CN111394344B - Low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and application thereof - Google Patents

Abstract

The invention discloses a low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and application thereof, wherein the amino acid sequence of the hyaluronic acid lyase YNLX-HYL is shown as SEQ NO.1. The hyaluronan lyase YNLX-HYL has the following properties: optimum pH5.5, optimum temperature 35 deg.C, 10%, 39% and 55% enzyme activity at 0 deg.C, 10 deg.C and 20 deg.C, respectively, and high concentration (NH)₄)₂SO₄And Na₂SO₄The hyaluronic acid oligosaccharide has good activity and stability, can crack sodium hyaluronate to prepare unsaturated hyaluronic acid oligosaccharide, and has good oxidation resistance, and can clear away hydroxyl radicals, nitrogen radicals, superoxide anion radicals and the capacity of resisting oxidation of 2,2' -dinitrobis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS). The hyaluronic acid lyase can be applied to industries such as beauty treatment, medicine, tanning and the like.

Description

Low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and an application thereof.

Background

Hyaluronic acid, also known as hyaluronic acid, is a glycosaminoglycan naturally occurring in the body of living organisms. D-glucuronic acid and N-acetyl-D-glucosamine are connected by beta-1, 3 glycosidic bonds to form disaccharide units, and polysaccharide formed by connecting the disaccharide units by the beta-1, 4 glycosidic bonds is hyaluronic acid.

Hyaluronidase is capable of degrading hyaluronic acid. The first class of hyaluronidases is the hyaluronic acid 4-glycosyl hydrolase (EC 3.2.1.35), which degrades hyaluronic acid by hydrolyzing 1, 4-glycosidic bonds, with tetrasaccharide molecules as the major product. The second class of hyaluronidases is the hyaluronic acid 3-glycosyl hydrolase (EC 3.2.1.36), which degrades hyaluronic acid by hydrolyzing 1, 3-glycosidic bonds, with tetrasaccharide and hexasaccharide molecules as the major products. A third class of hyaluronidases is the hyaluronidase (EC 4.2.2.1) which degrades hyaluronic acid by the β -elimination mechanism to produce unsaturated hyaluronic acid disaccharides (El-Safory et al carbohydrate Polymers,2010,81: 165-.

The hyaluronidase can be applied to industries such as beauty treatment, medicine, tanning and the like. For example, hyaluronidase can be used as a drug injection additive to enhance the absorption efficiency of drugs by the body; in ophthalmic surgery, hyaluronidase can be used as adjuvant to reduce the amount of anesthetic used; the hyaluronidase can be used as a medicament for treating complications after cosmetic surgery by injecting hyaluronic acid; the hyaluronidase can be used as enzyme for processing leather, improve leather-making process, and reduce environmental pollution during leather-making process.

The low-temperature enzyme can be applied to the Biotechnology field under the requirement of low-temperature environment, can prevent the pollution of microorganisms and reduce byproducts caused by the degradation of the substrate under high temperature, and has lower energy consumption in low-temperature reaction compared with high-temperature reaction (Cavicchiali et al. microbiological Biotechnology,2011,4(4): 449-460.). Salts can have a large influence on the properties of the enzyme. In neutral salts, salting-out of the enzyme occurs, resulting in a large proportion of the enzyme not having good catalytic activity at high salt concentrations. Salt is widely present in nature and in various production practices including sewage, washing, tanning, food, paper, etc., e.g., in leather softening processes, requiring the addition of sodium sulfate. The enzyme with salt tolerance can be better applied to the biotechnology field of high-salt environment, and can prevent the pollution of microorganisms and save energy consumed by sterilization and the like in the reaction under the high-salt environment (Madern et al. Therefore, the low-temperature sulfate-resistant hyaluronic acid lyase has the application advantage in industries such as tanning and the like.

Disclosure of Invention

The invention aims to provide a low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and application thereof.

The technical purpose of the invention is realized by the following technical scheme:

a low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL has an amino acid sequence shown in SEQ ID NO.1.

The hyaluronic acid lyase YNLX-HYL of the invention contains 799 amino acids in total, the theoretical molecular weight is 88kDa, and 20 amino acids at the N end are a predicted signal peptide sequence 'MKKTNLAFSLLCLSMGSVHA'. Compared with the hyaluronic acid lyase which has been experimentally researched to have the function, the hyaluronic acid lyase YNLX-HYL has the highest amino acid sequence consistency of only 30.9 percent with the hyaluronic acid lyase (Genbank ID: CTD38391) derived from Streptococcus pneumoniae.

The hyaluronic acid lyase YNLX-HYL has the following properties: the hyaluronic acid oligosaccharide has the optimum pH value of 5.5, the optimum temperature of 35 ℃, 10%, 39% and 55% of enzyme activity at 0 ℃, 10 ℃ and 20 ℃, good activity and stability in high concentration (NH4)2SO4 and Na2SO4, can be cracked and decomposed by sodium hyaluronate to prepare unsaturated hyaluronic acid oligosaccharide, and the unsaturated hyaluronic acid oligosaccharide has good oxidation resistance and capability of removing hydroxyl radicals, nitrogen radicals, superoxide anion radicals and resisting oxidation of 2,2' -dinitrobis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS).

The coding gene YNLX-HYL of the low-temperature sulfate-resistant hyaluronan lyase YNLX-HYL is shown in SEQ ID NO.2 by the nucleotide sequence of the coding gene YNLX-HYL. The total length is 2400bp, the initial code is ATG, and the termination code is TAG.

In another aspect of the present invention, the hyaluronan lyase gene of the present invention is inserted into an expression vector such that its nucleotide sequence is linked to an expression regulatory sequence. Provides a recombinant vector containing the hyaluronic acid lyase gene ynlx-hyl. Preferably pEasy-E2-ynlx-hyl.

As a most preferred embodiment of the present invention, the hyaluronan lyase gene of the present invention is ligated to an expression vector pEasy-E2 to obtain a recombinant E.coli expression plasmid pEasy-E2-ynlx-hyl.

In another aspect of the invention, the invention also provides a recombinant strain containing the hyaluronan lyase gene ynlx-hyl.

Preferably, the recombinant strain is escherichia coli, yeast, bacillus or lactobacillus, and more preferably, the recombinant strain is BL21(DE 3)/ynlx-hyl.

In another aspect of the invention, the invention also provides a method for preparing unsaturated hyaluronic acid oligosaccharide by using the hyaluronic acid lyase YNLX-HYL.

In another aspect of the present invention, there is also provided a method for preparing a hyaluronan lyase YNLX-HYL comprising the steps of:

1) transforming host cells by using the recombinant vector to obtain a recombinant strain;

2) culturing the recombinant strain, and inducing expression of a recombinant hyaluronan lyase YNLX-HYL;

3) recovering and purifying the expressed hyaluronan lyase YNLX-HYL.

Wherein, the host cell is an escherichia coli cell, preferably, the recombinant escherichia coli expression plasmid is transformed into an escherichia coli cell BL21(DE3) to obtain a recombinant strain BL21(DE 3)/ynlx-hyl.

In another aspect of the invention, the hyaluronic acid lyase YNLX-HYL can be used for degrading hyaluronic acid in the fields of beauty treatment and medicine, and can also be used in the preparation of leather.

The invention has the beneficial effects that:

the invention provides a novel hyaluronic acid lyase gene, wherein the encoded hyaluronic acid lyase YNLX-HYL has the characteristic of low-temperature sulfate resistance, and YNLX-HYL can crack sodium hyaluronate to prepare unsaturated hyaluronic acid oligosaccharide which has excellent oxidation resistance. The hyaluronic acid lyase can be applied to industries such as beauty treatment, medicine, tanning and the like.

Drawings

FIG. 1 is SDS-PAGE analysis of hyaluronan lyase YNLX-HYL expressed in E.coli, wherein M: a protein Marker; HYL: purified recombinant hyaluronidase YNLX-HYL;

FIG. 2 is the pH activity of purified recombinant hyaluronan lyase YNLX-HYL;

FIG. 3 is the pH stability of purified recombinant hyaluronan lyase YNLX-HYL;

FIG. 4 is the thermal activity of purified recombinant hyaluronan lyase YNLX-HYL;

FIG. 5 is the thermostability of purified recombinant hyaluronan lyase YNLX-HYL;

FIG. 6 shows the activity of purified recombinant hyaluronan lyase YNLX-HYL in (NH4)2SO 4;

FIG. 7 shows the stability of purified recombinant hyaluronan lyase YNLX-HYL in (NH4)2SO 4;

FIG. 8 shows the activity of purified recombinant hyaluronan lyase YNLX-HYL in Na2SO 4;

FIG. 9 shows the stability of purified recombinant hyaluronan lyase YNLX-HYL in Na2SO 4;

FIG. 10 is an analysis of the product of the purified recombinant hyaluronan lyase YNLX-HYL for the cleavage of sodium hyaluronate, wherein R: lactose; 4 h: reacting for 4 h; 1 h: reacting for 1 h; and (20 min): reacting for 20min to obtain a product;

FIG. 11 is the nitrogen radical clearance of the purified recombinant hyaluronan lyase YNLX-HYL cleavage sodium hyaluronate product, where HA: nitrogen radical scavenging of sodium hyaluronate; HAM: nitrogen free radical clearance rate of the product after 1h reaction; HAD: nitrogen radical scavenging rate of the product of reaction for 5 h;

FIG. 12 is the hydroxyl radical clearance of the purified recombinant hyaluronan lyase YNLX-HYL cleavage sodium hyaluronate product, wherein HA: hydroxyl radical scavenging of sodium hyaluronate; HAM: hydroxyl radical scavenging rate of the product of reaction for 1 hour; HAD: hydroxyl radical scavenging rate of the product of reaction for 5 h;

FIG. 13 is a graph of superoxide anion radical scavenging rates of purified recombinant hyaluronan lyase YNLX-HYL cleavage sodium hyaluronate product, where HA: superoxide anion radical scavenging of sodium hyaluronate; HAM: superoxide anion radical scavenging of the product of the reaction for 1 hour; HAD: superoxide anion radical scavenging of the product of 5h reaction;

FIG. 14 is a graph of the relative total antioxidant rate of a purified recombinant hyaluronan lyase YNLX-HYL cleaved sodium hyaluronate product, wherein HA: relative total oxidation resistance of sodium hyaluronate; HAM: relative total oxidation resistance of the product of reaction for 1 hour; HAD: relative total oxidation resistance of the product reacted for 5 h.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Test materials and reagents

1. Bacterial strain and carrier: the property of the strain is reported in the literature, such as the strain Citrobacter freundii CGMCC NO. 1.12836; escherichia coli BL21(DE3) and expression vector pEasy-E2 were purchased from Beijing Quanjin Biotechnology Ltd.

2. Reagent: DNA polymerase and dNTP were purchased from TaKaRa, sodium hyaluronate from Shanghai leaf Biotech Co., Ltd, Nickel-NTAAgarose from QIAGEN,

the II kit is purchased from Nanjing Novovin, the nitrogen free radical scavenging capability test kit is purchased from Shanghai conyyi Biotech, the superoxide anion and hydroxyl free radical scavenging capability test kit is purchased from Solebao Biotechnology Limited, the total antioxidant capability test kit is purchased from Nanjing as a built organism, and other reagents can be purchased from common biochemical reagent companies.

3. Culture medium:

LB culture medium: peptone 10g, Yeast extract 5g, NaCl 10g, distilled water to 1000ml, natural pH (about 7). On the basis of the solid medium, 2.0% (w/v) agar was added.

Description of the drawings: the molecular biology experiments, which are not specifically described in the following examples, were carried out according to the specific methods listed in molecular cloning, A laboratory Manual (third edition) J. Sambuchok, supra, or according to the kit and product instructions.

Example 1 cloning of the Hyaluronan lyase Gene ynlx-hyl

Extracting the Citrobacter freundii genome DNA: centrifuging the liquid bacterial liquid cultured for 2d to obtain thalli, adding 1mL of lysozyme, treating at 37 ℃ for 60min, and then adding a lysate, wherein the lysate comprises the following components: 50mM Tris, 20mM EDTA, NaCl 500mM, 2% SDS (w/v), pH8.0, water bath lysis at 70 deg.C for 60min, mixing once every 10min, and centrifuging at 4 deg.C at 10000rpm for 5 min. Extracting the supernatant in phenol/chloroform to remove impurity proteins, adding equal volume of isopropanol into the supernatant, standing at room temperature for 5min, and centrifuging at 4 deg.C at 10000rpm for 10 min. Discarding the supernatant, washing the precipitate with 70% ethanol twice, vacuum drying, adding appropriate amount of TE to dissolve, and standing at-20 deg.C for use.

The Citrobacter freundii genomic DNA was sent to Wuhan future group Biotech Co., Ltd for genomic sequencing. After the data obtained by genome sequencing is subjected to reading frame prediction and database sequence comparison, the Citrobacter freundii genome is subjected to functional annotation to obtain the hyaluronan lyase gene ynlx-hyl, wherein the gene sequence is shown as SEQ ID NO. 2.

Example 2 preparation of recombinant Hyaluronolytic enzyme YNLX-HYL

PCR amplification was performed using 5'TAAGAAGGAGATATACATATGCAGATCGCTACCGAAAATGTAAAT 3' and 5'GTGGTGGTGGTGGTGCTCGAGTTTATTTTTAGATAATTCAAAAGAATAACTACTG 3' as primer pairs and Citrobacter freundii genomic DNA as a template. The PCR reaction parameters are as follows: denaturation at 95 deg.C for 5 min; then, denaturation at 95 ℃ for 30sec, annealing at 60 ℃ for 30sec, elongation at 72 ℃ for 1min for 30sec, and heat preservation at 72 ℃ for 10min after 30 cycles. The PCR result obtained hyaluronic acid lyase gene ynlx-hyl, and the 5 'end and 3' end of the gene introduced with the carrier pEasy-E2 recombination region.

The plasmid pEasy-E2 was subjected to double digestion with restriction enzymes Nde I and Xho I, and the product was recovered by agarose gel electrophoresis to obtain the linearized vector pEasy-E2.

By using

And II, the kit is used for recombining and connecting the hyaluronic acid lyase gene ynlx-hyl and a linearized vector pEasy-E2 to obtain a recombinant expression plasmid pEasy-E2-ynlx-hyl containing ynlx-hyl.

Escherichia coli BL21(DE3) was transformed with pEasy-E2-ynlx-hyl by heat shock to obtain recombinant Escherichia coli strain BL21(DE 3)/ynlx-hyl.

The recombinant Escherichia coli strain BL21(DE3)/ynlx-hyl containing the recombinant plasmid pEasy-E2-ynlx-hyl is inoculated into LB (containing 100 mu g mL-1Amp) culture solution with the inoculation amount of 0.1 percent, and is rapidly shaken for 16h at 37 ℃. Then, the activated bacterial solution was inoculated into a fresh LB (containing 100. mu.g mL-1Amp) culture solution at an inoculum size of 1%, rapidly cultured with shaking for about 2 to 3 hours (OD600 reached 0.6 to 1.0), then induced by adding IPTG at a final concentration of 0.7mM, and further cultured with shaking at 20 ℃ for about 20 hours or 26 ℃ for about 8 hours. Centrifugation was carried out at 12000rpm for 5min to collect the cells. After the thalli is suspended by using a proper amount of pH7.0 McIlvaine buffer solution, the thalli is broken by ultrasonic waves in a low-temperature water bath. After the crude enzyme solution concentrated in the above cells was centrifuged at 12,000rpm for 10min, the supernatant was aspirated and the target protein was respectively subjected to affinity elution with Nickel-NTA Agarose and 0-500 mM imidazole. SDS-PAGE results (FIG. 1) show that the recombinant hyaluronan lyase YNLX-HYL is purified, and the product is a single band.

EXAMPLE 3 determination of the Properties of the purified recombinant hyaluronic acid lyase YNLX-HYL

1. Analysis of the activity of the purified recombinant hyaluronan lyase YNLX-HYL:

example 2 method for measuring activity of purified recombinant hyaluronan lyase YNLX-HYL using uv method: dissolving sodium hyaluronate in buffer solution to make its final concentration be 0.5% (w/v); the reaction system contains 50 mul of proper enzyme solution and 450 mul of 0.5% (w/v) sodium hyaluronate; preheating a substrate at the reaction temperature for 5min, adding enzyme liquid for reacting for 10min, adding 3.5mL of 0.2M HCl to terminate the reaction, and measuring the light absorption value at the wavelength of 232 nm; 1 enzyme activity unit (U) is defined as the amount of enzyme required to degrade sodium hyaluronate per minute to form 1. mu. mol of unsaturated double bonds. The extinction coefficient of the unsaturated double bond was 5.5/mM/cm.

2. Determination of pH Activity and pH stability of purified recombinant Hyaluronolytic enzyme YNLX-HYL:

determination of the pH Activity of the enzymes: the hyaluronic acid lyase YNLX-HYL is subjected to an enzymatic reaction at 37 ℃ in a buffer solution having a pH of 3.0 to 10.0.

Determination of the pH stability of the enzyme: the purified enzyme solution was placed in a buffer solution of pH 3.0-9.0, treated at 20 ℃ for 60min, and then subjected to enzymatic reaction at pH5.5 and 37 ℃ with untreated enzyme solution as a control.

The buffer solution is as follows: McIlvaine buffer (pH3.0-8.0) and 0.1M glycine-NaOH (pH9.0-10.0). Reacting for 10min by using sodium hyaluronate as a substrate, and determining the enzymological property of the purified hyaluronic acid lyase YNLX-HYL.

The results show that: the optimum pH of YNLX-HYL is 5.5 (FIG. 2); after being treated by buffer solution with pH value of 5.0-7.0 for 1h, the enzyme activity of the enzyme is remained to be more than 59 percent (figure 3).

3. Determination of thermal activity and thermal stability of purified recombinant hyaluronan lyase YNLX-HYL:

determination of the thermal activity of the enzyme: the enzymatic reaction is carried out at 0-70 ℃ in a buffer solution at pH 5.5.

Determination of the thermostability of the enzyme: the enzyme solutions with the same enzyme amount were treated at 40 deg.C, 50 deg.C and 60 deg.C for 10-60 min, and then subjected to enzymatic reaction at pH5.5 and 37 deg.C, with untreated enzyme solution as control.

Reacting for 10min by using sodium hyaluronate as a substrate, and determining the enzymological property of the purified YNLX-HYL. The results show that YNLX-HYL is a typical low temperature enzyme. The optimum temperature of YNLX-HYL is 35 ℃, and the YNLX-HYL has 10 percent, 39 percent and 55 percent of enzyme activity at 0 ℃, 10 ℃ and 20 ℃ respectively (figure 4); after the enzyme is treated at 40 ℃ and 50 ℃ for 60min, 59% and 18% of the enzyme activity respectively remain, and the enzyme is rapidly inactivated at 60 ℃ (figure 5).

4. Purified recombinant hyaluronan lyase YNLX-HYL (NH)₄)₂SO₄Activity and stability assay of (1):

the enzyme is in (NH)₄)₂SO₄The activity assay of (1): 1.0-30.0% (w/v) (NH) was added to the enzymatic reaction system₄)₂SO₄The enzymatic reaction was carried out at pH5.5 and 37 ℃.

The enzyme is in (NH)₄)₂SO₄Stability determination in (1): placing the purified enzyme solution in 5.0-30.0% (w/v) of (NH)₄)₂SO₄The enzyme solution was treated in an aqueous solution at 37 ℃ for 60min, and then an enzymatic reaction was carried out at pH5.5 and 37 ℃ with an untreated enzyme solution as a control.

Reacting for 10min by using sodium hyaluronate as a substrate, and determining the enzymatic property of the purified YNLX-HYL. The results show that: adding 1.0-30.0% (w/v) of (NH) into the reaction system₄)₂SO₄The activity of YNLX-HYL was gradually increased to 276% (FIG. 6); (NH) at 5.0-30.0% (w/v)₄)₂SO₄The enzyme activity gradually decreased from 143% to 18% by treatment at 37 ℃ for 60min (FIG. 7).

5. Purified recombinant hyaluronidase YNLX-HYL in Na₂SO₄Activity and stability assay of (1):

the enzyme is in Na₂SO₄The activity assay of (1): 1.0-30.0% (w/v) Na2SO4 was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH5.5 and 37 ℃.

The enzyme is in Na₂SO₄Stability determination in (1): placing the purified enzyme solution in 5.0-30.0% (w/v) Na₂SO₄The enzyme solution was treated in an aqueous solution at 37 ℃ for 60min, and then an enzymatic reaction was carried out at pH5.5 and 37 ℃ with an untreated enzyme solution as a control.

Reacting for 10min by using sodium hyaluronate as a substrate, and determining the enzymatic property of the purified YNLX-HYL. The results show that: adding 1.0-20.0% (w/v) of Na into the reaction system₂SO₄The activity of YNLX-HYL is gradually increased to 220%, and 20.0-30.0% (w/v) Na is added₂SO₄The activity of YNLX-HYL gradually decreased from 220% to 130% (FIG. 8); passing through 5.0-30.0% (w/v) of Na₂SO₄The activity of the enzyme was reduced overall to 19% by treatment at 37 ℃ for 60min (FIG. 9).

Example 4 method and application of purified recombinant Hyaluronolytic enzyme YNLX-HYL in preparation of unsaturated Hyaluronan oligosaccharides

1. Preparation of unsaturated hyaluronic acid oligosaccharide:

the reaction system contained 450. mu.L of 0.5% (w/v) sodium hyaluronate and 50. mu.L of appropriately diluted YNLX-HYL (about 130U of enzyme solution), and after reacting at pH5.5 and 37 ℃ for 20min to 4h, the reaction was terminated by boiling for 5 min. The cleavage product was analyzed by Thin Layer Chromatography (TLC) (using high performance thin layer chromatography silica gel plate type G from Qingdao ocean chemical Co., Ltd.).

The thin layer chromatography procedure is as follows:

(1) preparing a developing solvent (20 mL of glacial acetic acid, 20mL of double distilled water and 40mL of n-butanol, uniformly mixing), pouring a proper amount of the developing solvent into a developing tank, and standing for about 30 min;

(2) activating the silica gel plate in a 110 deg.C oven for 30min, cooling, scribing, and spotting (0.5 μ L each time, blow drying, and spotting for 3 times);

(3) placing the silica gel plate at one end of the sample application downwards into an expansion tank, wherein the sample application point does not immerse a developing agent;

(4) when the developing agent is 1.5cm away from the upper edge of the silica gel plate, taking out the silica gel plate, drying and developing again;

(5) after the second unfolding, directly immersing the silica gel plate into a proper amount of color developing agent (1g of diphenylamine is dissolved in 50mL of acetone, 1mL of aniline and 5mL of 85% phosphoric acid are added after the dissolution, and the mixture is uniformly mixed and prepared on site;

(6) after a few seconds, the silica gel plate was immediately removed and placed in an oven at 90 ℃ for 10-15 min to allow the spots to develop color.

The results show that: the product formed by YNLX-HYL cracking sodium hyaluronate for 20min is mainly unsaturated hyaluronic acid disaccharide, and in addition, the product also comprises two unsaturated hyaluronic acid oligosaccharides; the product formed by cracking sodium hyaluronate for 1h by YNLX-HYL is mainly unsaturated hyaluronic acid disaccharide, and also contains unsaturated hyaluronic acid oligosaccharide; the product formed after YNLX-HYL cleaves sodium hyaluronate for 4h is unsaturated hyaluronic disaccharide (figure 10).

2. Antioxidant analysis of unsaturated hyaluronic acid oligosaccharides:

the reaction system contained 5mL of 5% (w/v) sodium hyaluronate, 1mL of appropriately diluted YNLX-HYL (about 5000U enzyme solution), reacted at pH5.5 and 35 ℃ for 1 hour and 5 hours, and then boiled for 5min to terminate the reaction. Adding the cleavage product into a 10kDa ultrafiltration tube, centrifuging at 5000rpm to remove macromolecular substances such as enzyme, and collecting the filtrate in the tube to obtain unsaturated hyaluronic acid oligosaccharide.

The kit is used for detecting the nitrogen free radical scavenging capacity, the hydroxyl free radical scavenging capacity, the superoxide anion free radical scavenging capacity and the total antioxidant capacity of the sodium hyaluronate and the unsaturated hyaluronic acid oligosaccharide. The control for total antioxidant capacity was 1mM water soluble vitamin E (Trolox) and was assayed using ABTS.

The results show that: the nitrogen radical clearance rate of unsaturated hyaluronic acid oligosaccharide formed by YNLX-HYL cracking sodium hyaluronate for 1h and 5h is 68% and 73% respectively, and the nitrogen radical clearance rate of uncleaved sodium hyaluronate is 20% (figure 11); the hydroxyl radical clearance rate of unsaturated hyaluronic acid oligosaccharide formed by YNLX-HYL cracking sodium hyaluronate for 1h and 5h is 68% and 79%, respectively, and the hydroxyl radical clearance rate of uncleaved sodium hyaluronate is 41% (figure 12); superoxide anion radical clearance rates of unsaturated hyaluronic acid oligosaccharides formed by YNLX-HYL cleavage of sodium hyaluronate for 1h and 5h were 62% and 64%, respectively, while that of uncleaved sodium hyaluronate was 13% (FIG. 13); the relative total oxidation resistance of unsaturated hyaluronic acid oligosaccharides formed by YNLX-HYL cleavage of sodium hyaluronate for 1h and 5h was 62% and 61%, respectively, while the relative total oxidation resistance of uncleaved sodium hyaluronate was 14% (fig. 14).

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> university of Yunnan Master

<120> low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 799

<212> PRT

<213> hyaluronic acid lyase (YNLX-HYL)

<400> 1

Met Lys Lys Thr Asn Leu Ala Phe Ser Leu Leu Cys Leu Ser Met Gly

1 5 10 15

Ser Val His Ala Gln Ile Ala Thr Glu Asn Val Asn Leu Pro Val Val

20 25 30

Lys Ser Thr Thr Thr Thr Ser Thr Gln Gln Gln His Ile Ile Glu Arg

35 40 45

Met Arg Asp Thr Trp Arg Gln Asn Phe Val Pro Ser Gly Pro Ala Ala

50 55 60

Pro Glu Leu Ser Ala Glu Tyr Val Ala Ser Leu Asn Lys Thr Ala Asn

65 70 75 80

Ile Phe Trp Lys Gly Ile Asp Lys Asn Thr Pro Ala Gly Gln Leu Trp

85 90 95

Ala Asp Thr Val Leu Asp Ser Glu Ser Thr Ser Gly Arg Leu Lys Leu

100 105 110

Gly Thr Thr Leu Tyr Thr Val Tyr Gln Arg Leu Phe Thr Leu Ala Lys

115 120 125

Ala Trp Ala Thr Pro Gly Thr Asp Leu Tyr Lys Asn Ala Gln Leu Asn

130 135 140

Thr Val Leu Lys Ser Ala Leu Ile Asn Leu Asn Gln Asp Tyr Tyr Asn

145 150 155 160

Asp Gln Thr Pro Glu Trp Gly Asn Trp Trp Asn Trp Glu Leu Gly Ile

165 170 175

Ser Arg Ser Val Asn Asn Thr Leu Val Ile Leu Tyr Asp Asp Leu Pro

180 185 190

Ser Thr Leu Ile Asp Asn Tyr Asn Leu Ala Thr Arg His Phe Val Arg

195 200 205

Asp Pro Arg Tyr Leu Ala Glu Gly Ser Gly Ala Pro Tyr Ser Thr Thr

210 215 220

Lys Asn Ala Phe Thr Ser Thr Gly Gly Asn Arg Ile Asp Ser Ala Met

225 230 235 240

Val Val Phe Val Arg Gly Leu Leu Ala Asn Asp Pro Gly Glu Ile Ser

245 250 255

Ala Ala Val Thr Ser Val Pro Glu Val Leu Asn Thr Val Gln Ser Gly

260 265 270

Asp Gly Phe Tyr Lys Asp Gly Ser Phe Ile Gln His Lys Asp Leu Pro

275 280 285

Tyr Ser Gly Thr Tyr Gly Gln Val Leu Leu Asn Gly Leu Gly Leu Ile

290 295 300

Lys Asn Ser Val Ala Gly Thr Pro Trp Asp Phe Ser Val Glu Asp Asn

305 310 315 320

Arg Arg Ile Tyr Asp Val Ile Arg Gln Ala Phe Leu Pro Leu Leu His

325 330 335

Glu Gly Lys Met Pro Asp Ala Val Asn Gly Arg Ser Ile Ser Arg Lys

340 345 350

Asn Gly Gln Asp Gln Asp Val Gly Ala Ser Val Met Asn Ala Ile Ala

355 360 365

Leu Phe Val Asn Gly Ala Pro Pro Glu Glu Lys Arg His Ile Glu Gln

370 375 380

Val Leu Lys Ala Gln Leu Asn Ser Lys Thr Thr Glu Tyr Tyr His Thr

385 390 395 400

His Leu Pro Glu Asn Leu Thr Ser Trp Gln Val Ile Thr Arg Ile Gln

405 410 415

Gln His Ser His Leu Pro Pro Ala Pro Arg Thr Ala Gly Gly Lys Leu

420 425 430

Tyr Ala Asp Met Asp Arg Leu Ile Tyr Gln Gly Thr Asn Tyr Leu Ala

435 440 445

Val Val Ala Met His Ser Asn Arg Thr Gly Ser Tyr Glu Cys Ile Asn

450 455 460

Asn Glu Asn Leu Lys Gly Gln Arg Thr Ser Asp Gly Met Thr Trp Leu

465 470 475 480

Tyr Leu Pro Asn Asp Asp Gln Tyr Arg Asp Tyr Trp Pro Val Val Asp

485 490 495

Ser Arg Phe Leu Pro Gly Thr Thr Ser Ala Gly Glu Gln Gly Trp Cys

500 505 510

Asp Glu Gln Tyr Arg Val Thr Gln Leu Gly Arg Ala Asn Ile Ala Trp

515 520 525

Ala Gly Gly Asn Thr Leu Asn Lys Trp Ala Ser Ala Ser Met His Leu

530 535 540

Lys Val Pro Thr Tyr Ser Leu Lys Ala Lys Lys Ser Trp Phe Met Ala

545 550 555 560

Pro His Glu Met Ile Met Leu Gly Ser Gln Ile Ser Ser Ser Ser Pro

565 570 575

Ala Val Thr Thr Ile Ala Asn Gln Lys Ile Ser Gly Ser Ala Lys Val

580 585 590

Leu Val Asp Gly Ile Val Leu Leu Pro Gly Glu Glu Arg Lys Ala Thr

595 600 605

Gln Ser Val Val Leu Asn Asp Lys Gly Asn Asn Ile Ile Trp Lys Pro

610 615 620

Leu Ala Gly Ser Ser Ala Gln Val Ser Val Lys Gln Arg Gln Gly Asn

625 630 635 640

Trp Ala Asp Ile Gly Thr Ser Ser Gly Lys Val Ser Ala Gln Phe Leu

645 650 655

Thr Ile Ile Gln Pro His Ser Ala Glu Ser Asp Asn His Tyr Ala Trp

660 665 670

Val Val Phe Pro Ser Gly Ser Ala Ser Pro Ser Val Asn Ala Asp Ile

675 680 685

Thr Leu Leu Ala Asn Asp Ala Lys Val Gln Ala Val Ser Leu Pro Gly

690 695 700

Gln Gln Val Ile Tyr Ala Asn Phe Trp Arg Ser Ala Thr Val Gly Gly

705 710 715 720

Ile His Ala Leu Thr Pro Met Ser Leu Ile Met Thr Pro Thr Thr Gln

725 730 735

Gly Tyr Gln Ile Ala Val Ser Ser Pro Arg Arg Asp Ser Arg Val Ser

740 745 750

Phe Gln Leu Pro Asp Asn Ala Ile Pro Phe His Ile Ser Ser Asp Pro

755 760 765

Asp Lys Arg Val Ser Leu Asn Gly Glu Ile Val Ser Val Asn Met Thr

770 775 780

Asn Leu Arg Gly Ser Ser Tyr Ser Phe Glu Leu Ser Lys Asn Lys

785 790 795

<210> 2

<211> 2400

<212> DNA

<213> hyaluronic acid lyase gene (ynlx-hyl)

<400> 2

atgaaaaaga caaatttagc attttcgcta ttgtgcttaa gtatgggcag cgtacatgca 60

cagatcgcta ccgaaaatgt aaatctgcca gtagtaaaat caactaccac aacgtcaacc 120

cagcaacagc atattattga gcgtatgcgt gatacctggc ggcagaattt tgtgccttca 180

ggcccagcgg cgccagaatt atcagcagag tatgtggcaa gtttaaacaa aacggccaat 240

atattctgga aaggaataga taaaaatacc cccgcaggcc agttatgggc agataccgta 300

ctggatagtg aaagcacatc aggacgcctg aaactgggca ctactcttta tacggtatac 360

caacgcctgt tcaccctggc aaaagcctgg gctacgccgg ggacagatct ttataaaaat 420

gctcagttga atactgtact taaatcagcg ctgatcaatc tgaaccagga ctattataac 480

gatcagaccc cagaatgggg aaactggtgg aactgggagt taggcatttc acgcagtgtt 540

aacaatactc tggtgatact ttatgatgat ctcccttcca cgctgattga taattataat 600

ctcgcgaccc gacattttgt tcgcgaccct cgttatttag ctgaaggaag cggagccccc 660

tactccacaa caaaaaatgc ctttacgtcg actggcggaa accgcattga cagcgcaatg 720

gtcgtttttg ttcggggtct cctggctaac gatcctggag aaattagcgc tgcagtaact 780

tcagtacctg aagtgcttaa caccgttcag tccggagatg gtttctacaa agacggatcg 840

tttatccagc ataaagattt accttatagc ggaacctatg gccaggtttt gctgaatggt 900

ctgggattaa ttaaaaacag cgtcgcaggt acaccatggg atttctcagt tgaagataat 960

cgccgtattt atgacgtgat cagacaagct tttttacctt tacttcatga gggaaaaatg 1020

cccgatgccg tcaatgggcg cagtatttca cgtaaaaatg ggcaggatca ggatgttggc 1080

gcatcagtta tgaatgccat tgcattgttt gttaatggtg cgccaccaga agaaaagcgc 1140

cacattgaac aggtattaaa agcccagcta aattcaaaaa caacggaata ttatcacact 1200

cacttgccag aaaacttaac ctcctggcag gttattacgc gtattcaaca gcatagccat 1260

ttgccaccgg ccccccgaac agcgggcggt aaactgtatg cagatatgga tcgtctgatt 1320

tatcagggta caaactatct ggctgttgta gcgatgcatt ccaatcgtac tggtagctac 1380

gaatgtatta ataacgagaa tctaaaaggg cagagaacat ctgatgggat gacctggctg 1440

tatttgccca atgacgatca atatcgtgat tactggcctg tggtcgacag tcggttttta 1500

ccaggcacca cctctgctgg cgagcagggt tggtgtgatg agcaataccg tgtgactcag 1560

ttaggtcggg caaatatcgc ctgggcgggt ggcaatactc tgaataaatg ggcaagcgcg 1620

agtatgcatt taaaagtgcc gacttattca ctcaaggcga aaaaatcctg gttcatggca 1680

ccgcatgaaa tgatcatgct tgggagccag atatccagta gtagcccggc ggtaacgacc 1740

attgctaatc agaaaatcag tggctcggca aaagtgcttg ttgatggcat cgtcttgctg 1800

cccggagaag agagaaaagc aacccaatct gtcgttttaa acgataaagg taataacatt 1860

atctggaagc cattagctgg ctcaagcgca caagttagtg tgaaacaacg tcagggtaac 1920

tgggccgata tcggcacctc atccggtaaa gtttcggcac aatttttaac cattatccag 1980

cctcatagcg cagaatcaga taatcattat gcctgggttg tcttcccctc ggggtccgca 2040

tccccttccg taaatgctga cataacgctc cttgcgaatg atgcaaaagt ccaggctgtg 2100

tcgctaccag gtcagcaggt tatttatgct aatttctggc gttctgcaac tgtgggaggc 2160

attcatgcat tgacgccaat gtccctgatt atgacgccaa caacacaagg ttatcagata 2220

gcagtatctt caccacgtcg tgatagtcgg gtgtcattcc aactgcccga taatgcaatc 2280

ccattccata tttccagtga ccctgataag cgcgtatctc ttaacgggga gatcgtcagc 2340

gtgaatatga ccaatctacg cggcagtagt tattcttttg aattatctaa aaataaatag 2400

<210> 3

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Lys Thr Asn Leu Ala Phe Ser Leu Leu Cys Leu Ser Met Gly

1 5 10 15

Ser Val His Ala

20

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taagaaggag atatacatat gcagatcgct accgaaaatg taaat 45

<210> 5

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtggtggtgg tggtgctcga gtttattttt agataattca aaagaataac tactg 55

Claims (6)

1. The low-temperature sulfate-resistant hyaluronic acid lyase YNLX-HYL is characterized in that the amino acid sequence of the hyaluronic acid lyase YNLX-HYL is shown as SEQ ID No.1.

2. The coding gene YNLX-HYL of hyaluronidase YNLX-HYL of claim 1, wherein the nucleotide sequence of the coding gene YNLX-HYL is represented by SEQ ID No. 2.

3. A recombinant expression vector, which is characterized by comprising the coding gene ynlx-hyl according to claim 2.

4. The recombinant expression vector of claim 3, wherein the recombinant expression vector is pEasy-E2-ynlx-hyl.

5. A recombinant bacterium comprising the coding gene ynlx-hyl according to claim 2.

6. A recombinant bacterium according to claim 5, wherein the recombinant bacterium is BL21(DE 3)/ynlx-hyl.

Images