CN111004755A

CN111004755A - Citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by Citrobacter T26 and application of hyaluronidase HylC

Info

Publication number: CN111004755A
Application number: CN201911400783.1A
Authority: CN
Inventors: 宫倩红; 于文功; 张晓娟
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2020-04-14

Abstract

The invention provides a citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by the citrobacter T26 and application of the citrobacter T26. The classification name of the Citrobacter T26 is Citrobacter T26Citrobactersp.T26, with a preservation number of CCTCC NO: m2017203 round, translucent, milky white, surface light colonyThe leather is smooth and moist, the center is raised, the edges are neat, and the diameter is 1.5mm-3 mm. The hyaluronidase HylC is obtained by fermenting citrobacter T26, can specifically degrade hyaluronic acid in an endo-type manner, and the final product is unsaturated hyaluronic acid disaccharide. The hyaluronidase HylC can be used for preparing recombinant hyaluronidase, can promote subcutaneous diffusion, and can be used as a medicament diffusing agent to promote the diffusion and absorption effects of medicaments.

Description

Citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by Citrobacter T26 and application of hyaluronidase HylC

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by the citrobacter T26 and application of the citrobacter T HylC.

Background

Hyaluronic Acid (HA), a type of glycosaminoglycan, is a linear high-molecular acidic glycosaminoglycan formed by connecting D-glucuronic acid (GlcA) and N-acetylglucosamine (GlcNAc) disaccharide repeating units through β -1, 3 glycosidic bonds and β -1, 4 glycosidic bonds, and HAs been widely used in the fields of food, medicine, cosmetics and the like.

The hyaluronidase from the microorganisms can be used as a tool enzyme to produce low-molecular hyaluronic acid, has important biological activity in the field of medicine, can be clinically used as an important medicine diffusion promoter for promoting the absorption of medicines and promoting the dissipation of local edema or hematoma after operation and trauma.

Disclosure of Invention

The invention provides a citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by the citrobacter T26 and application of the citrobacter T26.

In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:

the invention provides a Citrobacter T26 for specifically degrading hyaluronic acid, which is characterized in that the Citrobacter sp is classified and named as Citrobacter sp, and the preservation number is CCTCC NO: m2017203.

Furthermore, the colony of the citrobacter T26 is round, translucent, milky white, smooth and moist in surface, raised in center, neat in edge, and 1.5-3 mm in diameter.

Furthermore, the suitable growth temperature of the citrobacter T26 is 25-35 ℃, and the pH value is 5-10.

Furthermore, the citric acid bacillus T26 grows rapidly, and the growth log phase is reached after 3-12 h of culture.

The invention also provides hyaluronidase HylC which is obtained by fermenting the citrobacter T26 which specifically degrades hyaluronic acid, and the nucleotide sequence of the coding gene is shown as SEQ ID No. 2.

Further, the reaction temperature of the hyaluronidase HylC is 30-50 ℃, the reaction pH is 4.5-6.5, and the reaction temperature of the hyaluronidase HylC is Ca²⁺、Mn²⁺、Ba²⁺Promoting the enzyme activity of the hyaluronidase HylC.

Further, the NaCl salt concentration of 0.08-0.8M has a promoting effect on the enzyme activity of the hyaluronidase HylC.

Further, the degradation mode of the hyaluronidase HylC is endo type, and the final product is unsaturated hyaluronic acid disaccharide.

Further, the hyaluronidase HylC can specifically degrade hyaluronic acid without degrading other glycosaminoglycans.

Further, the optimal reaction temperature of the hyaluronidase HylC is 40 ℃, and the optimal reaction pH is 6.0.

The invention also provides application of the hyaluronidase HylC in preparation of recombinant hyaluronidase.

Further, the conditions for inducing protein expression of the recombinant hyaluronidase are as follows: the addition amount of IPTG is 0.1-0.2 mM, and the induction temperature is 18-22 ℃.

Furthermore, the enzyme activity of the recombinant hyaluronidase rHylC can reach 28-33 times of that of the hyaluronidase HylC.

The invention also provides application of the hyaluronidase HylC in preparation of preparations for producing unsaturated hyaluronic acid oligosaccharides.

The invention also provides application of the hyaluronidase HylC in preparation of a drug dispersing agent for promoting subcutaneous diffusion.

Furthermore, the unit of activity of the hyaluronidase HylC is 0.01-0.02U.

Compared with the prior art, the invention has the following advantages and beneficial effects: the invention screens a Citrobacter T26 Citrobacter sp.t26 strain capable of producing hyaluronidase from offshore, and the preservation number is CCTCC NO: m2017203, and hyaluronidase HylC is separated and purified from the hyaluronidase HylC, the hyaluronidase has high catalytic efficiency at low temperature and good temperature stability, and has strong specificity to a substrate, hyaluronic acid is specifically degraded, other glycosaminoglycans are not degraded, and the properties ensure that HylC has good prospects in industrial production and application; the degradation mode of HylC on hyaluronic acid is endo-type, the final degradation product is single, and the degradation product is unsaturated hyaluronic acid disaccharide, which provides possibility for producing unsaturated hyaluronic acid disaccharide by using the enzyme. The recombinant hyaluronidase rHylC is prepared by the hyaluronidase HylC, so that the yield and the activity of the hyaluronidase are improved, the hyaluronidase HylC can also well promote subcutaneous diffusion, and can be used as a good drug dispersing agent to promote the diffusion and absorption of drugs, so that the hyaluronidase HylC obtained by fermenting the citrobacter T26 has high research value and industrial application value.

Drawings

FIG. 1 shows the colony morphology of Citrobacter T26 according to the invention.

FIG. 2 is a tree analysis of the C.citrobacter T26 in the present invention.

FIG. 3 shows the result of degradation of hyaluronic acid by Citrobacter T26 on a hyaluronic acid medium in the present invention.

FIG. 4 is an SDS-PAGE pattern of HylC hyaluronidase in the present invention, wherein M is a protein standard; 1 is a crude enzyme; 2 is the active component after ion exchange chromatography; 3 is the active component after hydrophobic chromatography.

FIG. 5 is a graph showing the effect of temperature and pH on the HylC enzyme activity of hyaluronidase in the present invention, wherein A is the optimum temperature, B is the temperature stability, C is the optimum pH, and D is the pH stability.

FIG. 6 is a graph showing the effect of NaCl concentration on HylC enzyme activity of hyaluronidase in the present invention.

FIG. 7 is a graph showing the degradation ability of hyaluronidase HylC of the present invention to various glycosaminoglycans.

FIG. 8 is a time-product TLC analysis chart of the hyaluronic acid enzymatic hydrolysis by HylC of hyaluronidase in the present invention, wherein s is hyaluronic acid substrate; 1-9 represent samples degraded for 0, 1, 5, 10, 20, 30min and 1h, 2h, 4h, respectively.

FIG. 9 is an ESI-MS detection chart of the HylC degradation end product of hyaluronidase in the present invention.

FIG. 10 is a graph showing the results of the hyaluronidase HylC of the present invention promoting the diffusion of subcutaneous trypan blue.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to specific examples.

Example 1: identification and physiological and biochemical properties of Citrobacter T26

1. Screening and purification of Citrobacter T26

Primary screening: collecting offshore seawater of Qingdao as a sample, coating the sample on a solid screening culture medium (5g of sodium hyaluronate, 15g of agar powder coated on plates, 1000ml of water, pH7.0, sterilizing at 121 ℃ for 15 minutes) for primary screening, and inversely culturing in a constant-temperature incubator at 25 ℃ for 24-72 hours. And (3) streaking, purifying and culturing the well-grown bacterial colonies on a plate again, selecting a single bacterial colony, inoculating the single bacterial colony on a hyaluronic acid primary screening culture medium (5g of sodium hyaluronate, 15g of agar powder and 1000ml of water, pH7.0, sterilizing at 121 ℃ for 15min, melting the culture medium by using a microwave oven when the bacterial colony is used, adding 10g of Albumin bouine V (bovine serum Albumin fifth component) when the bacterial colony is cooled to be not scalded, performing inverted culture in a constant-temperature incubator at 25 ℃ for 48-72 h, pouring 10ml of 200mM glacial acetic acid on the surface of the plate, and observing whether a transparent ring is generated or not. The hyaluronic acid with high molecular weight has a large amount of negative charges, can be combined with the fifth component of bovine serum albumin to form a compound which can be mixed with glacial acetic acid to generate a turbidity reaction, and the hyaluronidase can degrade the hyaluronic acid in the compound to form a transparent ring on a flat plate, so that the generation of the transparent ring indicates that the bacterial colony can generate the hyaluronidase, and the size of the generated transparent ring can preliminarily judge the degradation capability of the hyaluronidase generated by the bacterial colony. Through preliminary screening, the invention screens 63 strains of strains which produce transparent circles from 900 colonies.

Re-screening: from the results of the preliminary screening, colonies having a high enzyme-producing ability were selected from a liquid fermentation medium (5g of sodium hyaluronate, 10g of NaCl, 2g K)₂HPO₄·3H₂O、1gKH₂PO₄、0.7g MgSO₄·7H₂O, 0.5g of yeast powder and 1000ml of water, pH7.0, sterilized at 121 ℃ for 15min), and culturing in a shaking incubator at 25 ℃. Taking fermentation liquor at different culture time intervals, centrifugally collecting thalli, re-suspending the thalli by using 10mM Tris-HCl (pH 7.5), and respectively using hyaluronic acid as a substrate and adopting A₂₃₂The enzyme activity is measured by the method. The principle is that the reaction of degrading glycosaminoglycan substrates (hyaluronic acid, chondroitin sulfate, heparin and the like) by glycosaminoglycan lyase can generate unsaturated double bonds, the unsaturated double bonds have maximum light absorption at 232nm, and the quantity of the unsaturated double bonds is in direct proportion to the absorbance value within a certain range, so that the light absorption value (OD) at 232nm can be measured₂₃₂) To detect the quantity of unsaturated double bonds in the substrate and further display the production quantity of the product to determine the magnitude of enzyme activity。A₂₃₂The enzyme activity and enzyme activity detection method is defined as follows: adding 100 μ L of test sample with appropriate concentration into 900 μ L of 2g/L hyaluronic acid or other glycosaminoglycan substrate dissolved in 10mM Tris-HCl buffer solution with pH7.5, mixing, reacting in 37 deg.C constant temperature water bath for 10min, boiling in boiling water for 10min, cooling to room temperature, and detecting OD₂₃₂(ii) a The control was boiled inactivated enzyme solution. Enzyme activity is defined as: the amount of enzyme required to catalyze the production of 1. mu. mol of reducing sugar per minute is defined as one enzyme activity unit (U).

The results show that 30 strains of 63 rescreened strains can produce enzyme with the enzyme yield of more than 5U/L, and finally, a strain with the highest hyaluronidase production activity is selected and named as T26, and the hyaluronidase produced by the strain is named as HylC.

The colony morphology of the strain T26 on an LB culture medium is shown in figure 1, the colony is round, semitransparent, milky white, smooth and moist in surface, raised in center, neat in edge and 1.5-3 mm in diameter.

2. Identification of Citrobacter T26

The genome DNA of the strain T26 is used as a template, 16S rDNA universal primers are used for amplification, sequence determination is carried out on amplified fragments, the 16S rDNA sequencing result of the obtained strain T26 is compared with the sequence in GenBank for analysis, and the result is shown in figure 2, the strain T26 and two strains of Citrobacter form an evolutionary branch, so that the strain T26 is determined to be Citrobacter sp.T26. The 16S rDNA sequence of the strain T26 is SEQ ID No.1 and is preserved.

The invention carries out strain preservation on the screened strain T26, and the preservation unit is as follows: china Center for Type Culture Collection (CCTCC); address: wuchang Lodojia mountain, Wuhan university Collection, Wuhan, Hubei province; the preservation date is as follows: 21/4/2017, the preservation number of the Citrobacter T26 Citrobacter sp.t26 is CCTCC NO: m2017203.

3. Physiological and biochemical characteristics of Citrobacter T26

(1) The Citrobacter T26 is detected according to a strain physiological and biochemical detection method of Bergey bacteria identification manual, and the identification result of the Citrobacter T26 shows that the detection of β -galactosidase, power, hydrogen sulfide generation, lactose utilization, rhamnose utilization and citrate utilization is positive.

(2) The suitable growth temperature of the citric acid bacillus T26 is 25-35 ℃, and the pH value is 5-10.

(3) The method comprises the steps of enabling the citrobacter T26 to be positive in hyaluronidase, preparing a hyaluronic acid culture medium which takes hyaluronic acid as a unique carbon source and is added with a fifth component of bovine serum albumin, inoculating citrobacter T26 on the plate culture medium, carrying out streak culture until colonies grow out, carrying out inverted culture in a constant-temperature incubator at 25 ℃ for 24-72 hours, pouring 10ml of 200mM glacial acetic acid on the surface of a plate, and observing whether a transparent ring is generated or not. The result is shown in fig. 3, the citrobacter T26 can not only grow on the hyaluronic acid culture medium, but also degrade hyaluronic acid and generate larger transparent circles, which indicates that citrobacter T26 can generate hyaluronidase with better activity. The activity of the hyaluronidase produced by the citrobacter T26 can reach 66.4U/L. In a hyaluronic acid culture medium, the citrobacter T26 grows rapidly, the logarithmic phase of the growth of the strains is 3-12 h, the time that the strains enter the plateau phase of growth is longer when the strains reach 14h, the growth of the strains is in the plateau phase, the growth state of the strains is reduced after 36h, and the growth density is reduced. The Citrobacter T26 is continuously passaged for 30 times, the character is stable, and the hyaluronidase activity is still 66U/L.

Example 2: separation and purification of HylC

1. Preparing a crude enzyme solution: taking Citrobacter T26 preserved in a refrigerator at-80 ℃, streaking and activating for culturing for 48h in LB culture medium, adding 0.1mM IPTG, fermenting Citrobacter T26 at 25 ℃ and 160rpm, that is, a single clone was picked and placed in a 50mL conical centrifuge tube containing 5mL of the liquid fermentation medium (the same liquid fermentation medium used in the rescreening in example 1), shaking and culturing at 25 deg.C and 160r/min for 12h, inoculating 1% into 100ml of the liquid fermentation culture medium, shaking and culturing at 25 ℃ for 12h at 160r/min, collecting fermentation liquor, centrifuging at 12,000rpm for 20min, discarding supernatant, collecting thalli, then using 1/10-volume 10mM Tris-HCl buffer solution with pH7.5 for resuspension, carrying out low-temperature ultrasonic disruption, centrifuging at 12,000rpm for 20min at low temperature, collecting supernatant, namely the prepared hyaluronidase HylC crude enzyme solution, and carrying out enzyme activity determination on the crude enzyme solution.

2. Ion Exchange Chromatography (Ion Exchange Chromatography, IEC): a DEAE Sepharose high Performance column (1.1 cm. times.10 cm) was connected to an AKTA FPLC purification system at a sample loading of 10mL, and the column was equilibrated with an equilibration buffer (10mM Tris-HCl, pH 7.5) for 5-10 column volumes at a flow rate of 1 mL/min. And (2) loading the hyaluronidase HylC crude enzyme solution prepared in the step 1 onto a DEAE chromatographic column at the flow rate of 1ml/min, washing 3-5 column volumes with an equilibrium buffer solution after loading, and then eluting with an elution buffer solution, wherein the elution buffer solution is the equilibrium buffer solution containing 0.4M NaCl. And finally, carrying out gradient elution at the flow rate of 1ml/min, collecting active components as much as possible, and carrying out hyaluronidase activity detection on the collected substances, wherein the operations are all completed at 4 ℃.

3. Hydrophobic Chromatography (HIC): loading the active components collected by ion exchange chromatography in step 2 onto Phenyl HP hydrophobic chromatography column (1.1cm × 20cm), equilibrating the column with equilibration buffer solution containing 1.5M NaCl, eluting with NaCl step-by-step elution at flow rate of 2ml/min, collecting the eluates, and eluting with A₂₃₂The hyaluronidase activity of each eluted fraction was determined by the method, all at 4 ℃.

4. And (3) detection of a purification effect: and (3) determining the enzyme activity of each elution component collected in the step (3), calculating the specific activity and carrying out SDS-PAGE electrophoresis detection. And (3) calculating specific activity: specific activity (U/mg) ═ enzyme activity (U/ml)/protein content (mg/ml).

The two-step purification of ion exchange chromatography and hydrophobic chromatography is carried out to finally obtain the hyaluronidase HylC of electrophoresis purity, and the nucleotide sequence of the coding gene of the hyaluronidase HylC is shown as SEQ ID No. 2. As shown in FIG. 4, SDS-PAGE results showed that the molecular weight of hyaluronidase HylC was 85.8kDa, and the specific activity of purified HylC enzyme was 90.5U/mg.

Example 3: enzymatic Properties of HylC

1. Optimum reaction temperature of HylC

In order to detect the optimal reaction temperature of hyaluronidase HylC, firstly, a prepared hyaluronic acid substrate (2g/L, 10mM Tris-HCl, pH 7.5) is respectively placed at different temperatures of 0 ℃, 10 ℃, 20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃ and 70 ℃ for heat preservation for 10min, then HylC enzyme liquid diluted after 10mM Tris-HCl purification is respectively added, the HylC enzyme liquid is immediately taken out and boiled for 10min after the reaction is carried out for 10min at different temperatures, an A232 is measured by an ultraviolet spectrophotometer after a sample is cooled to room temperature, an enzyme activity unit is calculated according to an absorbance value, and the optimal reaction temperature of the enzyme is compared and determined, wherein the value when the enzyme activity is maximum is defined as 100%.

The result is shown in fig. 5A, the enzyme activity of HylC shows a significant rising trend along with the temperature rise between 0 ℃ and 40 ℃, the enzyme activity reaches the highest value at 40 ℃, and then the enzyme activity gradually decreases along with the temperature rise, so that the optimal reaction temperature of HylC is determined to be 40 ℃.

2. Effect of temperature on HylC stability

To examine the stability of HylC at different temperatures, the purified enzyme was first dialyzed into 10mM Tris-HCl buffer pH7.5, and then 200. mu.l of the diluted enzyme was incubated at 0 ℃, 10 ℃, 20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃ and 70 ℃ for 1 hour, and then immediately placed in an ice-water mixture and incubated for 10 min. And (3) determining the residual enzyme activity of each group of samples at the optimal reaction temperature by using an A232 method, defining the maximum enzyme activity as 100%, calculating the residual enzyme activity of the HylC after the HylC is placed for 1 hour at different temperatures, and determining the temperature stability of the HylC.

As can be seen from FIG. 5B, HylC has better thermal stability between 0 ℃ and 40 ℃, and about 60% of enzyme activity can still remain after heat preservation for 1h at 40 ℃.

3. Optimum reaction pH for HylC

0.4% hyaluronic acid substrate (dissolved in ddH)₂O) are respectively placed in different prepared buffer solution systems with different pH values of 3-10.6 according to the ratio of 1: glycine-NaOH (pH 8.6-10.6), Tris-HCl (pH7.05-8.95), PB (pH6.0-8.0), Na₂HPO₄Citric acid (pH 3.0-8.0). Dialyzing the separated and purified hyaluronidase solution in double distilled water, and determining enzyme activity at the optimum reaction temperature according to A232 method, wherein the enzyme activity when the enzyme activity is maximum is defined as 100%And determining the optimal reaction pH of HylC.

As can be seen from fig. 5C, the optimal pH of hyaluronidase HylC is 6.0(PB buffer), which is a neutral hyaluronidase, and the enzyme activity is significantly reduced when the pH is below 4 and above 8.

4. Effect of pH on HylC stability

Dialyzing the enzyme solution after the separation and purification of the hydrophobic chromatography in double distilled water, and respectively adding the enzyme solution into different buffers with pH of 3-10.6: glycine-NaOH (pH 8.6-10.6), Tris-HCl (pH7.05-8.95), PB (pH6.0-8.0), Na₂HPO₄Citric acid (pH 3.0-8.0), buffer final concentration 50mM, in 4 ℃ refrigerator for 12 h. The enzyme activity is measured by using an A232 method at the optimal reaction temperature, the enzyme activity when the enzyme activity is maximum is defined as 100 percent, and the stability of the enzyme under different pH values is determined.

As can be seen from FIG. 5D, the activity of HylC was more than 50% at pH 4-8.

5. Influence of Metal ions and surfactants on HylC enzyme Activity

When the influence of metal ions and a surfactant on the activity of the HylC enzyme is inspected, K with the final concentration of 1mM is respectively added into an enzyme reaction system⁺、Ca²⁺、Ba²⁺、Fe³⁺、Ni²⁺、Cu²⁺、Mg²⁺、Al³⁺、Mn²⁺、Zn²⁺、Li⁺EDTA and SDS, and determining the enzyme activity of HylC. The absorbance values of the reaction system without any metal ions, EDTA and SDS were used as a control, and the enzyme activity of the control group was defined as 100%.

As can be seen from Table 1, Ca²⁺、Mn²⁺、Ba²⁺The enzyme activity of HylC is well promoted; zn²⁺And EDTA severely inhibits the activity of HylC.

TABLE 1 influence of different metal ions, EDTA and SDS on the activity of HylC enzyme in the present invention

6. Effect of different concentrations of NaCl on HylC Activity

0.2% hyaluronic acid substrate was prepared, dissolved in Tris-HCl buffer (10mM, pH 7.5), and NaCl at various concentrations was added to give final NaCl concentrations of 0, 30mM, 50mM, 80mM, 100mM, 200mM, 300mM, 400mM, 500mM, 600mM, 700mM, 800mM, 900mM, 1M, 1.5M, 2M, 2.5M, and 3M in the substrate, respectively, and the enzymatic activity of HylC was measured under the optimal reaction conditions. The enzyme activity measured without adding NaCl substrate is set as 100%, and the influence of NaCl with different concentrations on the enzyme activity is calculated and compared.

As can be seen from FIG. 6, the enzyme activity gradually increases with the increase of NaCl concentration, the HylC enzyme activity reaches the highest value at 0.3M NaCl, which is about 3 times of the enzyme activity at the time of no NaCl addition, and then has a better promotion effect on the enzyme activity with the increase of NaCl concentration, but shows a decreasing trend relative to 0.3M.

7. Substrate preference study of HylC

The substrate specificity of hyaluronidase was reflected by the ability of HylC to degrade different glycosaminoglycan substrates. And (3) respectively carrying out heat preservation on enzyme liquid of pure enzyme (dissolved in 10mM Tris-HCl buffer solution with the pH value of 7.5) obtained by separation and purification and hyaluronic acid, chondroitin sulfate-A, chondroitin sulfate-B, chondroitin sulfate-AC, chondroitin sulfate-D, chondroitin sulfate-E and sodium heparin (2g/L, 10mM Tris-HCl and the pH value of 7.5) at the optimal reaction temperature for 10min, measuring the enzyme activity, defining the value with the highest enzyme activity as 100%, and evaluating the degradation capability of HylC on different glycosaminoglycan substrates by comparison.

The results are shown in FIG. 7, and HylC has no degradation ability on chondroitin sulfate-A, chondroitin sulfate-B, chondroitin sulfate-AC, chondroitin sulfate-D, chondroitin sulfate-E and heparin sodium, which indicates that HylC is hyaluronidase for specifically degrading hyaluronic acid.

8. HylC degradation mode and final degradation product study

(1) Study of the degradation mode of HylC.

Adding the purified HylC into 10ml of hyaluronic acid substrate (2g/L), reacting at 40 ℃ for different times, taking out reaction products, carrying out boiling water bath for 10min, centrifuging to remove insoluble substances, detecting the supernatant by the following detection method, analyzing the degradation products at different reaction times, and judging the degradation mode. Cutting TLC chromatographic plate activated in oven at 150 deg.C for 30min, placing each sample concentrated 10 times at the original point, placing in developing tank containing developing agent (n-butanol: glacial acetic acid: water: 2: 1) for 2h, blow-drying the chromatographic plate, soaking in developer (phenylaniline diphenylamine) for 2s, taking out, blow-drying, and baking at high temperature until sample appears.

As can be seen from fig. 8, hyaluronidase HylC degrades hyaluronic acid faster, and hyaluronic acid oligosaccharides are gradually produced, so HylC is an endo-type hyaluronic acid lyase.

(2) Analysis of HylC degradation end products

Adding purified HylC into 10ml of hyaluronic acid substrate (2g/L), reacting at 40 ℃ for 4h to completely degrade the substrate, centrifuging to remove insoluble substances, taking the supernatant, carrying out TLC spotting, detecting the final degradation product and carrying out scraper recovery on the final degradation product. Activating a pre-cut TLC chromatography plate, spotting a sample at an original point, placing the sample in a developing tank with a developing agent (n-butyl alcohol, glacial acetic acid and water are 2: 1) for 2h, drying the chromatography plate by blowing, immersing the plate in a color-developing agent (phenylamine diphenylamine) for 2s, taking out the plate and drying the plate by blowing, baking the plate at a high temperature until the sample appears, and detecting a final degradation product. And recovering the degraded sample scraper, mixing the degraded sample scraper with acetonitrile in an equal volume, detecting the molecular weight of a reaction product by ESI-anion mass spectrometry, and analyzing the result.

Results as shown in fig. 9, the final product of hyaluronidase HylC degradation is unsaturated hyaluronic acid disaccharide.

In conclusion, the optimal reaction temperature of the hyaluronidase HylC is 40 ℃, and more than 50% of enzyme activity can still remain after heat preservation l h at 40 ℃; the optimum reaction pH is pH6.0, and the activity can reach more than 50% within the range of pH 4-8; ca²⁺、Mn²⁺Ba2+ can promote the activity of HylC, Zn²⁺And EDTA severely inhibits the activity of HylC; when the NaCl concentration reaches 0.3M, HylC reaches the highest enzyme activity; HylC can specifically degrade hyaluronic acid; the degradation mode of HylC on hyaluronic acid is an endo type, and the final degradation product is unsaturated hyaluronic acid disaccharide。

Example 4: preparation of recombinant hyaluronidase rHylC

The hyaluronidase HylC obtained by the invention can be used for preparing recombinant hyaluronidase rHylC, and the process is as follows:

1. construction of recombinant expression vector of HylC

According to the gene sequence of HylC, analyzing the enzyme cutting sites which are not contained in the target gene by online sequence enzyme cutting site analysis software (http:// nc2.neb. com/NEBcut 2/), designing PCR specific primers, adding NdeI (CATATG) and XhoI (CTCGAG) enzyme cutting sites to the 5' ends of the upstream primer and the downstream primer respectively, and respectively naming the designed forward and reverse primers as HylC-F and HylC-R, wherein the designed primers are HylC-F: GGAATTCCATATGGGCAGCGTACATGCACAGAT (SEQ ID No.3) and HylC-R: CCGCTCGAGTTTATTTTTAGATAATTCAAAAGAATA (SEQ ID No. 4). The PCR reaction system for the HylC gene fragment amplification is as follows: 1. mu.l of DNA; the upstream and downstream primers were 1. mu.l, respectively; dNTP 4. mu.l; buffer 10. mu.l; primerstar 0.5. mu.l and ddH₂The PCR reaction conditions are 98 ℃ for 5min, 98 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 2min, 30 cycles are repeated, 72 ℃ for 7min, the PCR reaction is carried out by adopting the reaction conditions, agarose gel electrophoresis detection is carried out, target fragments are recovered, plasmids are extracted from E.coli DH5 α strains containing pET-28a (+) vectors, restriction enzymes NdeI and XhoI are used for carrying out double enzyme digestion on the pET-28a (+) vectors, glue recovery is carried out on target bands of about 5300bp, the HylC target fragments obtained by PCR amplification are connected with the pET-6328 a (+) vectors, the connection system is placed at 16 ℃ for overnight connection, products in the connection system are transferred into E.coli DH5 α competent state, the target bands are coated on LB solid culture medium containing kana penicillin resistance, the target bands are stored for standby, the target bands are cultured in 37 ℃ constant temperature incubator, the target bands are singly picked to LB liquid culture medium containing kana penicillin resistance, whether the target bands are cultured at 37 ℃ for overnight, whether the target bands are identified by using a shaker, and the target sequences are subjected to be subjected to comparison with a BL sequence analysis (DE) to determine whether the correct expression of the plasmid sequences after the plasmid sequences are tested and the plasmid sequences are returned to the plasmid sequences (3).

And connecting the enzyme-digested HylC fragment with a pET28a (+) vector, transforming the fragment into a DH5 α competent cell, and carrying out bacteria liquid PCR identification, selecting positive clone for sequencing, comparing the sequence to find that the expression vector pET28a (+) -HylC is consistent with a target gene obtained by genome sequencing and has no gene mutation, and obtaining a recombinant expression vector pET28a (+) -HylC of the hyaluronidase HylC, wherein the nucleotide sequence of the recombinant plasmid is shown as SEQ ID No. 5.

2. Separation and purification of recombinant hyaluronidase rHylC

Picking E.coli BL21(DE3)/pET28a-HylC monoclonal to LB liquid medium, shaking culture at 37 ℃ overnight; the overnight cultured cells were transferred to 100ml of liquid LB at a ratio of 1% to OD₆₀₀Adding 0.1mM IPTG between 0.4-0.6, and inducing at 20 deg.C for 24 hr; the fermentation broth was centrifuged at 12000rpm at 4 ℃ for 20min to collect the cells. The thalli is resuspended by adopting PB (pH 7.0) buffer solution with the volume of 1/10 fermentation liquor; crushing thallus with a low temperature high pressure crusher, centrifuging at 4 deg.C and 12000rpm for 20min, and collecting supernatant to obtain crude enzyme solution; the nickel ion column was equilibrated with equilibration solution (20mM PB pH7.0, 500mM NaCl) and washed 5-10 column volumes at a flow rate of 1.0 ml/min. Loading the crude enzyme solution, performing gradient elution with eluent (20mM PB pH7.0, 500mM NaCl, 500mM imidazole), collecting each component, and determining enzyme activity; the collected enzyme solution was dialyzed in 1L of dialysate (20mM PB pH 7.0) in a dialysis bag with 3 dialysate changes every 2 h. The enzyme solution after dialysis, namely the harvested purified recombinant hyaluronidase rHylC, is subpackaged and stored at-20 ℃.

Through optimization of protein expression conditions, 0.1mM IPTG is adopted to culture for 24h at the temperature of 20 ℃ and the rpm of 160, and the enzyme activity of the rHylC fermentation liquor can reach 2032U/L which is much higher than that of HylC. The acquisition of the recombinant hyaluronidase HylC can realize the high-efficiency expression of the hyaluronidase HylC, improve the yield and activity of the enzyme and contribute to enriching the knowledge of the hyaluronidase.

Example 5: research on effect of hyaluronidase HylC in promoting subcutaneous diffusion

Adult healthy female mice (18-22g) are selected, after the mice are bred for 3-4 days and the properties of the mice are stabilized, 100 mu l of 2% pentobarbital sodium is injected into the abdominal cavity of each mouse for anesthesia, after the back of each mouse is shaved, trypan blue solution and hyaluronidase HylC (0.002U, 0.01U and 0.02U) with different activity units are injected into the back of each mouse subcutaneously, the diffusion areas of the dye at different time points are measured 5, 10, 15, 20, 30 and 45min after injection, the sizes d1 and d2 of 2 dimensions are measured, and the diffusion area is pi/4 xd 1 xd 2.

The results are shown in fig. 10, when hyaluronidase is not added as a negative control, after hyaluronidase of different activity units is injected to the back of a mouse, the diffusion area of trypan blue shows a clear rising trend within 0min to 20min, the diffusion area rises slowly within 20min to 45min, and finally the diffusion area reaches the maximum at 45 min. In addition, with the increase of activity units, the diffusion speed and the diffusion area of trypan blue are obviously increased, wherein the effect is best at 0.02U, and the final diffusion area can reach about 700% of the initial area, which shows that hyaluronidase HylC has a good diffusion promoting effect, and also shows that HylC can produce unsaturated hyaluronic acid oligosaccharide or be used as a good medicine diffusing agent to promote the diffusion and absorption of medicines.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> China oceanic university

<120> Citrobacter T26 for specifically degrading hyaluronic acid, hyaluronidase HylC produced by Citrobacter T26 and application of hyaluronidase HylC

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>1400

<212>DNA

<213> Citrobacter T26(Citrobacter sp.)

<400>1

ccctcccgaa ggttaagcta cctacttctt ttgcaaccca ctcccatggt gtgacgggcg 60

gtgtgtacaa ggcccgggaa cgtattcacc gtggcattct gatccacgat tactagcgat 120

tccgacttca tggagtcgag ttgcagactc caatccggac tacgacatac tttatgaggt 180

ccgcttgctc tcgcgaggtc gcttctcttt gtatatgcca ttgtagcacg tgtgtagccc 240

tactcgtaag ggccatgatg acttgacgtc atccccacct tcctccagtt tatcactggc 300

agtctccttt gagttcccgg cctaaccgct ggcaacaaag gataagggtt gcgctcgttg 360

cgggacttaa cccaacattt cacaacacga gctgacgaca gccatgcagc acctgtctca 420

gagttcccga aggcaccaaa gcatctctgc taagttctct ggatgtcaag agtaggtaag 480

gttcttcgcg ttgcatcgaa ttaaaccaca tgctccaccg cttgtgcggg cccccgtcaa 540

ttcatttgag ttttaacctt gcggccgtac tccccaggcg gtcgacttaa cgcgttagct 600

ccggaagcca cgcctcaagg gcacaacctc caagtcgaca tcgtttacgg cgtggactac 660

cagggtatct aatcctgttt gctccccacg ctttcgcacc tgagcgtcag tctttgtcca 720

gggggccgcc ttcgccaccg gtattcctcc agatctctac gcatttcacc gctacacctg 780

gaattctacc cccctctaca agactctagc ctgccagttt cggatgcagt tcccaggttg 840

agcccgggga tttcacatcc gacttgacag accgcctgcg tgcgctttac gcccagtaat 900

tccgattaac gcttgcaccc tccgtattac cgcggctgct ggcacggagt tagccggtgc 960

ttcttctgcg agtaacgtca attgctgcgg ttattaacca caacaccttc ctcctcgctg 1020

aaagtacttt acaacccgaa ggccttcttc atacacgcgg catggctgca tcaggcttgc 1080

gcccattgtg caatattccc cactgctgcc tcccgtagga gtctggaccg tgtctcagtt 1140

ccagtgtggc tggtcatcct ctcagaccag ctagggatcg tcgcctaggt gagccgttac 1200

cccacctact agctaatccc atctgggcac atccgatggc aagaggcccg aaggtccccc 1260

tctttggtct tgcgacgtta tgcggtatta gctaccgttt ccagtagtta tccccctcca 1320

tcgggcagtt tcccagacat tactcacccg tccgccactc gtcacccaag gagcaagctc 1380

ctctgtgcta ccgttcgact 1400

<210>2

<211>2400

<212>DNA

<213> Citrobacter T26(Citrobacter sp.)

<400>2

atgaaaaaga caaatttagc attttcgcta ttgtgcttaa gtatgggcag cgtacatgca 60

cagatcgcta ccgaaaatgt aaatctgcca gtagtaaaat caactaccac aacgtcaacc 120

cagcaacagc atattattga gcgtatgcgt gatacctggc ggcagaattt tgtgccttca 180

ggcccagcgg cgccagaatt atcagcagag tatgtggcaa gtttaaacaa aacggccaat 240

aaactctgga aaggaataga taaaaatacc cccgcaggcc agttatgggc agataccgta 300

ctggatagtg aaagcacatc aggacgcctg aaactgggca ctactcttta tacggtatac 360

caacgcctgt tcaccctggc aaaagcctgg gctacgccgg ggacagatct ttataaaaat 420

gcccagttgt atactgtact taaatcagcg ctgatcaatc tgaaccagga ctattataac 480

gatcagaccc cagaatgggg aaactggtgg aactgggagt taggcatttc acgcagtgtt 540

aacaatactc tggtgatact ttatgatgat ctcccttcca cgctgattga taaatataat 600

ctcgcgaccc gacattttgt tcgcgaccct cgttatttag ctgaaggaag cggagccccc 660

tactccacca caaaaaatgc ctttacgtcg actggcggaa accgcattga cagcgcaatg 720

gtcgtttttg ttcggggtct cctggctaac gatcctggag aaattagcgc tgcagtaact 780

tcagtacctg aagtgcttaa caccgttcag tccggagatg gtttctacaa agacggatcg 840

tttatccagc ataaagattt accttatagc ggaacctatg gccaggtttt gctgaatggt 900

ctgggattaa ttaaaaacag cgtcgcaggt acaccatggg atttctcagt tgaagataat 960

cgccgtattt atgacgtgat cagacaagct tttttacctt tacttcatga gggaaaaatg 1020

cccgatgccg tcaatgggcg cagtatttca cgtaaaaatg ggcaggatca ggatgttggc 1080

gcatcagtta tgaatgccat tgcattgttt gttaatggtg cgccaccaga agaaaagcgc 1140

cacattgaac aggtattaaa agcccagcta aattcaaaaa caacggaata ttatcacact 1200

cacttgccag aaaacttaac ctcctggcag gttattacgc gtattcaaca ggatagccat 1260

ttgccaccgg ccccccgaac agcgggcggt aaactgtatg cagatatgga tcgtctgatt 1320

tatcagggta caaactatct ggctgttgta gcgatgcatt ccaatcgtac tggtagctac 1380

gaatgtatta ataacgagaa tctaaaaggg cagagaacat ctgatgggat gacctggctg 1440

tatttgccca atgacgatca atatcgtgat tactggcctg tggtcgacag tcggttttta 1500

ccaggcacca cctctgctgg cgagcagggt tggtgtgatg agcaataccg tgtgactcag 1560

ttaggtcggg caaatatcgc ctgggcgggt ggcaatactc tgaataaatg ggcaagcgcg 1620

agtatgcatt taaaagtgcc gacttattca ctcaaggcga aaaaatcctg gttcatggca 1680

ccgcatgaaa tgatcatgct tgggagccag atatccagta gtagcccggc ggtaacgacc 1740

attgctaatc agaaaatcag tggctcggca aaagtgcttg ttgatggcat cgtcttgcag 1800

cccggagaag agagaaaagc aacccaatct gtcgttttaa acgataaagg taataacgtt 1860

atctggaagc cattagctgg ctcaagcgca caagttagtg tgaaacaacg tcagggtaac 1920

tgggccgata tcggcacctc atccggtaaa gtttcggcac aatttttaac cattatccag 1980

cctcatagcg cagaatcaga taatcattat gcctgggttg tcttcccctc ggggtccgca 2040

tccccttccg taaatgctga cataacgctc cttgcgaatg atgcaaaagt ccaggctgtg 2100

tcgctaccag gtcagcaggt tatttatgct aatttctggc gttctgcaac tgtgggaggc 2160

attcatgcat tgacgccaat gtccctgatt atgacgccaa caacacaagg ttatcagata 2220

gcagtatctt caccacgtcg tgatagtcgg gtgtcattcc aactgcccga taatgcaatc 2280

ccattccata tttccagtga ccctgataag cgcgtatctc ttaacgggga catcgtcagc 2340

gtgaatatga ccaatctacg cggcagtagt tattcttttgaattatctaa aaataaatag 2400

<210>3

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggaattccat atgggcagcg tacatgcaca gat 33

<210>4

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgctcgagt ttatttttag ataattcaaa agaata 36

<210>5

<211>7614

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtttattt ttagataatt 180

caaaagaata actactgccg cgtagattgg tcatattcac gctgacgatg tccccgttaa 240

gagatacgcg cttatcaggg tcactggaaa tatggaatgg gattgcatta tcgggcagtt 300

ggaatgacac ccgactatca cgacgtggtg aagatactgc tatctgataa ccttgtgttg 360

ttggcgtcat aatcagggac attggcgtca atgcatgaat gcctcccaca gttgcagaac 420

gccagaaatt agcataaata acctgctgac ctggtagcga cacagcctgg acttttgcat 480

cattcgcaag gagcgttatg tcagcattta cggaagggga tgcggacccc gaggggaaga 540

caacccaggc ataatgatta tctgattctg cgctatgagg ctggataatg gttaaaaatt 600

gtgccgaaac tttaccggat gaggtgccga tatcggccca gttaccctga cgttgtttca 660

cactaacttg tgcgcttgag ccagctaatg gcttccagat aacgttatta cctttatcgt 720

ttaaaacgac agattgggtt gcttttctct cttctccggg ctgcaagacg atgccatcaa 780

caagcacttt tgccgagcca ctgattttct gattagcaat ggtcgttacc gccgggctac 840

tactggatat ctggctccca agcatgatca tttcatgcgg tgccatgaac caggattttt 900

tcgccttgag tgaataagtc ggcactttta aatgcatact cgcgcttgcc catttattca 960

gagtattgcc acccgcccag gcgatatttg cccgacctaa ctgagtcaca cggtattgct 1020

catcacacca accctgctcg ccagcagagg tggtgcctgg taaaaaccga ctgtcgacca 1080

caggccagta atcacgatat tgatcgtcat tgggcaaata cagccaggtc atcccatcag 1140

atgttctctg cccttttaga ttctcgttat taatacattc gtagctacca gtacgattgg 1200

aatgcatcgc tacaacagcc agatagtttg taccctgata aatcagacga tccatatctg 1260

catacagttt accgcccgct gttcgggggg ccggtggcaa atggctatcc tgttgaatac 1320

gcgtaataac ctgccaggag gttaagtttt ctggcaagtg agtgtgataa tattccgttg 1380

tttttgaatt tagctgggct tttaatacct gttcaatgtg gcgcttttct tctggtggcg 1440

caccattaac aaacaatgca atggcattca taactgatgc gccaacatcc tgatcctgcc 1500

catttttacg tgaaatactg cgcccattga cggcatcggg catttttccc tcatgaagta 1560

aaggtaaaaa agcttgtctg atcacgtcat aaatacggcg attatcttca actgagaaat 1620

cccatggtgt acctgcgacg ctgtttttaa ttaatcccag accattcagc aaaacctggc 1680

cataggttcc gctataaggt aaatctttat gctggataaa cgatccgtct ttgtagaaac 1740

catctccgga ctgaacggtg ttaagcactt caggtactga agttactgca gcgctaattt 1800

ctccaggatc gttagccagg agaccccgaa caaaaacgac cattgcgctg tcaatgcggt 1860

ttccgccagt cgacgtaaag gcattttttg tggtggagta gggggctccg cttccttcag 1920

ctaaataacg agggtcgcga acaaaatgtc gggtcgcgag attatattta tcaatcagcg 1980

tggaagggag atcatcataa agtatcacca gagtattgtt aacactgcgt gaaatgccta 2040

actcccagtt ccaccagttt ccccattctg gggtctgatc gttataatag tcctggttca 2100

gattgatcag cgctgattta agtacagtat acaactgggc atttttataa agatctgtcc 2160

ccggcgtagc ccaggctttt gccagggtga acaggcgttg gtataccgta taaagagtag 2220

tgcccagttt caggcgtcct gatgtgcttt cactatccag tacggtatct gcccataact 2280

ggcctgcggg ggtattttta tctattcctt tccagagttt attggccgtt ttgtttaaac 2340

ttgccacata ctctgctgat aattctggcg ccgctgggcc tgaaggcaca aaattctgcc 2400

gccaggtatc acgcatacgc tcaataatat gctgttgctg ggttgacgtt gtggtagttg 2460

attttactac tggcagattt acatatggct gccgcgcggc accaggccgc tgctgtgatg 2520

atgatgatga tggctgctgc ccatggtata tctccttctt aaagttaaac aaaattattt 2580

ctagagggga attgttatcc gctcacaatt cccctatagt gagtcgtatt aatttcgcgg 2640

gatcgagatc tcgatcctct acgccggacg catcgtggcc ggcatcaccg gcgccacagg 2700

tgcggttgct ggcgcctata tcgccgacat caccgatggg gaagatcggg ctcgccactt 2760

cgggctcatg agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg ccgggggact 2820

gttgggcgcc atctccttgc atgcaccatt ccttgcggcg gcggtgctca acggcctcaa 2880

cctactactg ggctgcttcc taatgcagga gtcgcataag ggagagcgtc gagatcccgg 2940

acaccatcga atggcgcaaa acctttcgcg gtatggcatg atagcgcccg gaagagagtc 3000

aattcagggt ggtgaatgtg aaaccagtaa cgttatacga tgtcgcagag tatgccggtg 3060

tctcttatca gaccgtttcc cgcgtggtga accaggccag ccacgtttct gcgaaaacgc 3120

gggaaaaagt ggaagcggcg atggcggagc tgaattacat tcccaaccgc gtggcacaac 3180

aactggcggg caaacagtcg ttgctgattg gcgttgccac ctccagtctg gccctgcacg 3240

cgccgtcgca aattgtcgcg gcgattaaat ctcgcgccga tcaactgggt gccagcgtgg 3300

tggtgtcgat ggtagaacga agcggcgtcg aagcctgtaa agcggcggtg cacaatcttc 3360

tcgcgcaacg cgtcagtggg ctgatcatta actatccgct ggatgaccag gatgccattg 3420

ctgtggaagc tgcctgcact aatgttccgg cgttatttct tgatgtctct gaccagacac 3480

ccatcaacag tattattttc tcccatgaag acggtacgcg actgggcgtg gagcatctgg 3540

tcgcattggg tcaccagcaa atcgcgctgt tagcgggccc attaagttct gtctcggcgc 3600

gtctgcgtct ggctggctgg cataaatatc tcactcgcaa tcaaattcag ccgatagcgg 3660

aacgggaagg cgactggagt gccatgtccg gttttcaaca aaccatgcaa atgctgaatg 3720

agggcatcgt tcccactgcg atgctggttg ccaacgatca gatggcgctg ggcgcaatgc 3780

gcgccattac cgagtccggg ctgcgcgttg gtgcggatat ctcggtagtg ggatacgacg 3840

ataccgaaga cagctcatgt tatatcccgc cgttaaccac catcaaacag gattttcgcc 3900

tgctggggca aaccagcgtg gaccgcttgc tgcaactctc tcagggccag gcggtgaagg 3960

gcaatcagct gttgcccgtc tcactggtga aaagaaaaac caccctggcg cccaatacgc 4020

aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc 4080

gactggaaag cgggcagtga gcgcaacgca attaatgtaa gttagctcac tcattaggca 4140

ccgggatctc gaccgatgcc cttgagagcc ttcaacccag tcagctcctt ccggtgggcg 4200

cggggcatga ctatcgtcgc cgcacttatg actgtcttct ttatcatgca actcgtagga 4260

caggtgccgg cagcgctctg ggtcattttc ggcgaggacc gctttcgctg gagcgcgacg 4320

atgatcggcc tgtcgcttgc ggtattcgga atcttgcacg ccctcgctca agccttcgtc 4380

actggtcccg ccaccaaacg tttcggcgag aagcaggcca ttatcgccgg catggcggcc 4440

ccacgggtgc gcatgatcgt gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc 4500

cttactggtt agcagaatga atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc 4560

aaaacgtctg cgacctgagc aacaacatga atggtcttcg gtttccgtgt ttcgtaaagt 4620

ctggaaacgc ggaagtcagc gccctgcacc attatgttcc ggatctgcat cgcaggatgc 4680

tgctggctac cctgtggaac acctacatct gtattaacga agcgctggca ttgaccctga 4740

gtgatttttc tctggtcccg ccgcatccat accgccagtt gtttaccctc acaacgttcc 4800

agtaaccggg catgttcatc atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc 4860

ggtatcatta cccccatgaa cagaaatccc ccttacacgg aggcatcagt gaccaaacag 4920

gaaaaaaccg cccttaacat ggcccgcttt atcagaagcc agacattaac gcttctggag 4980

aaactcaacg agctggacgc ggatgaacag gcagacatct gtgaatcgct tcacgaccac 5040

gctgatgagc tttaccgcag ctgcctcgcg cgtttcggtg atgacggtga aaacctctga 5100

cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa 5160

gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca 5220

cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag attgtactga 5280

gagtgcacca tatatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 5340

caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 5400

agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 5460

aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 5520

gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 5580

tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 5640

cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 5700

ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 5760

cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 5820

atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 5880

agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 5940

gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 6000

gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 6060

tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 6120

agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 6180

gattttggtc atgaacaata aaactgtctg cttacataaa cagtaataca aggggtgtta 6240

tgagccatat tcaacgggaa acgtcttgct ctaggccgcg attaaattcc aacatggatg 6300

ctgatttata tgggtataaa tgggctcgcg ataatgtcgg gcaatcaggt gcgacaatct 6360

atcgattgta tgggaagccc gatgcgccag agttgtttct gaaacatggc aaaggtagcg 6420

ttgccaatga tgttacagat gagatggtca gactaaactg gctgacggaa tttatgcctc 6480

ttccgaccat caagcatttt atccgtactc ctgatgatgc atggttactc accactgcga 6540

tccccgggaa aacagcattc caggtattag aagaatatcc tgattcaggt gaaaatattg 6600

ttgatgcgct ggcagtgttc ctgcgccggt tgcattcgat tcctgtttgt aattgtcctt 6660

ttaacagcga tcgcgtattt cgtctcgctc aggcgcaatc acgaatgaat aacggtttgg 6720

ttgatgcgag tgattttgat gacgagcgta atggctggcc tgttgaacaa gtctggaaag 6780

aaatgcataa acttttgcca ttctcaccgg attcagtcgt cactcatggt gatttctcac 6840

ttgataacct tatttttgac gaggggaaat taataggttg tattgatgtt ggacgagtcg 6900

gaatcgcaga ccgataccag gatcttgcca tcctatggaa ctgcctcggt gagttttctc 6960

cttcattaca gaaacggctt tttcaaaaat atggtattga taatcctgat atgaataaat 7020

tgcagtttca tttgatgctc gatgagtttt tctaagaatt aattcatgag cggatacata 7080

tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg 7140

ccacctgaaa ttgtaaacgt taatattttg ttaaaattcg cgttaaattt ttgttaaatc 7200

agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc aaaagaatag 7260

accgagatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt aaagaacgtg 7320

gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact acgtgaacca 7380

tcaccctaat caagtttttt ggggtcgagg tgccgtaaag cactaaatcg gaaccctaaa 7440

gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg 7500

aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta 7560

accaccacac ccgccgcgct taatgcgccg ctacagggcg cgtcccattc gcca 7614

Claims

1. A citrobacter T26 for specifically degrading hyaluronic acid is characterized in that the citrobacter T26 is named in classificationCitrobactersp. preservation number is CCTCC NO: m2017203.

2. The citrobacter T26 for specifically degrading hyaluronic acid according to claim 1, wherein the colony of citrobacter T26 is round, translucent, milky white, smooth and moist in surface, raised in center, neat in edge, and 1.5-3 mm in diameter.

3. HylC, a hyaluronidase which is obtained by fermentation of the Citrobacter bacterium T26 which specifically degrades hyaluronic acid according to claim 1, wherein the nucleotide sequence of the coding gene is shown in SEQ ID No. 2.

4. The hyaluronidase HylC of claim 3, wherein the hyaluronidase HylC has a suitable reaction temperature of 30 to 50 ℃, a suitable reaction pH of 4.5 to 6.5, Ca²⁺、Mn²⁺、Ba²⁺Promoting the enzyme activity of the hyaluronidase HylC.

5. The hyaluronidase HylC of claim 3, wherein the hyaluronidase HylC degrades in an endo-type manner, the final product of which is an unsaturated hyaluronic acid disaccharide.

6. The hyaluronidase HylC of claim 3, wherein the hyaluronidase HylC is capable of specifically degrading hyaluronic acid.

7. Use of the hyaluronidase HylC of any one of claims 3 to 6 for the preparation of recombinant hyaluronidase.

8. Use of the hyaluronidase HylC of any one of claims 3 to 6 in the preparation of a formulation for the production of unsaturated hyaluronic acid oligosaccharides.

9. Use of the hyaluronidase HylC of any one of claims 3 to 6 in the preparation of a drug diffusion agent for promoting subcutaneous diffusion.

10. The use of hyaluronidase HylC according to claim 9 in the preparation of a medicament spreading agent for promoting subcutaneous spreading, wherein the unit of activity of the hyaluronidase HylC is 0.01 to 0.02U.