CN110526968A

CN110526968A - A kind of Staphylococcal enterotoxin B nano antibody B7, application and kit

Info

Publication number: CN110526968A
Application number: CN201910764180.3A
Authority: CN
Inventors: 季艳伟; 郭鹏利; 王建龙; 王妍入; 陈利莉; 路云龙; 李想
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2019-08-19
Filing date: 2019-08-19
Publication date: 2019-12-03
Anticipated expiration: 2039-08-19
Also published as: CN110526968B

Abstract

The invention discloses a kind of Staphylococcal enterotoxin B nano antibody B7, application and kits.The nano antibody that the present invention obtains have relative molecular mass is small, stability is strong, yield is high, can specific recognition SEB, it is wider compared with conventional monoclonal antibody purposes, specificity it is stronger.The invention discloses this nano antibody and the gene order of the nano antibody is encoded, the method for the nano antibody is produced and applies the kit of the antibody.The nano antibody that the present invention obtains can avoid in conjunction with staphylococcus aureus surface albumin A, show compared with high specific, with stability is good, molecular weight is small and can be mass-produced.

Description

A kind of Staphylococcal enterotoxin B nano antibody B7, application and kit

Technical field

The invention belongs to field of biotechnology, and in particular to a kind of Staphylococcal enterotoxin B nano antibody B7, answer With and reagent.

Background technique

Staphylococcus aureus (Staphylococcus aureus, SA) is a kind of common food-borne pathogens, by it Caused sitotoxismus height in gram-positive bacteria ranks first, and pathogenecity depends primarily on the enterotoxin of bacterium generation (Staphylococcal enterotoxins, SEs).SEs is poison outside the extracellular soluble generated by staphylococcus aureus secretion Cellulose protein, structure is similar, and molecular weight is 27.5~30kDa, and thermal stability is good, boils 30min without being destroyed through 100 DEG C, Therefore, the food of staphylococcus aureus pollution is after generally heating, although microorganism can be killed, it is generated Enterotoxin is still active and pathogenicity.By serological classification, mainly there are the serotypes such as A, B, Cs, D, E, wherein SEB is Virulence is most strong in SEs family, most stable to heat, is primarily present in meat, in the higher animal food of the protein contents such as cream. Susceptible population will be made nausea occur when SEB intake reaches 20~100ng, vomitted, the poisoning symptoms such as abdominal pain and diarrhea, because This, is particularly important the detection of SEB in food.However, there are two main problems for the detection of SEB: food matrix first Ingredient it is complex, containing multiple proteins, lipid and other compounds, the accurate detection of the presence of these ingredients to SEB Cause interference；Secondly, SA often only generates this sensitivity to detection method of trace or micro SEB (ng/g) in food Propose higher requirement.Realize to be always one challenging to the quantitative detection of enterotoxin in food matrix Business.Currently, immunological detection method is because having the characteristics that quick, high specificity, easy to operate, result are easy to judge to be answered extensively For in the quick detection of SEs.Wherein immunological detection is SEs routine because having the characteristics that easy to operate, detection speed is fast Most popular method and the more mature detection method of development in screening detection, principle are that two of two identification surfaces SEB are anti- The antibody put in situ forms interlayer structure in the presence of SEB, by the marker on detection antibody to interpretation testing result. Currently, the staphylococcus aureus of research preparation both at home and abroad and its enterotoxin antibody are the Anti-TNF-α for identifying its surface antigen Body or monoclonal antibody, but the preparation of conventional monoclonal antibody is taken time and effort and low output, and staphylococcal protein A (spA) Interference be to SEs based on sixty-four dollar question in immunology detection.SpA is staphylococcus aureus in cell surface display Protein, also discharged in outside, the end Fc of the strong all IgG generated in conjunction with mammal, therefore, for detecting golden yellow The antibody of staphylococcal entotoxin can generate false positive results, keep method accuracy poor, to affect application value.

Nano antibody technology is to research and develop to obtain with Protocols in Molecular Biology on the basis of conventional antibodies, be at present Know the antibody molecule of the smallest combinable antigen.Initially there is Belgian scientist Hamers.R to find in camel blood, commonly The antibody protein novel antibodies natural deletions light chain that is formed, and found from camel blood by two heavy chains and two light chains and The heavy chain antibody of heavy chain constant region 1 (CH1) clones its variable region and obtains the single domain antibody being only made of a heavy chain variable region, Referred to as single domain heavy chain antibody (Variable domain of heavy chain of heavy-chain antibody, VHH), Also known as nano antibody (nanobody, Nb).Nano antibody also has following excellent compared with polyclonal antibody and monoclonal antibody Point:

1) without Fc recognition site, it can avoid false positive issue caused in conjunction with protein A；

2) there is the longer area CDR3, and pairs of complementary relationship is not present in the area CDRs and other structural domains of itself, therefore With more flexibilities and convex surface property, small size (12~15kD, 2 × 2 × 4nm) in addition, can its preferably and antigenic surface Crack and lacuna combine, so that the antigentic specificity and affinity of nano antibody are improved, in nanomole to picomolar range Inside there is good affinity.In identical detection range, the affinity of monovalent nano antibody is the two of common bivalent antibody Times.Especially for the more complex bacterium of surface texture or high molecular weight protein etc., nano antibody is beneficial to overcome surface texture Steric effect and surface antigen identify.

3) nano antibody stability height, good water solubility, can in microflora largely synthesis expression, be nano antibody it is low Cost, efficient production create condition.

4) C-terminal (C-terminus) of nano antibody is located at the opposite positions of antigen binding site, is easy to be oriented function Energyization modification, and then it is oriented modification.

For the nano antibody of SEB, there is not been reported at present, thus for SEB high-affinity, Gao Teyi, at low cost receive The exploitation of meter Kang Ti is conducive to the sensitivity and specificity for further increasing SEB immunology detection, to reach wanting for on-site test It asks.

Summary of the invention

For above-mentioned prior art deficiency and defect, the object of the present invention is to provide a kind of staphylococcus aureus intestines Toxin B nano antibody B7, application and kit, it is poor to solve antibody specificity in the prior art, and detection method is at high cost, operation Complicated technical problem.

In order to achieve the above object, the application, which adopts the following technical scheme that, is achieved:

A kind of Staphylococcal enterotoxin B nano antibody B7 includes framework region FR and complementary determining region CDR, institute The amino acid sequence that framework region FR includes FR1~FR4 is stated,

Wherein the amino acid sequence of FR1 is as shown in SEQ ID NO.:2, the amino acid sequence of FR2 such as SEQ ID NO.:4 institute Show, the amino acid sequence of FR3 is as shown in SEQ ID NO.:6, and the amino acid sequence of FR4 is as shown in SEQ ID NO.:8；

The complementary determining region CDR includes the amino acid sequence of CDR1~CDR3,

Wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO.:3, the amino acid sequence of CDR2 such as SEQ ID NO.:5 Shown, the amino acid sequence of CDR3 is as shown in SEQ ID NO.:7.

A kind of amino acid sequence such as SEQ of Staphylococcal enterotoxin B nano antibody B7, the nano antibody B7 Shown in ID NO.:1.

The nucleotide sequence such as SEQ ID NO.:9 institute of the coding Staphylococcal enterotoxin B nano antibody B7 Show.

A kind of preparation method of Staphylococcal enterotoxin B nano antibody B1, which is characterized in that be immunized in hunchbacked source Screening can tie the nano antibody that specificity is closed with target molecule SEB in nano antibody library, and pass through Phage amplification or genetic engineering It is prepared by the mode of recombinant expression；

The Phage amplification is will to show the bacteriophage for having anti-SEB nano antibody, by way of biology amplification, breeding Production shows the bacteriophage particles for having SEB nano antibody；

The mode of the genetic engineering recombinant expression refers to the gene of nano antibody, by being cloned into expression vector, with The form of protein expression carries out the preparation of nano antibody.

The Staphylococcal enterotoxin B nano antibody B7 is examined in Staphylococcal enterotoxin B immunology Application in survey.

The Staphylococcal enterotoxin B nano antibody B7 is used to prepare Staphylococcal enterotoxin B and exempts from The application of epidemic disease detection kit.

A kind of Staphylococcal enterotoxin B immunity detection reagent, the kit carry the golden yellow Staphylococcal enterotoxin B nano antibody B7.

Compared with prior art, the present invention beneficial has the technical effect that

(I) nano antibody that the present invention obtains has relative molecular mass is small, stability is strong, yield is high, energy is specific to know Other SEB, wider compared with conventional monoclonal antibody purposes, specificity is stronger.

(II) nano antibody that obtains of the present invention can avoid in conjunction with staphylococcus aureus surface albumin A, show compared with High specific, with stability is good, molecular weight is small and can be mass-produced.

(III) it is at high cost, complicated for operation, poor specificity can to solve existing detection method for the nano antibody that the present invention obtains Problem has broad application prospects

Detailed description of the invention

Fig. 1 is for elutriation positive colony Salmonella qualification result, wherein clone's B7OD value is maximum；

Fig. 2 is the SDS-PAGE figure of nano antibody B7；

Fig. 3 is the Salmonella standard curve to be established with nano antibody B7, and the range of linearity is 7.81~1000ng/mL, Linear relationship is R²=0.99, lowest detection is limited to 3.26ng/mL；

Fig. 4 is the resistance to acid and alkali analysis of nano antibody B7；

Fig. 5 is the thermal stability analysis of nano antibody B7；

Fig. 6 is the specificity analysis of nano antibody B7

Explanation is further explained in detail to particular content of the invention below in conjunction with drawings and examples.

Specific embodiment

Specific embodiments of the present invention are given below, it should be noted that the invention is not limited to implement in detail below Example, all equivalent transformations made on the basis of the technical solutions of the present application each fall within protection scope of the present invention.

Alashan Bactrian Camel is immunized using SEB in the present invention, extracts from the peripheral blood lymphocytes of immunized two-humped camel Its RNA, specific amplification camel single-chain antibody variable region gene, to construct nano antibody gene pool, analyze its storage capacity and Diversity.Pass through the nanometer that with display technique of bacteriophage, screening can be specifically bound with target molecule (SEB) from nano antibody library Antibody constructs nano antibody B7 expression vector, carries out prokaryotic expression, purifying and identification to it to get anti-to required nanometer Body B7.ELISA detection method is established using the nano antibody that elutriation obtains.Nano antibody prepared by the present invention is as a kind of novel Genetic engineering antibody, due to its unique structure feature, antigen binding ability is strong, can be used for fast and accurately SEB detection.

Two-humped camel is immunized using SEB in the present invention, is then established using the two-humped camel peripheral blood lymphocytes for golden yellow The phage display nano antibody library of color staphylococcal enterotoxin A.Then staphylococcus aureus toxin A is inhaled in test It is attached on ELISA Plate, using the nano antibody library of display technique of bacteriophage screening immunity, have been directed to one kind to obtain The specific nano antibody B7 of staphylococcus aureus toxin A, with amino acid sequence described in SEQ ID NO.:1.

Nano antibody mentioned by the present invention includes that four framework regions (Framework region, FR) and three complementations are determined Determine area (Complementarity-determining region, CDR).Wherein, framework region (FR1~FR4) is respectively selected from SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8, complementary determining region are respectively (CDR1~CDR3) It is respectively selected from SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.:7.Frame plot structure is relatively conservative, mainly plays dimension Hold the effect of protein structure；Complementary determining region structure is relatively diversified, is mainly responsible for the identification of antibody.

The invention further relates to the nucleotide for encoding the nano antibody amino acid sequence, sequence is SEQ ID NO.:9.

The nano antibody that the present invention refers to can be carried out a large amount of by way of Phage amplification or genetic engineering recombinant expression Preparation.Phage amplification, which refers to, to show the bacteriophage for having the nano antibody, by way of biology amplification, mass propagation production Show the bacteriophage particles for having the nano antibody.The mode of genetic engineering recombinant expression, which refers to, will encode the base of the nano antibody Cause carries out a large amount of preparations of the nano antibody by being cloned into expression vector in the form of protein expression.

The invention further relates to application of the nano antibody in immunology detection.The type of immunology detection includes enzyme Join the immune credits based on Ag-Ab specific reaction such as immuno absorbence detection, colloidal gold immunochromatographimethod, immunodotting hybridization Analyse detection type.

Nano antibody of the present invention is in use, can have nano antibody by the displaying that Phage amplification obtains Bacteriophage particles are directly used in analysis detection, it is of course also possible to by nano antibody after prokaryotes or eucaryote expression Immunology detection analysis is carried out in the form of albumen.

Amino acid sequence of the present invention can be used as precursor, is transformed by random or site-directed mutagenesis technique, energy Enough obtain property (affinity, specificity and stability etc.) better mutant.

The building of embodiment 1, hunchbacked source nano antibody phage display library

1) two-humped camel is immune

Using SEB as immunogene using bull Alashan Bactrian Camel is immunized in a manner of subcutaneous multi-point injection, five are carried out altogether Wheel is immune.Initial immunity is using Freund's complete adjuvant (Freund ' s complete adjuvant) and isometric immunizing antigen It is injected after emulsification, immunizing dose is 100 μ g/.Booster immunization is primary every two weeks backward, using incomplete Freund's adjuvant It is injected after (Freund ' s incomplete adjuvant) and isometric immunogene emulsification, each immunizing dose is 50 μ g/ is only.The 7th day after 5th booster immunization, two-humped camel peripheral blood is taken, for constructing nano antibody phage display library.

2) separation of lymphocyte

7th day after last time is immune, 200mL peripheral blood is acquired with Plastic Blood Bags (containing anti-coagulants), before use With isometric PBS dilute blood sample.Ficoll-Paque PLUS lymphocyte separation medium is balanced to room temperature, is drawn 15mL is addedSeparation of lymphocytes pipe (band porous barrier), is centrifuged with horizontal rotor centrifuge 1000g room temperature 30s makes lymphocyte separation medium be located just at sieve or less.It is thin that lymph is added after the blood sample diluted is balanced to room temperature Born of the same parents' separating pipe, 30mL/ branch are centrifuged 10min with horizontal rotor centrifuge 1000g room temperature, and centrifuge braking acceleration is adjusted to 0.From Red blood cell is located at separation of lymphocytes bottom of the tube after the heart, and top layer is blood plasma, blood plasma and white clear lymphocyte separation medium it Between one layer of ring to fill milky white color substance be lymphocyte, carefully remove upper plasma with dropper, until apart from cellular layer 5~ 10mm.Lymphocyte is collected into another clean 50mL centrifuge tube with dropper, and the PBS of the ice bath of at least 10 times volumes is added, After being mixed by inversion, 250g, 4 DEG C of centrifugation 10min.It discards supernatant, cell, 250g, 4 DEG C of centrifugations is resuspended with the PBS of 45mL ice bath 10min washs cell twice with same method again.After last time is centrifuged, cell is resuspended with the PBS of 10mL ice bath, it is thin with blood Born of the same parents' tally counts, and is sub-packed in 1.5mL centrifuge tube after counting, 1 × 10⁷A cell/, 250g, 4 DEG C of centrifugation 10min, Supernatant is abandoned, cell precipitation is directly used in RNA extraction, or -80 DEG C save backup.

3) extraction of lymphocyte RNA

1mL Trizol reagent is added in centrifuge tube, the lymphocyte agglomerate of centrifugation bottom of the tube is blown and beaten with pipettor, It is broken up；

1/5 volume of chloroform is added into above-mentioned lysate.Centrifuge tube lid is covered tightly, 15s is acutely shaken, is stored at room temperature 5min.4 DEG C, 12000g is centrifuged 10-15min.1/2 volume isopropanol is added into new centrifuge tube in careful upper strata aqueous phase of drawing.It is mixed by inversion After be placed at room temperature for 10min.4 DEG C, 12000g is centrifuged 10min.It carefully discards supernatant, isometric 75% ethyl alcohol is added.It is vortexed abundant Washing, and tube bottom is flicked, allow precipitating to suspend.4 DEG C, 7500g is centrifuged 5min, abandons supernatant.Be placed at room temperature for and be air-dried 5~ 10min.30~100 μ L are added and take a small amount of detection until completely dissolved without RNase water dissolution RNA, -70 DEG C of remaining solution guarantors It deposits.Measure the OD of total serum IgE₂₆₀And OD₂₆₀/OD₂₈₀, determine the concentration and quality of total serum IgE.

4) synthesis of cDNA and the amplification of VHH gene

Using total serum IgE as template, cDNA is synthesized through two-step reaction using reverse transcription PCR, the specific steps are as follows: according to reverse transcription PCR system 1 (being shown in Table 1) prepares reaction system, ice bath immediately after 65 DEG C of reaction 5min；It is added in first step reaction solution according to anti- It transcribes PCR system 2 (being shown in Table 2) to prepare in reaction system, 42 DEG C of reaction condition, 30min, 50 DEG C, 60min, 70 DEG C, 15min； - 20 DEG C of PCR product freeze it is spare.

1 reverse transcription PCR system 1 of table

2 reverse transcription PCR system 2 of table

According to two-humped camel VHH upstream and downstream sequence, with 5.0 software design PCR primer of Primer Premier, and company is sent Synthetic primer, sequence are as follows:

CALL001:GTCCTGGCTGCTCTTCTACAAGG

CALL002:GGTACGTGCTGTTGAACTGTTCC

VHH-FOR:5 '-CATGCCATGACTGTGGCCCAGGCGGCCGAGTCTGGRGGAGG-3 '

VHH-REV:5 '-CATGCCATGACTCGCGGCCGGCCTGGCCGGAGACGGTGACCWGGGT-3 '.

First round PCR:

Using cDNA as template, first round PCR amplification is carried out using primer CALL001 and primer CALL002, reaction system is PCR system 3, see Table 3 for details:

3 first round of table PCR system 3

Reaction condition: 95 DEG C, 5min, 95 DEG C, 30s；55 DEG C, 30s, 72 DEG C, 45s；30 circulations；72℃,10min.4℃ It saves.PCR product is identified with 1.2% agarose gel electrophoresis, cuts the purpose band near 700bp, with being tapped and recovered reagent Operating procedure recycles PCR product to box to specifications, measures the concentration of recovery product for testing in next step.

Second wheel PCR: with first round PCR glue recovery product (band near 700bp) for template, with primer VHH-FOR VHH genetic fragment is expanded with VHH-REV, reaction system 4: see Table 4 for details；Reaction condition: 98 DEG C, 10s, 55 DEG C, 15s, 72 DEG C, 30s；72 DEG C, 10min, 30 circulations.PCR product cuts purpose band (near 400bp) through 1.5% agarose gel electrophoresis, With plastic recovery kit, operating procedure recycles PCR product to specifications, measures the concentration of recovery product for testing in next step.

Table 4 second takes turns PCR system 4

5) building and identification in library:

The endonuclease reaction of carrier and Insert Fragment

According to the digestion system of table 5,50 DEG C of Sfi I overnight digestion pHEN I phagemid vectors and VHH segment.

Table 5Sfi I endonuclease reaction system

Whether agarose gel electrophoresis detection digestion is complete, recycles digestion products using DNA Purification Kit.

The connection of carrier and Insert Fragment

It is attached reaction by the linked system of table 6, and negative control and positive control are set.

6 coupled reaction system of table

16 DEG C of reaction 12h；After 5 μ L 3M sodium acetates (pH5.2) are added, the cold dehydrated alcohol of 125 μ L is added, -20 DEG C put Set 1h.4 DEG C, 10000g is centrifuged 15min, abandons supernatant；70% cold ethyl alcohol cleans precipitating；4 DEG C, 10000g is centrifuged 5min, in abandoning Clearly；After vacuum drying, 20 μ L sterile waters are resuspended precipitating, it is quantitative simultaneously -20 DEG C freeze it is spare.

The electrotransformation of connection product

It takes 5 μ L connection products to add in 80 μ L competent cell E.coli TG1, mixes well, place 1min on ice.Turn Enter electroporated (voltage 1.8kV) in the electric shock cup of 0.1cm, is added 900 μ L LB culture mediums into electric shock cup immediately, 37 DEG C 160rpm cultivates 1h.Bacterium solution is coated on LB-AG plate, 37 DEG C of inversion overnight incubations

The rescue of initial libraries

Inoculation is more than the cell of 10 times of storage capacities in 100mL 2 × YT/amp/2% glucose, is cultivated to OD600 up to 0.5； It is added helper phage (20:l infection multiplicity), 37 DEG C, after standing 15min, 220rpm cultivates 45min；4 DEG C, 1000g centrifugation 10min；Supernatant is abandoned, the fresh 2 × YT/amp/kan culture medium of 100mL is added, precipitating, 30 DEG C of overnight incubations is resuspended；4℃ 10000rpm is centrifuged 10min, takes supernatant；The PEG-NaCl solution of 1/5 volume, 4 DEG C of 3~4h of standing are added；4 DEG C of 10000rpm from Heart 15min, abandons supernatant, and precipitating is resuspended with 1mLPBS；10 μ L are taken to measure storage capacity, 50% glycerol of final concentration, -80 DEG C of guarantors are added in remaining It deposits.

Embodiment 2: the affine elutriation and its identification of nano antibody

1) the affine elutriation of nano antibody: firstly, SEB is diluted to 50 μ g/mL of final concentration, 4 DEG C of packets with PBS (pH7.4) It is stayed overnight.After second day is washed 5 times with PBST (10mM PBS, 0.1%Tween-20 (v/v)), addition 5%BSA-PBS (or 5%OVA-PBS) close 1 hour for 37 DEG C.Then it is washed 6 times with PBST, 100 μ L camel source single domain heavy chain antibody libraries (drop is added in every hole Degree about 2.0 × 10¹¹Cfu), it is incubated for 2 hours for 37 DEG C.Unbonded bacteriophage is discarded, is washed 10 times with PBST, is added 100 μ L's After Glycine-HCl (0.2M, pH2.2) elutes 8min, neutralized immediately with 15 μ L Tris-HCl (1M, pH9.1).10 μ L are taken to wash De- bacteriophage measures titre, remaining E.coli TG1 bacterial strain that logarithmic phase is grown to for infecting 25mL is expanded.Third It precipitates the bacteriophage after amplification with PEG/NaCl, and measures the titre of bacteriophage.

In the panning process of second, third and fourth round, coated SEB concentration is respectively 25 μ g/mL, 12.5 μ g/mL With 6.25 μ g/mL, being added after bacteriophage is incubated for PBST washing times is respectively 12 times, 15 times and 18 times, remaining step is same as above.

2) identification of positive phage clones: after third round and fourth round elutriation measure phage titre plate on Machine picking 50 clones, carry out the amplification of bacteriophage, carry out positive phage clones using enzyme-linked immunosorbent assay method Identification.Method particularly includes: firstly, SEB is diluted to 500ng/mL with PBS (pH7.4), 4 DEG C of coatings are overnight.Use PBST within second day After (10mM PBS, 0.05%Tween-20 (v/v)) is washed 3 times, 5% skimmed milk power of 300 μ L is added, 37 DEG C are closed 2 hours； Confining liquid is abandoned, after PBST is washed 3 times, 100 μ L Phage amplification liquid (2.0 × 10 are added¹¹Cfu), with naive phage peptide library work For negative control, 37 DEG C are incubated for 1 hour；1:5000 times of diluted HRP is added and marks anti-100 μ L of M13 bacteriophage secondary antibody, 37 DEG C incubate It educates 1 hour；100 μ L tmb substrate solution are added, are protected from light colour developing 10min；50 μ L terminate liquid (2M H are added₂SO₄) terminate reaction； With the absorption value at microplate reader (Thermo Scientific Multiskan FC) measurement 450nm.It chooses OD450 and is greater than feminine gender The phage clone of 2 times of control is positive colony, and 23 plants of positive colonies, respectively B1-B3, B5-B7, B9-B19 are obtained, B21-B28, B30 (shown in attached drawing 1).

Embodiment 3: the sequencing of nano antibody encoding gene and its determination of amino acid sequence

B7 is cloned and carries out DNA sequencing, can get the amino acid sequence of nano antibody according to DNA sequencing result and password sublist Column.

A large amount of preparations of embodiment 4:B7 nano antibody

(1) it is prepared in a manner of Phage amplification

It will show that the bacteriophage for having positive nano antibody is added to 20mL in the culture for being inoculated with E.coli TG1,37 DEG C, 220rpm shaken cultivation 6h.Culture is transferred in another centrifuge tube, 4 DEG C, 10000rpm centrifugation 10min, by the upper of supernatant Portion 80% is transferred in a fresh centrifuge tube, after the PEG/NaCl of 1/6 volume of addition, 4 DEG C of standing 120min, 4 DEG C, 10000rpm It is centrifuged 10min, abandons supernatant；Add a small amount of PBS cleaning bacteriophage.4 DEG C of 10000rpm are centrifuged 10min, abandon supernatant, and 1mL is added PBS is resuspended, as Phage amplification liquid.

(2) it is prepared in the form of protein expression

The plasmid for extracting B7 clone, is transferred to Escherichia coli Top10 ' for recombinant expression carrier.It is single that one is chosen from conversion plate Colony inoculation is in 5mL LB liquid medium, and 37 DEG C, 220r/min shaken cultivation is stayed overnight, by overnight culture by 1% inoculation Amount (v/v) is inoculated in the LB/Amp of 50mL, in 2% dextrose culture-medium, 37 DEG C, and 220r/min shaken cultivation；When culture bacterium Bulk concentration OD₆₀₀When reaching 0.5, the IPTG of addition 0.1mM into culture, 30 DEG C, 8~12h of 220r/min shaken cultivation；It will For culture in 4 DEG C, 8000rpm, centrifugation 20min collects bacterial sediment.The PBS solution that cell is pre-chilled in 5mL, ultrasonication is resuspended After 10min, 8000rpm centrifugation 20min takes supernatant, and supernatant is carried out affinitive layer purification to get the nano antibody B7 of expression.

Embodiment 5: the foundation of standard curve

Using ELISA method carry out sensitivity identification, method particularly includes: with PBS (pH7.4) by SEB to 1000, 500,250,125,62.5,31.25,15.625,7.8125,3.90625 μ g/mL, 4 DEG C of coatings are overnight；Use PBST within second day After (10mM PBS, 0.05%Tween-20 (v/v)) is washed 5 times, 3% skimmed milk power of 300 μ L is added, 37 DEG C are closed 1 hour； The nano antibody B7 of 100 μ L, 10 μ g/mL is added, 37 DEG C are incubated for 1 hour；The anti-His antibody of 1:10000 dilution HRP label is added 100 μ L, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, is protected from light colour developing 10min, measures OD₄₅₀, draw standard curve (as shown in Figure 2), the range of linearity are 16.63~1000ng/mL, linear relationship R²=0.99, lowest detection is limited to 5.91ng/ ML shows preferable sensitivity.

The stability assessment of 6 nano antibody of embodiment

(1) pH stability experiment

With PBS (pH7.4) by the μ of SEB to 1000,500,250,125,62.5,31.25,15.625,7.8125,3.90625 G/mL, 4 DEG C of coatings are overnight；After second day is washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 300 μ are added 3% skimmed milk power of L, 37 DEG C are closed 1 hour；PBST (10mM PBS, 0.05%Tween-20 (v/v)) is washed 3 times；By nanometer Antibody uses pH5.0,6.0,7.4,8.0 and 9.0 PBS to be diluted to 10 μ g/mL respectively, and 37 DEG C are incubated for 1 hour；1:10000 is added The 100 μ L of anti-His antibody of HRP label is diluted, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, are protected from light colour developing 10min measures OD₄₅₀, the OD of more different pH value₄₅₀Variation, to obtain acidproof alkali ability.Experimental result is as shown in figure 3, result Show between pH6~8, SC₅₀(semi-saturation signal value concentration) there was no significant difference, shows that nano antibody B7 has centainly Acidproof alkaline stability.

(2) heat-resistant experiment

Coating: with PBS (pH7.4) by SEB to 1000,500,250,125,62.5,31.25,15.625,7.8125, 3.90625 μ g/mL, 4 DEG C of coatings are overnight；After second day is washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 3% skimmed milk power of 300 μ L is added, 37 DEG C are closed 1 hour；PBST (10mM PBS, 0.05%Tween-20 (v/v)) washing 3 It is secondary；Nano antibody is diluted to 10 μ g/mL with PBS, is respectively placed in 37,50,70,90 DEG C of water-bath 10min, after being restored to room temperature, 100 μ L are taken to be added in the lath handled well respectively again, 37 DEG C are incubated for 1 hour；The anti-His that 1:10000 dilution HRP label is added is anti- 100 μ L of body, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, is protected from light colour developing 10min, measures OD₄₅₀.Compare not equality of temperature The absorbance value under treatment conditions is spent, obtains the temperature capacity of nano antibody, the results showed that between 37~70 DEG C, SC₅₀(half Saturation signal value concentration) there was no significant difference, show that nano antibody B7 has certain thermal stability, as shown in Figure 5.

Embodiment 7: specificity identification

The specificity identification of positive nano antibody is carried out using the method for ELISA, method particularly includes: it will with PBS (pH7.4) Staphylococcal enterotoxin B, staphylococcus aureus toxin A are diluted to 500ng/mL respectively, by Staphylococcus aureus Bacterium ATCC25923, staphylococcus aureus ATCC29213, staphylococcus aureus ATCC26111 are diluted to 10 respectively⁷cfu/ ML, 4 DEG C of coatings are overnight；After being washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 3% that 300 μ L are added is de- Rouge milk powder, 37 DEG C are closed 1 hour；After being washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 100 μ L are added The conjugate of horseradish peroxidase and nano antibody, 37 DEG C are incubated for 1 hour；With PBST (10mM PBS, 0.05%Tween-20 (v/v)) after washing 3 times, 100 μ L tmb substrate solution are added, is protected from light colour developing 10min, 50 μ L2M H is added₂SO₄Terminate liquid terminates After reaction, OD450 is measured.As a result see Fig. 2, B7 nano antibody and Staphylococcal enterotoxin B, staphylococcus aureus ATCC25923, staphylococcus aureus ATCC29213, the equal no cross reaction of staphylococcus aureus ATCC26111, show to receive Meter Kang Ti B7 and staphylococcus aureus show that albumin A without combination, shows preferable specificity.

Nucleotides sequence list electronic document

<110>Xibei Univ. of Agricultural & Forest Science & Technology

<120>a kind of Staphylococcal enterotoxin B nano antibody B7, application and kit

<130> 2018

<160> 9

<170> PatentIn Version 3.5

<210> 1

<211> 122

<212> PRT

<213> Llama

<400> 1

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu

1 5 10 15

Ser Cys Lys Val Ser Gly Phe Asn Phe Arg Glu His Ala Leu Ala

20 25 30

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ser Cys

35 40 45

Ile Arg Gly Ser Gly Asp Tyr Thr Thr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln Asn Thr Leu Tyr

65 70 75

Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Met Tyr Tyr

80 85 90

Cys Ala Ala Ala Arg Tyr Ala Arg Tyr Tyr Pro Asn Asn Cys Leu

95 100 105

Asp Ser Ala Glu Tyr Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

110 115 120 122

<210> 2

<211> 20

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(20)

<223> FR1

<400> 2

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Lys Val Ser

1 5 10 15 20

<210>3

<211>10

<212> PRT

<213>Llama

<220>

<221> Domain

<222> (1)..(10)

<223> CDR1

<400>3

Gly Phe Asn Phe Arg Glu His Ala Leu Ala

1 5 10

<210>4

<211> 18

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(18)

<223> FR2

<400>4

Leu Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ser Cys Ile

1 5 10 15 18

<210>5

<211>10

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(10)

<223> CDR2

<400>5

Arg Gly Ser Gly Asp Tyr Thr Thr Tyr Ala

1 5 10

<210>6

<211>37

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(37)

<223>FR3

<400>6

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln

1 5 10 15

Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr

20 25 30

Ala Met Tyr Tyr Cys Ala Ala

35 37

<210>7

<211>19

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(19)

<223>CDR3

<400>7

Ala Arg Tyr Ala Arg Tyr Tyr Pro Asn Asn Cys Leu Asp Ser Ala

1 5 10 15

Glu Tyr Gly Tyr

19

<210>8

<211>10

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(10)

<223>FR4

<400>8

Trp Gly Gln Gly Thr Leu Val Thr Val Ser

1 5 10

<210>9

<211>366

<212>DNA

<213> Llama

<400>8

gagtctgggg gaggcttggt gcaggccggg gggtctctga gactctcctg taaagtctct 60

ggatttaatt ttcgtgagca tgccctggcc tggttccgcc aggctccagg aaaagagcgc 120

gagggggtct catgtattcg cgggagtggt gattacacaa cttatgcaga ctccgtgaag 180

ggccgattca ccatctccag agacaacgct cagaacaccc tgtatctgca aatgaacagc 240

ctcagacctg aggacacggc catgtattac tgtgcggcag cgcggtacgc gcggtactat 300

cctaacaatt gtctggattc agcggaatat gggtactggg gccaggggac cctggtcacc 360

gtctcc 366

Claims

1. a kind of Staphylococcal enterotoxin B nano antibody B7, which is characterized in that include framework region FR and complementary decision Area CDR, the framework region FR include the amino acid sequence of FR1~FR4,

Wherein the amino acid sequence of FR1 is as shown in SEQ ID NO.:2, the amino acid sequence of FR2 as shown in SEQ ID NO.:4, The amino acid sequence of FR3 is as shown in SEQ ID NO.:6, and the amino acid sequence of FR4 is as shown in SEQ ID NO.:8；

Wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO.:3, the amino acid sequence of CDR2 such as SEQ ID NO.:5 institute Show, the amino acid sequence of CDR3 is as shown in SEQ ID NO.:7.

2. a kind of Staphylococcal enterotoxin B nano antibody B7, which is characterized in that the amino acid of the nano antibody B7 Sequence is as shown in SEQ ID NO.:1.

3. Staphylococcal enterotoxin B nano antibody B7 as described in claim 1, which is characterized in that described in encoding The nucleotide sequence of Staphylococcal enterotoxin B nano antibody B7 is as shown in SEQ ID NO.:9.

4. a kind of preparation method of Staphylococcal enterotoxin B nano antibody B7, which is characterized in that received what hunchbacked source was immunized Screening can tie the nano antibody that specificity is closed with target molecule SEB in rice antibody library, and pass through Phage amplification or genetic engineering weight It is prepared by the mode of group expression；

The Phage amplification is will to show the bacteriophage for having anti-SEB nano antibody, by way of biology amplification, breeding production Show the bacteriophage particles for having SEB nano antibody；

The mode of the genetic engineering recombinant expression refers to the gene of nano antibody, by being cloned into expression vector, with albumen The form of expression carries out the preparation of nano antibody.

5. Staphylococcal enterotoxin B nano antibody B7 is in golden yellow Portugal described in Claims 1 to 4 any claim Application in grape coccus enterotoxin B immunology detection.

6. Staphylococcal enterotoxin B nano antibody B7 described in Claims 1 to 4 any claim is used to prepare gold The application of staphylococcus aureus enterotoxin B immunity detection reagent.

7. a kind of Staphylococcal enterotoxin B immunity detection reagent, which is characterized in that the kit carries right It is required that Staphylococcal enterotoxin B nano antibody B7 described in 1~4 any claim.