CN110551832A - Primer pair, kit and detection method for detecting genotype of chicken s14916609 locus - Google Patents
Primer pair, kit and detection method for detecting genotype of chicken s14916609 locus Download PDFInfo
- Publication number
- CN110551832A CN110551832A CN201910992269.5A CN201910992269A CN110551832A CN 110551832 A CN110551832 A CN 110551832A CN 201910992269 A CN201910992269 A CN 201910992269A CN 110551832 A CN110551832 A CN 110551832A
- Authority
- CN
- China
- Prior art keywords
- chicken
- genotype
- electrophoresis
- enzyme digestion
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer pair, a kit and a detection method for detecting the genotype of a chicken s14916609 locus, belonging to the technical field of genetic engineering, wherein the primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2. The rs14916609 polymorphism is closely related to the egg weight character of the chicken, can be used as a molecular marker for screening the egg weight character of the chicken, can greatly reduce the cost of molecular breeding, and lays a foundation for accelerating the molecular breeding for improving the egg weight of the laying hens. The kit and the detection method provided by the invention have the advantages of simple operation, high accuracy, no miscellaneous belts, short time consumption of only 2-3 h, low cost, capability of realizing automatic detection, convenience for breeding chicken and great play in breeding chicken.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a primer pair, a kit and a detection method for detecting the genotype of a chicken s14916609 locus.
background
Egg Weight (EW) is an important economic property in the laying hen feeding process, is directly related to economic benefits of laying hen breeding, and is a property of great concern to laying hen breeders and breeders for a long time. The main income of the layer chicken breeder is the selling income of eggs, and the selling of the eggs is based on weight, so the weight of the eggs directly influences the income of the breeder, the weight of the eggs does not reach the standard, and the economic benefit of layer chicken breeding is greatly reduced. Consumers in different regions have different preferences on egg weight, some regions like eggs with larger egg weight, and some regions like small eggs, so the egg weight also has an influence on the popularity of the eggs in the market, and further influences the sales volume of products in farms. The egg weight also has an important influence on the quality of the eggshell, the eggshell strength is the egg quality which is most concerned by breeders at present, because the eggshell is too weak, the egg is easy to be damaged, the damaged egg in the processes of collection, storage, transportation and sale cannot be sold, meanwhile, other peripheral eggs can be influenced, the influence on the economic benefit is huge, according to the research result of predecessors, the thinner the eggshell thickness of the egg with the larger egg weight is, the weaker the eggshell strength is, the easier the egg is to be damaged, therefore, the influence on the economic benefit of breeders is very large by how to control the egg weight, and the eggshell strength is an important content in the breeding and breeding processes of laying hens.
For a long time, a laying hen breeder does not have an effective control method for egg weight, breeding is always selected through the phenotype of the egg weight, but the effect is not ideal, and the genetic progress is slow.
Disclosure of Invention
In view of the above, the present invention aims to provide a primer pair, a kit and a detection method for detecting the genotype of the chicken s14916609 locus.
In order to achieve the above purpose, the invention provides the following technical scheme:
The invention provides a primer pair for detecting the genotype of a chicken s14916609 locus, which comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2.
The invention also provides a kit for detecting the genotype of the chicken s14916609 locus, which comprises the primer pair and the restriction endonuclease BsrG I in the technical scheme.
the invention also provides a method for detecting the genotype of the chicken s14916609 locus based on the primer pair or the kit in the technical scheme, which comprises the following steps:
1) Extracting the genome DNA of the chicken, and carrying out PCR amplification by using the primer pair in the technical scheme by taking the genome DNA as a template to obtain an amplification product;
2) Carrying out enzyme digestion on the amplification product obtained in the step 1) by using restriction endonuclease BsrG I to obtain an enzyme digestion product;
3) Performing agarose gel electrophoresis on the enzyme digestion product obtained in the step 2), wherein when 1 bright band is displayed after electrophoresis, the genotype of the chicken s14916609 locus is GG;
When 2 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AA;
When 3 bright bands are displayed after electrophoresis, the chicken s14916609 locus is AG.
preferably, the chicken of step 1) comprises a green-shell laying chicken.
preferably, the system used in the PCR amplification of step 1) comprises 5ng of genomic DNA, 0.3. mu.l of upstream and downstream primers with a concentration of 10pmol/L and 7.5. mu.l of Taq Mix, respectively, and ddH 2 O is supplemented to 15. mu.l.
preferably, the step 1) PCR amplification procedure comprises: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 60 ℃ for 30s and 72 ℃ for 30 s; 10min at 72 ℃.
Preferably, the system cleaved in step 2) comprises 4. mu.l of amplification product at a concentration of 10pmol/L, 1. mu.l of 10 Xcleavage buffer, 0.4. mu.l of restriction endonuclease BsrG I, and 4.6. mu.l of ddH 2 O per 10. mu.l.
Preferably, the enzyme digestion conditions include: and (3) carrying out enzyme digestion for 50-70 min at 35-42 ℃.
preferably, in the step 3), when 1 bright band is displayed after electrophoresis, the length of the enzyme digestion product is 185 bp;
When 2 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp and 128bp respectively;
when 3 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp, 128bp and 185bp respectively.
preferably, the egg weight of genotype GG is greater than that of genotype AG, and the egg weight of genotype AG is greater than that of genotype AA.
The invention provides a primer pair, a kit and a detection method for detecting the genotype of a chicken s14916609 locus, the primer pair provided by the invention is utilized to carry out PCR amplification on chicken genome DNA, an obtained amplification product is subjected to restriction endonuclease BsrG I enzyme digestion and agarose gel electrophoresis, the genotype is detected by displaying the number of bright bands, and when 1 bright band is displayed after electrophoresis, the genotype of the chicken s14916609 locus is GG; when 2 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AA; when 3 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AG, wherein the egg weight of genotype GG is greater than that of genotype AG, and the egg weight of genotype AG is greater than that of genotype AA.
Drawings
FIG. 1 shows the results of electrophoresis of the cleavage products of the examples.
Detailed Description
the invention provides a primer pair for detecting the genotype of a chicken s14916609 locus, which comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and the specific sequence is shown as follows:
5’-tcttccctgcgtattttgcc-3’；
The nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and is specifically shown as follows:
5’-caacactgaatgctgggacc-3’。
The invention preferably designs a primer according to a sequence nearby rs14916609, wherein the nucleotide sequence of the sequence nearby rs14916609 is shown as SEQ ID No.3, and is specifically shown as follows:
tcttccctgcgtattttgcccataggcaccaaattgtgctttaaaactgtattaaccctgtacaggaaagacgatgatcatatacaaattccacaaaatttggcaagcttctcccagctccacttttaatacaaacacagactcgatatggagcacaggccacaaggtcccagcattcagtgttg。
The invention also provides a kit for detecting the genotype of the chicken s14916609 locus, which comprises the primer pair and the restriction endonuclease BsrG I in the technical scheme.
The placing amount of the primer pair and the restriction endonuclease in the kit is not particularly limited, and the placing amount of the reagent in the conventional kit is adopted.
In the present invention, the kit preferably further comprises TaqMix and 10 × enzyme digestion buffer, and the amount of the above-mentioned reagent to be placed is not particularly limited.
the invention also provides a method for detecting the genotype of the chicken s14916609 locus based on the primer pair or the kit in the technical scheme, which comprises the following steps:
1) Extracting the genome DNA of the chicken, and carrying out PCR amplification by using the primer pair in the technical scheme by taking the genome DNA as a template to obtain an amplification product;
2) Carrying out enzyme digestion on the amplification product obtained in the step 1) by using restriction endonuclease BsrG I to obtain an enzyme digestion product;
3) performing agarose gel electrophoresis on the enzyme digestion product obtained in the step 2), wherein when 1 bright band is displayed after electrophoresis, the genotype of the chicken s14916609 locus is GG;
When 2 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AA;
When 3 bright bands are displayed after electrophoresis, the chicken s14916609 locus is AG.
The invention extracts the chicken genome DNA, and PCR amplification is carried out by taking the genome DNA as a template and using the primer pair of the technical scheme to obtain an amplification product.
In the present invention, the chicken is preferably a green-shell laying hen. The method for extracting the chicken genome DNA is not particularly limited, and the method can be used for extracting the poultry genome DNA by adopting a conventional extraction method.
In the present invention, the system used for PCR amplification preferably comprises 5ng genomic DNA, 0.3. mu.l Taq Mix 7.5. mu.l upstream and downstream primers with a concentration of 10pmol/L, respectively, and ddH 2 O is supplemented to 15. mu.l. in the present invention, the PCR amplification procedure preferably comprises 35 cycles of 95 ℃ for 5min, 95 ℃ for 20s, 60 ℃ for 30s, 72 ℃ for 30s, and 72 ℃ for 10min, the source of the Taq Mix is not particularly limited, and a conventional commercially available product can be used.
The invention uses restriction endonuclease BsrG I to carry out enzyme digestion on the obtained amplification product to obtain an enzyme digestion product.
In the invention, each 10 mu L of the enzyme digestion system preferably comprises 4 mu L of an amplification product with the concentration of 10pmol/L, 1 mu L of 10 Xenzyme digestion buffer solution, 0.4 mu L of restriction endonuclease BsrG I and 4.6 mu L of ddH 2 O, wherein the enzyme digestion condition preferably comprises 50-70 min of enzyme digestion at 35-42 ℃.
in the present invention, the restriction sequence of the restriction endonuclease BsrG I is as follows:
5 '-T ↓: GTACA-3' and 3 '-ACATG ≠ T-5', in which the arrow indicates the site of enzyme digestion.
The obtained enzyme digestion product is subjected to agarose gel electrophoresis, and when 1 bright band is displayed after electrophoresis, the genotype of the chicken s14916609 locus is GG; when 2 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AA; when 3 bright bands are displayed after electrophoresis, the chicken s14916609 locus is AG.
In the present invention, the agarose gel electrophoresis is preferably 1.5% agarose gel electrophoresis, the voltage of the agarose gel electrophoresis is preferably 8V/cm, and the time of the agarose gel electrophoresis is preferably 30 cm. And after the agarose gel electrophoresis is finished, observing by using a gel imaging system.
In the invention, when 1 bright band is displayed after electrophoresis, the length of the enzyme digestion product is 185 bp; when 2 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp and 128bp respectively; when 3 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp, 128bp and 185bp respectively. In the present invention, the genotype GG mutant homozygote is heterozygous for the genotype AG, the genotype AA is wild homozygote, the egg weight of the genotype GG is preferably larger than that of the genotype AG, and the egg weight of the genotype AG is preferably larger than that of the genotype AA.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
example 1
Establishment of method for detecting egg weight behavior of green-shell laying hens
determination of rs14916609 polymorphic site
1. PCR amplification
Selecting a pure green-shell layer chicken as an experimental material, designing a primer according to a sequence near rs14916609, and enabling an amplified target fragment to contain rs14916609 deoxyribonucleotide, wherein the sequence of the primer is as follows:
An upstream primer: 5'-TCTTCCCTGCGTATTTTGCC-3' (SEQ ID No. 1);
A downstream primer: 5'-CAACACTGAATGCTGGGACC-3' (SEQ ID No. 2).
taking pure genome DNA of the green-shell layer chicken as a template, and carrying out PCR amplification by using an upstream primer and a downstream primer. The amplification system is shown in table 1:
TABLE 1 PCR amplification System
| Chicken genomic DNA | 50ng |
| upstream and downstream primers (10pmol/L) | 0.3. mu.L each |
| Taq Mix | 7.5μL |
| By ddH2O | Make up the reaction to 15. mu.L |
The PCR reaction conditions are as follows: denaturation at 95 deg.C for 5 min; the cycle program is denaturation at 95 ℃ for 20s, annealing at 60 ℃ for 30s and extension at 72 ℃ for 30s, and the cycle is 35; finally, extension is carried out for 10min at 72 ℃.
2. RFLP analysis
The PCR amplification product in step 1 was digested with the restriction enzyme BsrG I. The restriction enzyme sequence of BsrGI is shown in Table 2 (the position indicated by the arrow is the restriction enzyme site):
TABLE 2 cleavage sequences
| 5’-T↓GTACA-3’ |
| 3’-ACATG↑T-5’ |
the digestion reaction system is shown in Table 3:
TABLE 3 digestion system
| PCR reaction mixture | 4μl |
| 10 Xenzyme digestion buffer | 1μl |
| endonuclease AcuI (10U/. mu.l) | 0.4μl |
| ddH2O | 4.6μl |
| Total volume | 10μl |
Incubate in a constant temperature water bath at 37 ℃ for 1 hour.
The cleaved product was subjected to 1.5% agarose gel electrophoresis (voltage 8V/cm, time 30 min). The results are shown in FIG. 1, observed using a gel imaging system.
As can be seen from FIG. 1, the enzyme-digested product shows 3 band types, and a part of the sample shows two electrophoresis bands, with sequence lengths of 57bp and 128bp, respectively; part of the sample is displayed as an electrophoresis strip, and the sequence length is 185 bp; the remaining samples are shown as three electrophoretic bands with sequence lengths of 57bp, 128bp and 185bp, respectively.
3. Clone sequencing and sequence analysis
according to the results of PCR-RFLP analysis, PCR amplification products of samples showing different electrophoresis bands were recovered and purified by an agarose gel recovery kit (Tiangen Biochemical technology Co., Ltd.), the recovered DNA fragments were ligated to a vector pMD-19T (TAKARA Co., Ltd.), the ligation products were transformed into E.coli DH5 α competent cells by the method of Cohen et al (Proc Natl Acad Sci, 69:2110), and positive clones were selected based on the carbenicillin resistance marker on the vector to obtain recombinant plasmids containing the recovered fragments. The T7 and SP6 promoter sequences on the recombinant plasmid vector are used as primers to carry out nucleotide sequence determination on the recombinant plasmid vector, and sequencing results show that the amplified fragments of different samples are all 185bp in length, and only one deoxyribonucleotide difference (A/G) exists.
According to the sequencing result and the PCR-RFLP result, the genotype is defined as follows:
If the allele of the site is A, the homozygous genotype is AA, PCR-RFLP detection is two electrophoresis bands, and the sequence lengths are 57bp and 128bp respectively;
if the allele of the locus is G, the homozygote genotype is GG, PCR-RFLP detection is an electrophoresis band, and the sequence length is 185 bp;
the locus heterozygote genotype is AG, PCR-RFLP detection is three electrophoresis bands, and the sequence lengths are 57bp, 128bp and 185bp respectively.
Example 2
Preparation of green-shell egg weight detection kit
the kit for detecting the egg weight behavior allele of the green-shell laying hens comprises: a pair of primers (SEQ ID Nos. 1-2); restriction endonuclease BsrGI; all reagents in the PCR reaction system in step 1 and all reagents in the enzyme reaction system in step 2 of example 1.
Example 3
Correlation analysis of chicken genotype and egg weight
detection was performed using the green shell egg weight detection kit of example 2. Using the genomic DNA of the chicken to be detected as a template, PCR amplification and RFLP analysis were performed according to example 1, and the correlation between the genotype of the chicken and the egg weight trait was analyzed.
The association of chicken genotype with egg weight trait is shown in table 4:
TABLE 4 correlation of rs14916609 locus genotype with egg weight trait
Among the 215 tested chickens, 88 AA genotypes, 101 AG genotypes and 26 GG genotypes had significant differences between the AA and GG egg weight traits.
the embodiment can show that the rs14916609 polymorphism is closely related to the egg weight character of the chicken, can be used as a molecular marker for screening the egg weight character of the chicken, can greatly reduce the cost of molecular breeding, and lays a foundation for accelerating the molecular breeding for improving the egg weight of the laying hens. The kit and the detection method provided by the invention have the advantages of simple operation, high accuracy, no miscellaneous belts, short time consumption of only 2-3 h, low cost, capability of realizing automatic detection, convenience for breeding chicken and great play in breeding chicken.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> primer pair, kit and detection method for detecting genotype of chicken s14916609 locus
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 1
tcttccctgc gtattttgcc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 2
caacactgaa tgctgggacc 20
<210> 3
<211> 185
<212> DNA
<213> Artificial Sequence
<400> 3
tcttccctgc gtattttgcc cataggcacc aaattgtgct ttaaaactgt attaaccctg 60
tacaggaaag acgatgatca tatacaaatt ccacaaaatt tggcaagctt ctcccagctc 120
cacttttaat acaaacacag actcgatatg gagcacaggc cacaaggtcc cagcattcag 180
tgttg 185
Claims (10)
1. A primer pair for detecting the genotype of a chicken s14916609 locus is characterized by comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2.
2. A kit for detecting the genotype of a chicken s14916609 site, which comprises the primer pair of claim 1 and a restriction endonuclease BsrGI.
3. A method for detecting the genotype of the chicken s14916609 locus based on the primer pair of claim 1 or the kit of claim 2, which comprises the following steps:
1) Extracting chicken genome DNA, and carrying out PCR amplification by using the primer pair of claim 1 by using the genome DNA as a template to obtain an amplification product;
2) carrying out enzyme digestion on the amplification product obtained in the step 1) by using restriction endonuclease BsrGI to obtain an enzyme digestion product;
3) Performing agarose gel electrophoresis on the enzyme digestion product obtained in the step 2), wherein when 1 bright band is displayed after electrophoresis, the genotype of the chicken s14916609 locus is GG;
When 2 bright bands are displayed after electrophoresis, the genotype of the chicken s14916609 site is AA;
when 3 bright bands are displayed after electrophoresis, the chicken s14916609 locus is AG.
4. The detection method according to claim 3, wherein the chicken of step 1) comprises a green-shell laying chicken.
5. the detection method according to claim 3, wherein the PCR amplification in step 1) is performed using a system comprising 5ng of genomic DNA, 0.3. mu.l of upstream and downstream primers at a concentration of 10pmol/L, and 7.5. mu.l of TaqMix, and ddH 2 O supplemented to 15. mu.l per 15. mu.l.
6. The detection method according to claim 3, wherein the PCR amplification procedure of step 1) comprises: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 60 ℃ for 30s and 72 ℃ for 30 s; 10min at 72 ℃.
7. The detection method according to claim 3, wherein the enzyme-digested system of step 2) comprises 4. mu.l of the amplification product at a concentration of 10pmol/L, 1. mu.l of 10 Xdigestion buffer, 0.4. mu.l of restriction endonuclease BsrG I, and 4.6. mu.l of ddH 2 O per 10. mu.l.
8. The detection method according to claim 3 or 7, wherein the enzyme digestion conditions comprise: and (3) carrying out enzyme digestion for 50-70 min at 35-42 ℃.
9. The detection method according to claim 3, wherein in the step 3), when 1 bright band is displayed after electrophoresis, the length of the enzyme digestion product is 185 bp;
When 2 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp and 128bp respectively;
When 3 bright bands are displayed after electrophoresis, the lengths of the enzyme digestion products are 57bp, 128bp and 185bp respectively.
10. The assay of claim 3 wherein the eggs of genotype GG are heavier than genotype AG and the eggs of genotype AG are heavier than genotype AA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910992269.5A CN110551832B (en) | 2019-10-18 | 2019-10-18 | Primer pair, kit and detection method for detecting genotype of rs14916609 locus of chicken |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910992269.5A CN110551832B (en) | 2019-10-18 | 2019-10-18 | Primer pair, kit and detection method for detecting genotype of rs14916609 locus of chicken |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110551832A true CN110551832A (en) | 2019-12-10 |
| CN110551832B CN110551832B (en) | 2022-04-26 |
Family
ID=68743051
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910992269.5A Active CN110551832B (en) | 2019-10-18 | 2019-10-18 | Primer pair, kit and detection method for detecting genotype of rs14916609 locus of chicken |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110551832B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103120143A (en) * | 2013-01-23 | 2013-05-29 | 河南农业大学 | Cultivating method of laying hen with low egg yolk cholesterol content |
| JP2014050329A (en) * | 2012-09-05 | 2014-03-20 | National Agriculture & Food Research Organization | Method of determining chicken |
| CN103789307A (en) * | 2014-01-25 | 2014-05-14 | 山东省农业科学院家禽研究所 | Molecular marker relevant to reproductive performance of chicken and application of molecular marker in breeding |
| CN104975097A (en) * | 2015-07-17 | 2015-10-14 | 上海市农业科学院 | Kit for green-eggshell chicken feather pecking related gene detection and implementation method thereof |
| CN105349637A (en) * | 2015-10-26 | 2016-02-24 | 中国农业大学 | SNP molecular marker related to egg weight and application of SNP molecular marker |
-
2019
- 2019-10-18 CN CN201910992269.5A patent/CN110551832B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2014050329A (en) * | 2012-09-05 | 2014-03-20 | National Agriculture & Food Research Organization | Method of determining chicken |
| CN103120143A (en) * | 2013-01-23 | 2013-05-29 | 河南农业大学 | Cultivating method of laying hen with low egg yolk cholesterol content |
| CN103789307A (en) * | 2014-01-25 | 2014-05-14 | 山东省农业科学院家禽研究所 | Molecular marker relevant to reproductive performance of chicken and application of molecular marker in breeding |
| CN104975097A (en) * | 2015-07-17 | 2015-10-14 | 上海市农业科学院 | Kit for green-eggshell chicken feather pecking related gene detection and implementation method thereof |
| CN105349637A (en) * | 2015-10-26 | 2016-02-24 | 中国农业大学 | SNP molecular marker related to egg weight and application of SNP molecular marker |
Non-Patent Citations (3)
| Title |
|---|
| GUOQIANG YI ET AL.: ""Genome-wide association study dissects genetic architecture underlying longitudinal egg weights in chickens"", 《BMC GENOMICS》 * |
| LAURA MACDOUGALL ET AL.: ""Spread of Cryptococcus gattii in British Columbia, Canada, and detection in the Pacific Northwest, USA"", 《EMERGING INFECTIOUS DISEASES》 * |
| 邓春青: ""四个HBV感染相关候选基因的SNP关联研究及初步功能鉴定"", 《万方学位论文》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110551832B (en) | 2022-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108220408B (en) | Grain-saving green-shin recessive white feather broiler new strain breeding method | |
| CN110273010B (en) | Identification and application method of MC1R gene haplotype | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN109811063B (en) | SNP molecular marker related to pig growth speed and application thereof | |
| Song et al. | DNA polymorphisms of the Hu sheep melanocortin-4 receptor gene associated with birth weight and 45-day weaning weight | |
| CN110904266B (en) | Identification of maize stalk lodging resistance QTL and development and application of molecular marker | |
| CN114317781B (en) | Molecular marker related to long and short velvet characters of pigeons and application of molecular marker | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN111154887A (en) | Goat hair color related molecular marking method and application thereof | |
| CN113430277A (en) | Primer group for identifying sex-linked dwarf gene and application thereof | |
| CN111073983B (en) | SNP marker related to identification of northern subspecies and Florida subspecies of largemouth bass and application thereof | |
| CN104975097A (en) | Kit for green-eggshell chicken feather pecking related gene detection and implementation method thereof | |
| CN112899372A (en) | HSD3B1 gene SNP molecular marker related to laying age and egg yield of chicken and application thereof | |
| Kim et al. | Development of polymorphic microsatellite markers suitable for genetic linkage mapping of olive flounder Paralichthys olivaceus | |
| CN110551832B (en) | Primer pair, kit and detection method for detecting genotype of rs14916609 locus of chicken | |
| JP7101961B2 (en) | Amberjack sex identification method | |
| CN111197103A (en) | Cotton leaf honey gland related molecular marker InDel-GaNEC1, primer pair and application thereof | |
| CN116516018A (en) | Structural variation molecular marker and specific primer related to body color of Oujiang color carp and application of structural variation molecular marker and specific primer | |
| CN111378765B (en) | SNP (Single nucleotide polymorphism) marker of fast-growing grass carp individual and application of SNP marker | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda | |
| CN112176075A (en) | Primer for identifying green-shell laying hen genotype by using FRET probe and application | |
| CN112831503B (en) | Rice sheath blight resistance gene SBR11 and molecular marker and application thereof | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| CN109468400B (en) | Rice blast resistance gene Pi36 codominant molecular marker and application thereof | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |