.7ml of Timentin (320 mg/ml, added after sterilization), 10ml of 100 XM 5 vitamines (added after sterilization).

Differentiation medium (pH 5.8): 100ml of 10 XMS macroelements, 10ml of 100 XMS microelements, 10ml of 100 xFe-EDTA, 30g of Sucrose, 2g of Phytagel, sterile water to 990ml, 10ml of 100 XM 5vitamins (added after sterilization), 2ml of Kinetin (0.1 mg/ml, added after sterilization), 0.4ml of Hygromycin B (50 mg/ml, added after sterilization), and 0.7ml of Timentin (320 mg/ml, added after sterilization).

Rooting medium (pH 5.8): 40ml of 10 XMS macroelements, 40ml of 100 XMS microelements, 10ml of 100 xFe-EDTA, 6g of Agar, 2g of Phytagel, 10ml of 100 xB 5vitamins (added after sterilization) and 0.35ml of Timentin (320 mg/ml, added after sterilization).

Carrying out positive plant PCR identification on T1 generation plants of Fielder transformed by WLHS1-D by using young ear stage DNA as an amplification template, wherein identification primer sequences are shown as SEQ ID NO.11 and SEQ ID NO.15, a primer Ubi-F is designed aiming at a vector sequence, a primer WLHS1-D-R is designed aiming at a WLHS1-D sequence, and the specific sequence is as follows:

SEQ ID NO.11：Ubi-F：TTTAGCCCTGCCTTCATACGCT；

SEQ ID NO.15：WLHS1-D-R：GCTGATCGAGTAATACTTGATTCTTTTT。

the PCR identification result of T1 generation plant is shown in FIG. 3, wherein, the plant with 780bp band in the amplification product is positive plant.

The expression levels of WLHS1-D genes of T3 generations of Fielder wild type plants and transgenic positive plants are analyzed by adopting a semi-quantitative PCR detection method, and the result is shown in figure 7, and the result shows that the expression level of WLHS1-D in the transgenic plants is far higher than that of the wild type plants, which indicates that WLHS1-D is over-expressed in the transgenic plants.

The results of analyzing the phenotype of T3 generation plants of Fielder wheat of the transgenic WLHS1 gene are respectively shown in figure 4, figure 5 and figure 6, and show that the number of spikelets per ear (A and figure 5 of figure 4) and the number of seeds per ear (B and figure 6 of figure 4) of the transgenic plants are remarkably increased compared with those of wild-type plants, and the phenotype of increasing the number of spikelets per ear and the number of seeds per ear of the transgenic plants is realized by increasing the expression level of the WLHS1 gene because the expression level of the WLHS1-D gene in the transgenic plants is far higher than that of the wild-type plants.

In conclusion, WLHS1-D overexpression can significantly increase the number of spikelets per ear and the number of seeds per ear of wheat plants.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

Application of wheat WLHS1 gene in regulation and control of development of ears and grains of plant

<130> KHP191114606.9

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 170

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gly Arg Gly Lys Val Glu Met Arg Arg Ile Glu Asn Lys Ile Ser

1 5 10 15

Arg Gln Val Thr Phe Ala Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala

20 25 30

Tyr Glu Leu Ser Leu Leu Cys Asp Ala Glu Val Ala Leu Ile Ile Phe

35 40 45

Ser Gly Arg Gly Arg Leu Phe Glu Phe Ser Ser Ser Ser Cys Met Tyr

50 55 60

Lys Thr Leu Glu Arg Tyr Arg Thr Cys Asn Ser Asn Ser Gln Glu Ala

65 70 75 80

Ala Pro Pro Leu Glu Asn Glu Glu Gln Glu Leu Gln Asp Glu Asn Lys

85 90 95

Asp Leu Arg Lys Lys Leu Gln Asp Thr Thr Ser Ser Cys Gly Glu Asn

100 105 110

Ala Val His Met Ser Trp Gln Asp Gly Gly Gln Ser Ser Ser Arg Val

115 120 125

Leu Gln His Pro Glu His Asp Thr Ser Met Gln Ile Gly Tyr Pro Gln

130 135 140

Ala Tyr Met Asp Gln Leu Asn Ser Arg Asp His Val Ala Ser Glu Arg

145 150 155 160

Pro Gly Gly Gly Ser Ser Ala Gly Trp Ile

165 170

<210> 2

<211> 237

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Gly Arg Gly Lys Val Glu Met Arg Arg Ile Glu Asn Lys Ile Ser

1 5 10 15

Arg Gln Val Thr Phe Ala Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala

20 25 30

Tyr Glu Leu Ser Leu Leu Cys Asp Ala Glu Val Ala Leu Ile Ile Phe

35 40 45

Ser Gly Arg Gly Arg Leu Phe Glu Phe Ser Ser Ser Ser Cys Met Tyr

50 55 60

Lys Thr Leu Glu Arg Tyr Arg Thr Cys Asn Ser Asn Ser Gln Glu Ala

65 70 75 80

Thr Pro Pro Leu Glu Ser Glu Ile Asn Tyr Gln Glu Tyr Leu Lys Leu

85 90 95

Lys Thr Arg Val Glu Phe Leu Gln Ser Ser Gln Arg Asn Ile Leu Gly

100 105 110

Glu Asp Leu Gly Pro Leu Ser Met Lys Glu Leu Asp Gln Ile Glu Asn

115 120 125

Gln Ile Asp Ala Ser Leu Lys His Ile Arg Ser Lys Arg Asn Gln Val

130 135 140

Leu Leu Asp Gln Leu Phe Glu Leu Lys Ser Lys Glu Gln Glu Leu Gln

145 150 155 160

Asp Glu Asn Asn Asp Leu Arg Lys Lys Leu Gln Asp Thr Thr Ser Cys

165 170 175

Cys Gly Glu Asn Ala Val His Met Ser Trp Gln Asp Gly Gly Gln Cys

180 185 190

Ser Ser Arg Val Leu His Pro Glu His Asp Thr Ser Met Gln Ile Gly

195 200 205

Tyr Pro Arg Ala Tyr Met Asp Gln Leu Asn Asn Arg Asp His Val Ala

210 215 220

Cys Glu Arg Pro Gly Gly Gly Ser Ser Ala Gly Trp Ile

225 230 235

<210> 3

<211> 225

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Gly Arg Gly Lys Val Glu Met Arg Arg Ile Glu Asn Lys Ile Ser

1 5 10 15

Arg Gln Val Thr Phe Ala Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala

20 25 30

Tyr Glu Leu Ser Leu Leu Cys Asp Ala Glu Val Ala Leu Ile Ile Phe

35 40 45

Ser Gly Arg Gly Arg Leu Phe Glu Phe Ser Ser Ser Ser Cys Met Tyr

50 55 60

Arg Thr Leu Glu Arg Tyr Arg Thr Cys Asn Ser Asn Ser Gln Glu Ala

65 70 75 80

Thr Pro Pro Leu Glu Asn Glu Ile Asn Tyr Gln Glu Tyr Leu Lys Leu

85 90 95

Lys Thr Arg Val Glu Phe Leu Gln Ser Ser Gln Arg Asn Ile Leu Gly

100 105 110

Glu Asp Leu Gly Pro Leu Ser Met Lys Glu Leu Asp Gln Ile Glu Asn

115 120 125

Gln Ile Asp Ala Ser Leu Lys His Ile Arg Ser Lys Lys Asn Gln Val

130 135 140

Leu Leu Asp Gln Leu Phe Glu Leu Lys Ser Lys Glu Gln Glu Leu Gln

145 150 155 160

Asp Glu Asn Asn Asp Leu Arg Lys Lys Leu Gln Asp Thr Thr Ser Cys

165 170 175

Cys Gly Asp Asn Ala Val His Met Ser Trp Gln Asp Gly Gly Gln Cys

180 185 190

Ser Ser Arg Val Leu His Pro Glu His Asp Thr Ser Met Gln Ile Gly

195 200 205

Tyr Pro Gln Ala Tyr Met Asp Gln Leu Asn Lys Gln Arg Ser Arg Gly

210 215 220

Phe

225

<210> 4

<211> 513

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgggtcggg ggaaggtgga gatgaggcgg atcgagaaca agataagccg gcaggtgacg 60

ttcgccaagc gccggaatgg gctgctcaag aaggcctacg agctctcgct gctctgcgac 120

gccgaggtcg ccctcatcat cttctccggc cgcggccgcc tcttcgagtt ctcaagctcc 180

tcatgcatgt acaaaacact tgagagatac cgtacctgca actccaactc acaagaagca 240

gcacctccgc tagaaaatga agagcaagaa ttgcaggatg aaaacaaaga cttgaggaag 300

aagttgcaag ataccaccag cagctgcgga gagaatgcgg tccatatgtc ctggcaagac 360

ggagggcagt ctagctccag agtactccaa cacccggagc atgatacctc catgcaaatt 420

gggtatcctc aggcctacat ggaccagctg aacagcagag atcacgtggc ttctgaacgc 480

cctggtggag gatcgtctgc agggtggata tga 513

<210> 5

<211> 714

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgggtcggg ggaaggtgga gatgaggcgg atcgagaaca agataagccg gcaggtgacg 60

ttcgccaagc gccggaatgg gctgctcaag aaggcctacg agctctcgct gctctgcgac 120

gccgaggtcg ccctcatcat cttctccggc cgcggccgcc tcttcgagtt ctcaagctcc 180

tcatgcatgt acaaaacact tgagagatac cgtacctgca actccaactc acaggaagca 240

acacctccgc tagaaagtga aattaattac caggaatatt tgaagctcaa gaccagagtt 300

gaatttcttc aaagttcaca aagaaatatt ctcggtgagg atctgggccc acttagcatg 360

aaggagcttg accagataga gaaccaaata gatgcatccc tcaagcatat caggtcaaaa 420

aagaatcagg tactactcga tcagctattt gaactgaaaa gtaaggagca agaattgcag 480

gatgaaaaca atgacttgag gaagaagttg caagatacca ccagctgctg cggagagaat 540

gcggtccata tgtcctggca agacggaggg cagtgtagct ccagagtact acatccggag 600

catgatacct ccatgcaaat tgggtatcct cgggcctaca tggatcagct gaacaacaga 660

gatcacgtgg cttgtgagcg ccctggtgga ggatcgtctg caggttggat atga 714

<210> 6

<211> 678

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgggtcggg ggaaggtgga gatgaggcgg atcgagaaca agataagccg gcaggtgacg 60

ttcgccaagc gccggaatgg gctgctcaag aaggcctacg agctctcgct gctctgcgac 120

gccgaggtcg ccctcatcat cttctccggc cgcggccgcc tcttcgagtt ctcaagctcc 180

tcatgcatgt acagaacact tgagagatac cgtacctgca actccaactc acaggaagca 240

acacctccgc tagaaaatga aattaattac caggaatatt tgaagctcaa gaccagagtt 300

gaatttcttc aaagttcaca aagaaatatt ctcggtgagg atctgggccc acttagcatg 360

aaggagcttg accagataga gaaccaaata gatgcatccc tcaagcatat caggtcaaaa 420

aagaatcaag tattactcga tcagctattt gaactgaaaa gtaaggagca agaattgcag 480

gatgaaaaca atgacttgag gaagaagttg caagatacca ccagttgctg cggagacaat 540

gcggtccata tgtcctggca agacggaggg cagtgtagct ccagagtact acacccggag 600

catgatacct ccatgcaaat tgggtatcct caggcctaca tggaccagct gaacaaacag 660

agatcacgtg gcttctga 678

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gagatgggtc gggggaag 18

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtcaccgaag tacaaataca ttagc 25

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggactagtat gggtcggggg aaggtg 26

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccgagctctc agaagccacg tgatct 26

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tttagccctg ccttcatacg ct 22

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgtataattg cgggactcta atc 23

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcggatccga cggtatcgat ttaaagc 27

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcagaagcca cgtgatctct gtttg 25

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gctgatcgag taatacttga ttcttttt 28

Claims

The WLHS1 protein or the coding gene thereof is applied to the regulation of the development of ears or grains of wheat, the regulation of the development of the ears or grains of wheat is to increase the number of small ears per ear or the number of grains per ear of wheat, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID No. 3.
2. The use as claimed in claim 1, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.
The WLHS1 protein or the coding gene thereof is applied to improving the number of grains per spike of wheat, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID No. 3.
4. The use as claimed in claim 3, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.
The WLHS1 protein or the coding gene thereof is applied to improving the number of spikelets of wheat per spike, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID No. 3.
6. The use as claimed in claim 5, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.
The WLHS1 protein or the coding gene thereof is applied to wheat genetic breeding aiming at improving the number of spikelets per ear or the number of seeds per ear of wheat, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID NO. 3.
8. The use as claimed in claim 7, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.
The WLHS1 protein or the coding gene thereof is applied to the improvement of wheat germplasm resources for improving the number of small ears per ear or the number of seeds per ear of wheat, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID No. 3.
10. The use as claimed in claim 9, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.
The WLHS1 protein or the coding gene thereof is applied to constructing transgenic wheat aiming at improving the number of spikelets per ear or the number of seeds per ear of the wheat, and the amino acid sequence of the WLHS1 protein is shown as SEQ ID NO. 3.
12. The use as claimed in claim 11, wherein the gene encoding WLHS1 protein has the sequence shown in SEQ ID No. 6.