CN110564721B

CN110564721B - Preparation method and application of gene Gal1265

Info

Publication number: CN110564721B
Application number: CN201910850032.3A
Authority: CN
Inventors: 肖安风; 陈培旭; 焦超; 张永辉; 曾洁; 杨秋明; 翁慧芬; 肖琼
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2019-09-10
Filing date: 2019-09-10
Publication date: 2021-07-20
Anticipated expiration: 2039-09-10
Also published as: CN110564721A

Abstract

The invention discloses a preparation method and application of a gene Gal 1265. Inoculating Pseudomonas carrageenovora ASY5 into an artificial seawater culture medium, and extracting strain genome DNA after culture; then, the genomic DNA of the strain is taken as a template, and SEQ ID NO 3 and SEQ ID NO 4 are taken as upstream and downstream primers, and the gene Gal1265 is obtained by amplification. The gene Gal1265 and/or the vector containing the gene Gal1265 has the function of hydrolyzing oligosaccharide in a high-salt state.

Description

Preparation method and application of gene Gal1265

Technical Field

The invention relates to the field of genes, in particular to a preparation method and application of a gene Gal 1265.

Background

Agar consists of D-galactose and 3, 6-anhydro-L-galactose (AHG) connected alternately by β -1-4 and α -1-3 linkages. Agar-derived oligosaccharides are classified as Agar Oligosaccharides (AOS) and neoagar oligosaccharides (NAOS). The non-reducing end of AOS is a galactose unit, while the non-reducing end of NAOS is an AHG unit.

Recently methods have been developed for the combination of enzymatic hydrolysis of agar-agar with weak acid prehydrolysis. The alpha-1-3 glycosidic bond is cleaved by weak acid in advance, and the agar is degraded into even number AOS with galactose as a non-reducing end. AOS is then hydrolyzed to monosaccharides by β -agarase and neoagarobiose hydrolase. In the degradation of agar, the degradation of agar can be divided into a beta-agar degradation pathway (beta-agar pathway) and an alpha-agar degradation pathway (alpha-agar pathway), and both degradation pathways can finally degrade agar into fermentable monosaccharide so as to be utilized by microorganisms. In the beta-agaropectin degradation pathway, agaropectin is degraded into neoagarobiose by beta-agarase, and the neoagarobiose is degraded into D-galactose and 3, 6-diether-alpha-L-galactose which can be utilized by microorganisms under the action of neoagarobiose hydrolase. In the alpha-agaropectin degradation path, agaropectin is degraded into agarobiose under the action of alpha-agarase. Recent studies have found that agarobiose can be further degraded by β -galactosidase to D-galactose and 3, 6-lacto- α -L-galactose, and thus be utilized into relevant metabolic pathways.

Beta-galactosidase (beta-Gal), also known as Lactase (Lactase), hydrolyzes glycosidic bonds to form glucose and galactose. Beta-galactosidase has two functions of catalyzing lactose hydrolysis and transglycosylation, and particularly utilizes the transglycosylation to generate galactooligosaccharide, which has become a hotspot for developing and utilizing functional oligosaccharide. Recent studies have found that β -galactosidase is involved in agar degradation, and β -galactosidase derived from the marine bacteria Vibrio sp. EJY3 and Agarivorans gilvus WH0801 is capable of cleaving the first β -1, 4-glycosidic bond at the non-reducing end of AOSs to produce D-galactose and corresponding NAOSs.

Disclosure of Invention

The invention aims to provide a preparation method and application of a gene Gal 1265.

In order to achieve the above object, the present invention provides a method for producing a gene Gal1265, which is characterized by producing the gene from seawater.

Further, Pseudoalteromonas carrageenovora ASY5 was inoculated into an artificial seawater culture medium, and the strain genomic DNA was extracted after culture; then, the genomic DNA of the strain is taken as a template, and SEQ ID NO 3 and SEQ ID NO 4 are taken as upstream and downstream primers, and the gene Gal1265 is obtained by amplification.

Further, the procedure of the amplification is as follows: 95 ℃ for 5 min; 94 ℃, 15s, 56 ℃, 15s, 72 ℃, 3min, 20s, 30 cycles; 72 ℃ for 10 min.

Further, the preparation method of the artificial seawater culture medium comprises the steps of dissolving beef extract and tryptone in distilled water, adjusting the pH value to 7.8 by using NaOH, heating and boiling for 10min, cooling, adding NaOH again to adjust the pH value to 7.3, mixing with artificial seawater, and sterilizing; wherein the dosage proportions of the beef extract, the tryptone, the distilled water and the artificial seawater are as follows: 10 g: 10 g: 250mL of: 750 mL;

the artificial seawater is NaCl, KCl, CaCl₂、MgCl₂·6H₂O、NaHCO₃、MgSO₄·7H₂O and distilled water, wherein NaCl, KCl and CaCl₂、MgCl₂·6H₂O、NaHCO₃、MgSO₄·7H₂The dosage ratio of O and distilled water is as follows: 37.51 g: 1.03 g: 1.61 g: 6.4 g: 0.15 g: 4.67 g: 1000 mL.

The invention also protects the use of the gene Gal1265 and/or of a vector containing the gene Gal1265 for the hydrolysis of oligosaccharides in the high salt state.

Further, the high salt means that when the concentration of potassium ions is 0-800mM, excluding 0, the gene Gal1265 and/or the vector containing the gene Gal1265 has enzyme activity; or sodium ion in 0-240mM, not including 0, the gene Gal1265 and/or the vector containing the gene Gal1265 has enzyme activity.

Further, the salt in the high salt is Na⁺、K⁺、Ca²⁺、Mg²⁺、Ba²⁺、Cu²⁺、Mn²⁺、Al³⁺And Fe³⁺And (3) salt.

The present invention found a novel gene gal1265 encoding an agaro oligosaccharide hydrolyzing activity in marine bacterium p. pET-28a (+) -gal1265 recombinant plasmid is constructed and transferred into E.coli BL21(DE3) for induction expression, after the induction product is purified by nickel column, the enzymatic property research is carried out, and the hydrolysis activity of the agar oligosaccharide is verified.

The invention obtains the DNA sequence of the gene Gal1265 by designing a specific primer, the coding region of the gene has the length of 3099bp, codes 1032 amino acids, has no signal peptide sequence and has the molecular weight of 117 kDa.

The DNA sequence is shown as SEQ ID NO: 1, and the following components:

ATGAACTCACTACAGCACATAATTAATCGCCGCGATTGGGAAAACCCAATTTCGGTGCAAGTTAATCAAGTAAAAGCGCACAGCCCACTTAATGGTTTTAAAAGCGTTGACCATGCCCGTACAAACACGCAATCACAAAAACAAAGTTTAAACGGCCAGTGGGATTTTAAATTATTTGATAAGCCCGAAGCGGTTGATGAGTCATTACTAAGTGAGGCACTCGCCAGCGACTGGCAAAGTATTCCTGTGCCTTCTAACTGGCAATTACACGGCTTTGATAAACCTATTTATTGTAATGTTAAATATCCCTTTGCCGTAAACCCGCCATTTGTACCAAGCGATAACCCAACAGGTTGCTACCGCACAGAGTTTACTATTCCGGCGGAGCAATTAGCTCAGCGAAACCATATTATTTTTGAAGGCGTAAACTCGGCGTTTCACCTTTGGTGTAACGGTCAATGGGTGGGCTACTCGCAGGATAGCCGCTTACCAAGCGAATTTGATTTAAGCAAACTGTTAGTGGCTGGCACCAACCGCATTGCGGTTATGGTTATTCGCTGGAGCGATGGCAGTTACTTAGAAGATCAAGACATGTGGTGGCTAAGCGGTATATTCCGCGATGTTAATTTACTTACTAAACCGCAACACCAAATACGCGATGTATTTATAACCCCAGATTTAGACGCCTGCTACCGCGATGCGACTTTGCATATAAAAACCGCAATTGATGCGCCAAATAACTACCAAGTAGCAGTACAGGTTTTTGATGGTGAACTGGCACTGTGTGAGCCACAAATACAAAGCACTAACAATAAACGCGTTGATGAAAAAGGCGGCTGGAGCGATGTGGTTTTTCAAACAATTGATATACAAAACCCTAAAAAATGGACCGCCGAAACCCCAACCTTATACCGCTGTGTTGTAAGCCTGTTAGATGAGCAAGGCATTACAGTAGACGTAGAAGCCTACAACATTGGCTTTAGAAAAGTAGAAATGCTCAACGGGCAGCTTTGCTTAAACGGCAAACCGCTGCTTATTCGCGGTGTTAACCGCCACGAGCATCACCCAGAAAACGGCCATACAGTGAGCACTGCCGACATGATTGAAGATATTAAGCTGATGAAGCAAAATAACTTTAATGCTGTACGTACCGCTCACTACCCTAACCACCCTCGTTTTTACGAGCTGTGTGACGAGTTAGGTTTATACGTAGTAGACGAAGCCAATATAGAAACTCACGGCATGTTCCCAATGGGTAGGCTTGCAAGCGATCCGCAGTGGACTGGCGCATTTATGTCGCGTTATACACAAATGCTTGAGCGCGATAAAAACCACGCCTCTATTATTATTTGGTCACTAGGTAATGAGTGCGGGCACGGTGCAAACCACGATGCTATGTACGGCTGGTCAAAAAGCTTTGACCCATCGCGCCCAGTGCAATACGAAGGTGGCGGCGCAAATACCACCGCAACCGATATTATTTGCCCTATGTACGCCCGTGTAGATACCCATATTGCCGACGACGCCGTACCTAAATACTCTATTAAAAAGTGGTTAAGCCTACCGGGTGAAACGCGTCCGCTTATTTTATGTGAATACGCCCATGCTATGGGTAACAGCCTAGGTAGCTTTGATGATTACTGGCAAGCATTTAGAGAATACCCGCGTTTGCAAGGTGGCTTTATTTGGGATTGGGTAGACCAAGGTTTATCTAAAACTGATGAAAACGGTAAGCATTATTGGGCTTACGGTGGCGATTTTGGTGATGAACTAAACGACCGTCAATTCTGTATTAACGGCTTATTATTTCCAGATCGCACGCCGCATCCTAGCTTGTTTGAAGCTAAATACAGCCAACAGCATTTACAATTTACGCTGCGTGAGCAAACTCAAAACCACTATACCGTTGATGTATTTAGTGATTATGTATTTAGGGCAACTGATAACGAAAAATTGGTTTGGCAGTTAATAGAAAATGGCCAATGTATAGAGCAAGGCGAGCAAATTATTAGTATTGCTCCGCAAAGTATGAAAACGCTGACTGTTAATACAAAAACGGTGTTTAAAGCCGGTGCGCAATATCACCTTAATTTAGATGTAGCACTGATTAACGACTCAAGCTTTGCAAGTGCCGAGCATGTATTAAACACCGAGCAATTTAAGCTTATAAATAGCCAAAGTTTAAGCACTGATACATTTTCGCCTGCTTTAGCAAACGCCTCAACGCACGGCGCACTAAATATTAGCGAAACCAACACACAGCTAAATATTGAAGGCGATAGCTTTAAACTTGTGTTTAATAGCCAATCAGGCCTTATTGAGCAATGGCTGCACAATCAAACCCAAGTTATTAAAAGCCCATTGGTTGATAATTTTTACCGCGCCCCGCTTGATAACGACATAGGCGTAAGCGAAGTAGACAACCTAGACCCTAACGCATGGGAAGCGCGCTGGTTAAGAGCAGGTATTGGGCAGTGGCAGCGTACATGTCGCTCGTTTGAAGTAGTGCAATCAAAGATAGATATACGTATTACCTGTGTATTTAGTTATGAATTTAATGGCGCAGTACAAGCAAAAACAACTTGGCTTTATACACTTAATAATACCGGTGAAATTAGCTTAAATGTTGATGTACAACTAAACGACACTTTGCCACCCATGCCACGCATAGGGTTAAGCACAACGCTTAATAAACAAAGCGATACACAAGTAAACTGGGTTGGTTTAGGGCCATTTGAAAACTACCCAGATCGCAAAGCGGCTGCGCGTTTAGGTTATTACAGCGCGCAACATAATGAGCTACATACACCGTATATATTCCCAACCGATAACGGCGTGCGTAGTGATTGCCAATTACTTAGCGTTAATAATTTAACCGTAACCGGTACATTTTTATTTGCCGCCAGTGAATACTCTCAAAGCATGCTTACGCAAGCAAAGCACACCAATGAGCTAGTAGCTGATGATTGCTTACATGTACATATTGATCATCAACATATGGGGGTTGGCGGCGATGATTCGTGGAGCCCAAGTACCCATAAAGAGTATTTACTAGAGCAAACGCAGTACAACTACTCTTTAACTTTTTCGGCTAAATAA。

the amino acid sequence is shown as SEQ ID NO: 2, as shown in the figure:

MNSLQHIINRRDWENPISVQVNQVKAHSPLNGFKSVDHARTNTQSQKQSLNGQWDFKLFDKPEAVDESLLSEALASDWQSIPVPSNWQLHGFDKPIYCNVKYPFAVNPPFVPSDNPTGCYRTEFTIPAEQLAQRNHIIFEGVNSAFHLWCNGQWVGYSQDSRLPSEFDLSKLLVAGTNRIAVMVIRWSDGSYLEDQDMWWLSGIFRDVNLLTKPQHQIRDVFITPDLDACYRDATLHIKTAIDAPNNYQVAVQVFDGELALCEPQIQSTNNKRVDEKGGWSDVVFQTIDIQNPKKWTAETPTLYRCVVSLLDEQGITVDVEAYNIGFRKVEMLNGQLCLNGKPLLIRGVNRHEHHPENGHTVSTADMIEDIKLMKQNNFNAVRTAHYPNHPRFYELCDELGLYVVDEANIETHGMFPMGRLASDPQWTGAFMSRYTQMLERDKNHASIIIWSLGNECGHGANHDAMYGWSKSFDPSRPVQYEGGGANTTATDIICPMYARVDTHIADDAVPKYSIKKWLSLPGETRPLILCEYAHAMGNSLGSFDDYWQAFREYPRLQGGFIWDWVDQGLSKTDENGKHYWAYGGDFGDELNDRQFCINGLLFPDRTPHPSLFEAKYSQQHLQFTLREQTQNHYTVDVFSDYVFRATDNEKLVWQLIENGQCIEQGEQIISIAPQSMKTLTVNTKTVFKAGAQYHLNLDVALINDSSFASAEHVLNTEQFKLINSQSLSTDTFSPALANASTHGALNISETNTQLNIEGDSFKLVFNSQSGLIEQWLHNQTQVIKSPLVDNFYRAPLDNDIGVSEVDNLDPNAWEARWLRAGIGQWQRTCRSFEVVQSKIDIRITCVFSYEFNGAVQAKTTWLYTLNNTGEISLNVDVQLNDTLPPMPRIGLSTTLNKQSDTQVNWVGLGPFENYPDRKAAARLGYYSAQHNELHTPYIFPTDNGVRSDCQLLSVNNLTVTGTFLFAASEYSQSMLTQAKHTNELVADDCLHVHIDHQHMGVGGDDSWSPSTHKEYLLEQTQYNYSLTFSAK。

drawings

FIG. 1 shows the results of PCR amplification electrophoresis of gene Gal 1265. Wherein M: DL5000 marker, 1: the product was amplified in a gradient.

FIG. 2 is a map of the expression vector pET-28a (+) dicase. Wherein M: DL5000 marker, 1: a circular plasmid; 2: the plasmid was linearized.

FIG. 3 is a diagram showing the result of PCR electrophoresis of recombinant plasmid colonies. M: DL5000 marker, 1-5: a recombinant plasmid.

FIG. 4 is a diagram of SDS-polyacrylamide gel electrophoresis analysis of the recombinant purified gene Gal 1265. M: protein marker 1-2: and (5) purifying the protein.

FIG. 5 is a graph showing the effect of temperature on the recombinant gene Gal 1265. a: the optimal temperature of the recombinant gene Gal 1265; b: the heat inactivation curve of the recombinant gene Gal 126525 ℃; c: the heat inactivation curve of the recombinant gene Gal 126530 ℃; d: recombinant gene Gal126535 ℃ heat inactivation curve.

FIG. 6 is a graph showing the effect of pH on the recombinant gene Gal 1265. a: the optimum pH of the gene Gal 1265; b: gene Gal1265pH stability.

FIG. 7 is a graph showing the effect of metal ions on the recombinant gene Gal 1265.

FIG. 8 is a graph showing the effect of NaCl and KCl on the recombinant gene Gal 1265.

FIG. 9 is a graph showing the effect of inhibitors and surfactants on the recombinant gene Gal 1265.

FIG. 10 is a view of TLC analysis of the reaction product of AOSs and NAOSs hydrolyzed by recombinant gene Gal 1265. a, 1: D-galactose; 2: qiongtriose; 3: gelatinose is obtained after enzymolysis; 4: agar-agar pentasaccharide; 5: after enzymolysis, agaropentaose is obtained; 6: agar-agar sugar; 7: after enzymolysis, the agar is agar. b, 1: D-galactose; 2: neoagarobiose; 3: carrying out enzymolysis on the neoagarobiose; 4: neoagarotetraose; 5: carrying out enzymolysis on the neoagarotetraose; 6: neoagarohexaose; 7: and (4) hydrolyzing the neoagarohexaose by enzymolysis.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

The source of the biological material is as follows: pseudomonas carrageenonovora ASY5, the Chinese name of which is Pseudoalteromonas cervicalis, is separated from mansion mangrove soil leaf mold sample and is derived from China center for culture Collection of Industrial microorganisms and strains (CICC) with the preservation number of 23819.

Example 1: gene Gal1265 for hydrolyzing agar oligosaccharide

Inoculating Pseudomonas carrageenovora ASY5 into artificial seawater culture medium, and shake culturing at 25 deg.C and 180r/min to OD₆₀₀1-1.5, taking 1mL of culture solution, and extracting genomic DNA of Pseudomonas carrageenovora ASY5 strain by using a rapid extraction kit (silica gel membrane centrifugation column method) for bacterial genomes of Donghai organisms. The method for configuring the artificial seawater culture medium comprises the following steps:

artificial seawater culture medium: 10g of beef extract, 10g of tryptone, 250mL of distilled water and 750mL of artificial seawater (NaCl37.51g, 1.03g of KCl, 21.61g of CaCl21, 2 & 6H2O 6.4.4 g of MgCl, 30.15g of NaHCO, 4 & 7H2O 4.67.67 g and 1000mL of distilled water). Dissolving beef extract and tryptone in distilled water, adjusting pH to 7.8 with NaOH, heating and boiling for 10min, cooling, adjusting pH to 7.3 with NaOH, mixing with artificial seawater, and sterilizing at 121 deg.C for 20 min. The solid medium was supplemented with 20g of agar.

Example 2: sequence analysis and primer design

Analyzing the gal1265 gene sequence by using SignalP 4.1Server to obtain the signal peptide position, and removing the signal peptide in the subsequent construction of recombinant plasmid and expression. And analyzing the gene sequence by using DNAMAN software to obtain a proper enzyme cutting site. Primers were designed as in table 1.

The gal1265-F sequence is as follows:

5′-CGCGGATCCAACTCACTACAGCACATAATTAATC-3′SEQ ID NO:3,

the gal1265-R sequence is as follows:

5′-CCGCTCGAGTTTAGCCGAAAAAGTTAAAGAGTAG-3′EQ ID NO:4。

the BamHI and XhoI sites are underlined, respectively.

Example 3: recombinant expression and purification of Gene Glu525 in the Strain of Escherichia coli BL21(DE3)

PCR amplification of β -galactosidase gene: PCR amplification was performed using the ASY5 strain genomic DNA obtained in example 1 as a template.

The PCR reaction system is as follows: 5 XPrimeSTAR buffer 10 uL, 10 mmol/L4 uL of 4 dNTPs mixed solution, gene specific upstream Primer (i.e. gal1265-F)1 uL, gene specific downstream Primer (i.e. gal1265-R)1 uL, Primer STAR enzyme 0.5 uL, genome template 1 uL (<200ng), sterile water is added to make up to 50 uL.

The PCR amplification procedure was: pre-denaturation (95 ℃, 5 min); denaturation (94 ℃, 15s), annealing (56 ℃, 15s), and extension (72 ℃, 3min20 s) for 30 cycles; final extension (72 ℃ C., 10 min). The size of the obtained PCR amplification product is detected by agarose gel electrophoresis. The DNA purification kit is used for recovering the target gene fragment, and the target gene fragment is stored at the temperature of minus 20 ℃ after agarose gel electrophoresis detection, and the result is shown in figure 1. Wherein lane M is DL5000 marker and lane 1 is PCR amplification product. As can be seen from FIG. 1, the PCR amplification product shows a specific band around 3000bp, which corresponds to the theoretical size of the target band.

And (3) recovering PCR amplification products: the PCR product was purified according to the DNA gel recovery kit instructions of Guangdong Sheng Biotech Co., Ltd, the concentration of the recovered product was determined, and the product was stored at-20 ℃ for future use.

Double enzyme digestion of target gene and vector: the purified target gene and the pET-28a vector are diluted to be consistent in concentration by using sterile ultrapure water, the components in the table 1 are added into a PCR tube, the mixture is mixed evenly and centrifuged for a short time, and the liquid is concentrated at the bottom of the tube. The enzyme was cleaved at 37 ℃ for 12 h. The enzyme digestion product is purified and recovered by a gel recovery and purification kit, the product is stored at the temperature of minus 20 ℃ for later use, and the enzyme digestion electrophoresis result is shown in figure 2. Wherein lane M is DL5000 marker, lane 1 is a circular plasmid; lane 2 is linearized plasmid. As can be seen from the figure, the mobility of lane 1 is greater than that of lane 2, which proves that the enzyme digestion is successful, and the enzyme digestion product can be used for subsequent connection.

TABLE 1 double digestion reaction system Table

And (3) connecting the target gene with the vector: the ingredients in Table 2 were added to a 0.5mL centrifuge tube, mixed well and centrifuged briefly to collect the liquid at the bottom of the tube and connected for 16h at 16 ℃.

TABLE 2 connection reaction systems

Transformation into a cloned host and screening:

(1) coli DH5 α competent cells were transformed with the instructions.

(2) Single colonies of positive transformants were picked up on fresh liquid LB medium (containing 50. mu.g/mL Kana), cultured overnight at 37 ℃ and verified by colony PCR, the colony PCR system and procedure are shown in tables 3 and 4.

(3) And detecting colony PCR amplification products by agarose gel electrophoresis.

(4) For further validation, positive transformants that were validated correctly were sent to platforming biotechnology (shanghai) ltd for sequencing.

(5) Sequencing transformants meeting the requirements to prepare glycerol tube stock.

TABLE 3 colony PCR reaction System Table

Note: the upstream primer is gal1265-F, and the downstream primer is gal 1265-R.

TABLE 4PCR reaction schedule

Note: 30 cycles.

Extraction of recombinant plasmid: the screened positive transformants are transferred to a liquid LB culture medium (containing 50. mu.g/mL Kana) and cultured overnight at 37 ℃, and then the recombinant plasmid pET-28a-gal1265 is obtained by the operation according to the procedures of the specification of a plasmid extraction kit of the company Limited in Biotechnology engineering (Shanghai), wherein the result is shown in FIG. 3, wherein a Lane M is DL5000 marker, and lanes 1-5 are recombinant plasmids. As can be seen from FIG. 3, all of the clones 1 to 5 were positive clones, and sequencing was performed by trusting Botanshang Biotechnology (Shanghai) Co., Ltd. on the recombinant plasmid from which the positive clones were extracted, and the sequencing results showed that the target fragment was correctly inserted into the vector, indicating that the expression vector pET-28a-gal1265 was successfully constructed.

Transformation into expression hosts and screening: the transformation and screening methods were as above. Validation of correct e.coli BL21(DE3) transformants glycerol tube stocks were made for subsequent recombinant protein expression.

Inducible expression of the recombinant gene Gal 1265: the positive transformants were transferred to 200mL LB liquid medium (containing Kana 50. mu.g/mL) and cultured at 37 ℃ to OD₆₀₀The value is 0.5-0.6. IPTG was added to a final concentration of 0.5mmol/L and expression was induced at 16 ℃ for 20h for subsequent affinity chromatography purification.

Purification of the recombinant gene Gal 1265: freezing and centrifuging the bacteria liquid induced to express at 6500rpm and 4 ℃ for 20min, discarding the supernatant, and collecting the thallus precipitate. The protein of interest was purified with reference to the Ni-NTA Sepharose protocol from GE Healthcare. An appropriate amount of sample was taken and examined by SDS-PAGE, and the results are shown in FIG. 4. Wherein lane M is protein marker and lanes 1-2 are purified proteins. The results show that a single band of recombinant protein (lanes 1, 2) was obtained after purification, with a molecular weight of approximately 117kDa, corresponding to the theoretical molecular weight.

Example 4: analysis of enzymatic Properties of recombinant Gene Gal1265

Determination of the activity of the recombinant enzyme: adding 190 μ L10 mM ONPG (dissolved in 50mM Tris-HCl, pH 7.0) into 1.5mL centrifuge tube, keeping the temperature for 5min, adding 10 μ L enzyme solution, reacting for 10min, adding 200 μ L1 mol/L Na₂CO₃The reaction was terminated and the absorbance at 420nm was measured. Definition of enzyme activity: the amount of enzyme required to produce 1. mu. mol ONP per minute was one unit of enzyme activity (U/mL).

Effect of temperature on enzyme activity and stability: the optimal reaction temperature determination of the recombinant gene Gal1265 takes 10mM ONPG as a substrate, the activity of a recombinase is studied at the temperature of 5-60 ℃, and the highest enzyme activity is defined as 100%; the thermal stability of the recombinant enzyme was investigated by detecting the residual enzyme activity of the recombinant gene Gal1265 after treatment at 25 deg.C, 30 deg.C and 35 deg.C for various times. The enzyme activity without heat treatment was defined as 100%. The results are shown in FIG. 5, where a is the optimum temperature for the recombinant gene Gal 1265; b is a heat inactivation curve of the recombinant gene Gal 126525 ℃; c is a heat inactivation curve of the recombinant gene Gal 126530 ℃; d is a heat inactivation curve of the recombinant gene Gal126535 ℃. As shown in a of FIG. 5, the recombinant gene Gal1265 was active at 5 ℃ to 55 ℃ and the optimum reaction temperature was 30 ℃. When the temperature is higher than 30 ℃, the enzyme activity is obviously reduced, the enzyme activity can reach more than 40 percent of the maximum activity within the range of 15-30 ℃, the activity is still close to 20 percent at 5 ℃, and Gal1265 has the characteristic of low-temperature enzyme; in the b of figure 5, the recombinant beta-galactosidase is kept at 25 ℃ for 3.5h, the enzyme activity is basically unchanged, the enzyme activity is slowly reduced after 3.5h, and the enzyme activity can still be kept above 65% after 7 h; in the step c of fig. 5, under the condition of 30 ℃, the enzyme activity is lost by about 30 percent in the first 20min, and then the temperature is kept for 1h, so that the enzyme activity can be kept more than 50 percent; in fig. 5 d, the enzyme activity is lost by about 60% in the first 5min and almost completely after 30min at 35 ℃.

Effect of pH on enzyme activity and stability: when the optimum pH is determined, buffer solutions with different pH values are used for preparing 0.5% (w/v) sodium alginate, and the enzyme activity is determined at the optimum reaction temperature, wherein the highest enzyme activity is 100%. The buffers were 50mM acetic acid-sodium acetate (pH 4-6), sodium dihydrogen phosphate-disodium hydrogen phosphate (pH 6-8), Tris-HCl (pH 8-9), and glycine-NaOH (pH 9-10), respectively. The pH stability was studied by measuring the residual enzyme activity of the enzyme solution after 24h at 4 ℃ without pH, taking the untreated enzyme activity as 100%. The results are shown in FIG. 6, where a is the optimum pH of the gene Gal 1265; b is the stability of the gene Gal1265 pH. The result is shown in a in figure 6, the recombinant gene Gal1265 has the highest enzyme activity in a Gly-NaOH buffer system, the optimum reaction pH is 8.5, and the enzyme activity with the highest enzyme activity of more than 80 percent is within the range of pH 8.0-9.0; in the b of figure 6, the recombinant beta-galactosidase is relatively stable in the range from acidity to alkalescence (pH 5.0-9.0), can still keep more than 60% of enzyme activity after being treated for 24h at 4 ℃, and completely loses activity under the condition that the pH is higher than 9. The results show that the recombinant beta-galactosidase has a wider pH adaptation range.

Influence of metal ions on the enzyme activity of the recombinant gene Gal 1265: by measuring the presence of different metal ions (Na) in the enzyme solution at 4 deg.C⁺、K⁺、Ca²⁺、Mg²⁺、Ba²⁺、Cu²⁺、Mn²⁺、Cd²⁺、Al³⁺And Fe³⁺1mM or 10mM) for 1 hour, to study the effect of metal ions on the enzyme activity, taking the enzyme activity without being treated by metal ions as 100%. The results are shown in FIG. 7, and FIG. 7 is a graph showing the effect of the metal ion on the recombinant gene Gal 1265. It can be seen that: k +, Na +, Mg2+ and Mn2+ can obviously promote enzyme activity, wherein 1mM Mn2+ has the strongest promotion effect, so that the enzyme activity is improved by 49.46%, Cd + and 10mM Cu2+ and Zn2+ can almost completely inhibit the enzyme activity, and 1mM Ba²⁺、Fe³⁺And Al³⁺Has slight promotion effect on enzyme activity, 10mM of Ba²⁺、Fe³⁺And Al³⁺The enzyme activity is inhibited. The results are shown in FIG. 8, where FIG. 8 shows NaCl and KCl on the recombinant basisGraph of effect due to Gal 1265. It can be seen that: gal1265 has stronger tolerance to K +, still has promotion effect on enzyme activity by adding 800mM K +, has strongest promotion effect on enzyme activity by 40mM K +, and is improved by 159.59%. Na + has the tendency of promoting Gal1265 at low concentration and inhibiting Gal at high concentration, the promoting effect is strongest when 160mM Na + is added, the enzyme activity is improved by 45.30%, and when the Na + concentration is higher than 240mM, the inhibiting effect is started to be shown, but the activity can still be maintained by more than 70%.

Effect of inhibitors and surfactants on the viability of the recombinant gene Gal 1265: adding 1mM or 10mM inhibitor (EDTA, CTAB, Urea) and 1% (w/w or w/v) or 10% (w/w or w/v) surfactant (SDS, Tween-20, Tween-80, Triton X-100) into the enzyme solution respectively at final concentration, treating at 4 ℃ for 1h, measuring the residual activity of the enzyme, and studying the influence of the inhibitor and the detergent on the enzyme activity by taking the enzyme activity without the addition of the inhibitor or the detergent as 100%. The results are shown in fig. 9, and fig. 9 is a graph showing the effect of the inhibitor and the surfactant on the recombinant gene Gal 1265. It can be seen that: gal1265 has good resistance to Triton X-100, Tween-20 and Tween-80 in a surfactant, low-concentration SDS can slightly promote enzyme activity, CTAB has strong inhibition effect on Gal1265, when the concentration is 1%, Gal1265 is basically inactivated, inhibitor EDTA has strong inhibition effect on Gal1265, 1mM EDTA can almost completely inhibit the enzyme activity, and urea can slightly promote the enzyme activity.

Example 5: hydrolysis of agar oligosaccharide with Gene Gal1265

Determination of Gal1265 on hydrolysis activity of agar oligosaccharide: the reaction system comprises 100 mu L of oligosaccharide solution with the concentration of 2mg/mL, 100 mu L of purified enzyme solution is added, and samples are taken for TLC after reaction at 30 ℃ for 24 h.

A5 mg/mL sodium alginate solution was prepared with 50mM Tris-HCl buffer (pH 8.0). Taking 50mL of the solution, adding 5mL of enzyme solution, reacting at 55 ℃, supplementing 5mL of enzyme solution every hour, and measuring the content of reducing sugar in the system. When the reducing sugar content is stable, inactivating in boiling water bath for 10min, 10,000r/min, centrifuging at 4 deg.C for 20min, and collecting supernatant. Adding 3 times of anhydrous ethanol, standing for 2h at 4 ℃, centrifuging to obtain a supernatant, performing rotary evaporation and concentration on the supernatant, and performing freeze-drying to obtain the new agaro-oligosaccharide degraded by the recombinant gene Gal 1265. The components of enzymatically degraded agar oligosaccharides were analyzed by TLC technique. The developing solvent is n-butyl alcohol: glacial acetic acid: water 2: 1: 1 (v/v/v). The developer was a 10% concentrated sulfuric acid in ethanol (0.5 g thymol per 100mL developer). The results are shown in FIG. 10, and FIG. 10 is a view showing TLC analysis of the reaction product of AOSs and NAOSs hydrolyzed by the recombinant gene Gal 1265. In a, 1 is D-galactose; 2 is Qiongtriose; 3 is agarotriose after enzymolysis; 4 is Qiongwutang; 5 is agaropentaose after enzymolysis; 6 is Qiqiong sugar; 7 is the agaroheptase after enzymolysis. In B, 1 is D-galactose; 2 is neoagarobiose; 3, hydrolyzing with neoagarobiose; 4 is neoagarotetraose; 5, hydrolyzing the neoagarotetraose; 6 is neoagarohexaose; 7 is the neoagarohexaose after enzymolysis. It can be seen that: gal1265 acts on AOSs (such as setron trisaccharide, setron pentasaccharide and setron heptasaccharide) whose non-reducing end is D-Gal, but does not act on NAOSs (such as neosetron disaccharide, neosetron tetrasaccharide and neosetron hexasaccharide) whose non-reducing end is AHG. After 24h of reaction, neoagarobiose, neoagarotetraose and neoagarohexaose were unchanged. Qiongtriose, Qiongpentaose and Qiongheptaose are substantially converted to D-Gal and another smaller molecular sugar.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.

SEQUENCE LISTING

<110> college university

<120> preparation method and application of gene Gal1265

<130> JMDXL-19038-CNI

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 3099

<212> DNA

<213> Pseudoalteromonas carrageenovora ASY5

<400> 1

atgaactcac tacagcacat aattaatcgc cgcgattggg aaaacccaat ttcggtgcaa 60

gttaatcaag taaaagcgca cagcccactt aatggtttta aaagcgttga ccatgcccgt 120

acaaacacgc aatcacaaaa acaaagttta aacggccagt gggattttaa attatttgat 180

aagcccgaag cggttgatga gtcattacta agtgaggcac tcgccagcga ctggcaaagt 240

attcctgtgc cttctaactg gcaattacac ggctttgata aacctattta ttgtaatgtt 300

aaatatccct ttgccgtaaa cccgccattt gtaccaagcg ataacccaac aggttgctac 360

cgcacagagt ttactattcc ggcggagcaa ttagctcagc gaaaccatat tatttttgaa 420

ggcgtaaact cggcgtttca cctttggtgt aacggtcaat gggtgggcta ctcgcaggat 480

agccgcttac caagcgaatt tgatttaagc aaactgttag tggctggcac caaccgcatt 540

gcggttatgg ttattcgctg gagcgatggc agttacttag aagatcaaga catgtggtgg 600

ctaagcggta tattccgcga tgttaattta cttactaaac cgcaacacca aatacgcgat 660

gtatttataa ccccagattt agacgcctgc taccgcgatg cgactttgca tataaaaacc 720

gcaattgatg cgccaaataa ctaccaagta gcagtacagg tttttgatgg tgaactggca 780

ctgtgtgagc cacaaataca aagcactaac aataaacgcg ttgatgaaaa aggcggctgg 840

agcgatgtgg tttttcaaac aattgatata caaaacccta aaaaatggac cgccgaaacc 900

ccaaccttat accgctgtgt tgtaagcctg ttagatgagc aaggcattac agtagacgta 960

gaagcctaca acattggctt tagaaaagta gaaatgctca acgggcagct ttgcttaaac 1020

ggcaaaccgc tgcttattcg cggtgttaac cgccacgagc atcacccaga aaacggccat 1080

acagtgagca ctgccgacat gattgaagat attaagctga tgaagcaaaa taactttaat 1140

gctgtacgta ccgctcacta ccctaaccac cctcgttttt acgagctgtg tgacgagtta 1200

ggtttatacg tagtagacga agccaatata gaaactcacg gcatgttccc aatgggtagg 1260

cttgcaagcg atccgcagtg gactggcgca tttatgtcgc gttatacaca aatgcttgag 1320

cgcgataaaa accacgcctc tattattatt tggtcactag gtaatgagtg cgggcacggt 1380

gcaaaccacg atgctatgta cggctggtca aaaagctttg acccatcgcg cccagtgcaa 1440

tacgaaggtg gcggcgcaaa taccaccgca accgatatta tttgccctat gtacgcccgt 1500

gtagataccc atattgccga cgacgccgta cctaaatact ctattaaaaa gtggttaagc 1560

ctaccgggtg aaacgcgtcc gcttatttta tgtgaatacg cccatgctat gggtaacagc 1620

ctaggtagct ttgatgatta ctggcaagca tttagagaat acccgcgttt gcaaggtggc 1680

tttatttggg attgggtaga ccaaggttta tctaaaactg atgaaaacgg taagcattat 1740

tgggcttacg gtggcgattt tggtgatgaa ctaaacgacc gtcaattctg tattaacggc 1800

ttattatttc cagatcgcac gccgcatcct agcttgtttg aagctaaata cagccaacag 1860

catttacaat ttacgctgcg tgagcaaact caaaaccact ataccgttga tgtatttagt 1920

gattatgtat ttagggcaac tgataacgaa aaattggttt ggcagttaat agaaaatggc 1980

caatgtatag agcaaggcga gcaaattatt agtattgctc cgcaaagtat gaaaacgctg 2040

actgttaata caaaaacggt gtttaaagcc ggtgcgcaat atcaccttaa tttagatgta 2100

gcactgatta acgactcaag ctttgcaagt gccgagcatg tattaaacac cgagcaattt 2160

aagcttataa atagccaaag tttaagcact gatacatttt cgcctgcttt agcaaacgcc 2220

tcaacgcacg gcgcactaaa tattagcgaa accaacacac agctaaatat tgaaggcgat 2280

agctttaaac ttgtgtttaa tagccaatca ggccttattg agcaatggct gcacaatcaa 2340

acccaagtta ttaaaagccc attggttgat aatttttacc gcgccccgct tgataacgac 2400

ataggcgtaa gcgaagtaga caacctagac cctaacgcat gggaagcgcg ctggttaaga 2460

gcaggtattg ggcagtggca gcgtacatgt cgctcgtttg aagtagtgca atcaaagata 2520

gatatacgta ttacctgtgt atttagttat gaatttaatg gcgcagtaca agcaaaaaca 2580

acttggcttt atacacttaa taataccggt gaaattagct taaatgttga tgtacaacta 2640

aacgacactt tgccacccat gccacgcata gggttaagca caacgcttaa taaacaaagc 2700

gatacacaag taaactgggt tggtttaggg ccatttgaaa actacccaga tcgcaaagcg 2760

gctgcgcgtt taggttatta cagcgcgcaa cataatgagc tacatacacc gtatatattc 2820

ccaaccgata acggcgtgcg tagtgattgc caattactta gcgttaataa tttaaccgta 2880

accggtacat ttttatttgc cgccagtgaa tactctcaaa gcatgcttac gcaagcaaag 2940

cacaccaatg agctagtagc tgatgattgc ttacatgtac atattgatca tcaacatatg 3000

ggggttggcg gcgatgattc gtggagccca agtacccata aagagtattt actagagcaa 3060

acgcagtaca actactcttt aactttttcg gctaaataa 3099

<210> 2

<211> 1032

<212> PRT

<213> Pseudoalteromonas carrageenovora ASY5

<400> 2

Met Asn Ser Leu Gln His Ile Ile Asn Arg Arg Asp Trp Glu Asn Pro

Ile Ser Val Gln Val Asn Gln Val Lys Ala His Ser Pro Leu Asn Gly

Phe Lys Ser Val Asp His Ala Arg Thr Asn Thr Gln Ser Gln Lys Gln

Ser Leu Asn Gly Gln Trp Asp Phe Lys Leu Phe Asp Lys Pro Glu Ala

Val Asp Glu Ser Leu Leu Ser Glu Ala Leu Ala Ser Asp Trp Gln Ser

Ile Pro Val Pro Ser Asn Trp Gln Leu His Gly Phe Asp Lys Pro Ile

Tyr Cys Asn Val Lys Tyr Pro Phe Ala Val Asn Pro Pro Phe Val Pro

Ser Asp Asn Pro Thr Gly Cys Tyr Arg Thr Glu Phe Thr Ile Pro Ala

Glu Gln Leu Ala Gln Arg Asn His Ile Ile Phe Glu Gly Val Asn Ser

Ala Phe His Leu Trp Cys Asn Gly Gln Trp Val Gly Tyr Ser Gln Asp

Ser Arg Leu Pro Ser Glu Phe Asp Leu Ser Lys Leu Leu Val Ala Gly

Thr Asn Arg Ile Ala Val Met Val Ile Arg Trp Ser Asp Gly Ser Tyr

Leu Glu Asp Gln Asp Met Trp Trp Leu Ser Gly Ile Phe Arg Asp Val

Asn Leu Leu Thr Lys Pro Gln His Gln Ile Arg Asp Val Phe Ile Thr

Pro Asp Leu Asp Ala Cys Tyr Arg Asp Ala Thr Leu His Ile Lys Thr

Ala Ile Asp Ala Pro Asn Asn Tyr Gln Val Ala Val Gln Val Phe Asp

Gly Glu Leu Ala Leu Cys Glu Pro Gln Ile Gln Ser Thr Asn Asn Lys

Arg Val Asp Glu Lys Gly Gly Trp Ser Asp Val Val Phe Gln Thr Ile

Asp Ile Gln Asn Pro Lys Lys Trp Thr Ala Glu Thr Pro Thr Leu Tyr

Arg Cys Val Val Ser Leu Leu Asp Glu Gln Gly Ile Thr Val Asp Val

Glu Ala Tyr Asn Ile Gly Phe Arg Lys Val Glu Met Leu Asn Gly Gln

Leu Cys Leu Asn Gly Lys Pro Leu Leu Ile Arg Gly Val Asn Arg His

Glu His His Pro Glu Asn Gly His Thr Val Ser Thr Ala Asp Met Ile

Glu Asp Ile Lys Leu Met Lys Gln Asn Asn Phe Asn Ala Val Arg Thr

Ala His Tyr Pro Asn His Pro Arg Phe Tyr Glu Leu Cys Asp Glu Leu

Gly Leu Tyr Val Val Asp Glu Ala Asn Ile Glu Thr His Gly Met Phe

Pro Met Gly Arg Leu Ala Ser Asp Pro Gln Trp Thr Gly Ala Phe Met

Ser Arg Tyr Thr Gln Met Leu Glu Arg Asp Lys Asn His Ala Ser Ile

Ile Ile Trp Ser Leu Gly Asn Glu Cys Gly His Gly Ala Asn His Asp

Ala Met Tyr Gly Trp Ser Lys Ser Phe Asp Pro Ser Arg Pro Val Gln

Tyr Glu Gly Gly Gly Ala Asn Thr Thr Ala Thr Asp Ile Ile Cys Pro

Met Tyr Ala Arg Val Asp Thr His Ile Ala Asp Asp Ala Val Pro Lys

Tyr Ser Ile Lys Lys Trp Leu Ser Leu Pro Gly Glu Thr Arg Pro Leu

Ile Leu Cys Glu Tyr Ala His Ala Met Gly Asn Ser Leu Gly Ser Phe

Asp Asp Tyr Trp Gln Ala Phe Arg Glu Tyr Pro Arg Leu Gln Gly Gly

Phe Ile Trp Asp Trp Val Asp Gln Gly Leu Ser Lys Thr Asp Glu Asn

Gly Lys His Tyr Trp Ala Tyr Gly Gly Asp Phe Gly Asp Glu Leu Asn

Asp Arg Gln Phe Cys Ile Asn Gly Leu Leu Phe Pro Asp Arg Thr Pro

His Pro Ser Leu Phe Glu Ala Lys Tyr Ser Gln Gln His Leu Gln Phe

Thr Leu Arg Glu Gln Thr Gln Asn His Tyr Thr Val Asp Val Phe Ser

Asp Tyr Val Phe Arg Ala Thr Asp Asn Glu Lys Leu Val Trp Gln Leu

Ile Glu Asn Gly Gln Cys Ile Glu Gln Gly Glu Gln Ile Ile Ser Ile

Ala Pro Gln Ser Met Lys Thr Leu Thr Val Asn Thr Lys Thr Val Phe

Lys Ala Gly Ala Gln Tyr His Leu Asn Leu Asp Val Ala Leu Ile Asn

Asp Ser Ser Phe Ala Ser Ala Glu His Val Leu Asn Thr Glu Gln Phe

Lys Leu Ile Asn Ser Gln Ser Leu Ser Thr Asp Thr Phe Ser Pro Ala

Leu Ala Asn Ala Ser Thr His Gly Ala Leu Asn Ile Ser Glu Thr Asn

Thr Gln Leu Asn Ile Glu Gly Asp Ser Phe Lys Leu Val Phe Asn Ser

Gln Ser Gly Leu Ile Glu Gln Trp Leu His Asn Gln Thr Gln Val Ile

Lys Ser Pro Leu Val Asp Asn Phe Tyr Arg Ala Pro Leu Asp Asn Asp

Ile Gly Val Ser Glu Val Asp Asn Leu Asp Pro Asn Ala Trp Glu Ala

Arg Trp Leu Arg Ala Gly Ile Gly Gln Trp Gln Arg Thr Cys Arg Ser

Phe Glu Val Val Gln Ser Lys Ile Asp Ile Arg Ile Thr Cys Val Phe

Ser Tyr Glu Phe Asn Gly Ala Val Gln Ala Lys Thr Thr Trp Leu Tyr

Thr Leu Asn Asn Thr Gly Glu Ile Ser Leu Asn Val Asp Val Gln Leu

Asn Asp Thr Leu Pro Pro Met Pro Arg Ile Gly Leu Ser Thr Thr Leu

Asn Lys Gln Ser Asp Thr Gln Val Asn Trp Val Gly Leu Gly Pro Phe

Glu Asn Tyr Pro Asp Arg Lys Ala Ala Ala Arg Leu Gly Tyr Tyr Ser

Ala Gln His Asn Glu Leu His Thr Pro Tyr Ile Phe Pro Thr Asp Asn

Gly Val Arg Ser Asp Cys Gln Leu Leu Ser Val Asn Asn Leu Thr Val

Thr Gly Thr Phe Leu Phe Ala Ala Ser Glu Tyr Ser Gln Ser Met Leu

Thr Gln Ala Lys His Thr Asn Glu Leu Val Ala Asp Asp Cys Leu His

Val His Ile Asp His Gln His Met Gly Val Gly Gly Asp Asp Ser Trp

Ser Pro Ser Thr His Lys Glu Tyr Leu Leu Glu Gln Thr Gln Tyr

Asn Tyr Ser Leu Thr Phe Ser Ala Lys

<210> 3

<211> 34

<212> DNA

<213> Artificial Synthesis

<400> 3

cgcggatcca actcactaca gcacataatt aatc 34

<210> 4

<211> 34

<212> DNA

<213> Artificial Synthesis

<400> 4

ccgctcgagt ttagccgaaa aagttaaaga gtag 34

Claims

1. The use of the protein expressed by the gene Gal1265 for hydrolyzing the agar oligosaccharide under the concentration of 40-800mM potassium ion; the DNA sequence of the gene Gal1265 is shown in SEQ ID NO: 1, and the sequence of the expressed protein is shown as SEQ ID NO: 2, respectively.

2. Use of a protein expressed by a vector containing the gene Gal1265 to hydrolyze agar oligosaccharides at a potassium ion concentration of 40-800 mM; the DNA sequence of the gene Gal1265 is shown in SEQ ID NO: 1, and the sequence of the expressed protein is shown as SEQ ID NO: 2, respectively.