CN110526966A - A kind of Staphylococcal enterotoxin B nano antibody B6, application and kit - Google Patents
A kind of Staphylococcal enterotoxin B nano antibody B6, application and kit Download PDFInfo
- Publication number
- CN110526966A CN110526966A CN201910763770.4A CN201910763770A CN110526966A CN 110526966 A CN110526966 A CN 110526966A CN 201910763770 A CN201910763770 A CN 201910763770A CN 110526966 A CN110526966 A CN 110526966A
- Authority
- CN
- China
- Prior art keywords
- nano antibody
- amino acid
- seq
- antibody
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1267—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
- C07K16/1271—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria from Micrococcaceae (F), e.g. Staphylococcus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56938—Staphylococcus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/305—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F)
- G01N2333/31—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F) from Staphylococcus (G)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of Staphylococcal enterotoxin B nano antibody B6, application and kits.The nano antibody that the present invention obtains have relative molecular mass is small, stability is strong, yield is high, can specific recognition SEB, it is wider compared with conventional monoclonal antibody purposes, specificity it is stronger.The invention discloses this nano antibody and the gene order of the nano antibody is encoded, the method for the nano antibody is produced and applies the kit of the antibody.The nano antibody that the present invention obtains can avoid in conjunction with staphylococcus aureus surface albumin A, show compared with high specific, with stability is good, molecular weight is small and can be mass-produced.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of Staphylococcal enterotoxin B nano antibody B6, answer
With and reagent.
Background technique
Staphylococcus aureus (Staphylococcus aureus, SA) is a kind of common food-borne pathogens, by it
Caused sitotoxismus height in gram-positive bacteria ranks first, and pathogenecity depends primarily on the enterotoxin of bacterium generation
(Staphylococcal enterotoxins, SEs).SEs is poison outside the extracellular soluble generated by staphylococcus aureus secretion
Cellulose protein, structure is similar, and molecular weight is 27.5~30kDa, and thermal stability is good, boils 30min without being destroyed through 100 DEG C,
Therefore, the food of staphylococcus aureus pollution is after generally heating, although microorganism can be killed, it is generated
Enterotoxin is still active and pathogenicity.By serological classification, mainly there are the serotypes such as A, B, Cs, D, E, wherein SEB is
Virulence is most strong in SEs family, most stable to heat, is primarily present in meat, in the higher animal food of the protein contents such as cream.
Susceptible population will be made nausea occur when SEB intake reaches 20~100ng, vomitted, the poisoning symptoms such as abdominal pain and diarrhea, because
This, is particularly important the detection of SEB in food.However, there are two main problems for the detection of SEB: food matrix first
Ingredient it is complex, containing multiple proteins, lipid and other compounds, the accurate detection of the presence of these ingredients to SEB
Cause interference；Secondly, SA often only generates this sensitivity to detection method of trace or micro SEB (ng/g) in food
Propose higher requirement.Realize to be always one challenging to the quantitative detection of enterotoxin in food matrix
Business.Currently, immunological detection method is because having the characteristics that quick, high specificity, easy to operate, result are easy to judge to be answered extensively
For in the quick detection of SEs.Wherein immunological detection is SEs routine because having the characteristics that easy to operate, detection speed is fast
Most popular method and the more mature detection method of development in screening detection, principle are that two of two identification surfaces SEB are anti-
The antibody put in situ forms interlayer structure in the presence of SEB, by the marker on detection antibody to interpretation testing result.
Currently, the staphylococcus aureus of research preparation both at home and abroad and its enterotoxin antibody are the Anti-TNF-α for identifying its surface antigen
Body or monoclonal antibody, but the preparation of conventional monoclonal antibody is taken time and effort and low output, and staphylococcal protein A (spA)
Interference be to SEs based on sixty-four dollar question in immunology detection.SpA is staphylococcus aureus in cell surface display
Protein, also discharged in outside, the end Fc of the strong all IgG generated in conjunction with mammal, therefore, for detecting golden yellow
The antibody of staphylococcal entotoxin can generate false positive results, keep method accuracy poor, to affect application value.
Nano antibody technology is to research and develop to obtain with Protocols in Molecular Biology on the basis of conventional antibodies, be at present
Know the antibody molecule of the smallest combinable antigen.Initially there is Belgian scientist Hamers.R to find in camel blood, commonly
The antibody protein novel antibodies natural deletions light chain that is formed, and found from camel blood by two heavy chains and two light chains and
The heavy chain antibody of heavy chain constant region 1 (CH1) clones its variable region and obtains the single domain antibody being only made of a heavy chain variable region,
Referred to as single domain heavy chain antibody (Variable domain of heavy chain of heavy-chain antibody, VHH),
Also known as nano antibody (nanobody, Nb).Nano antibody also has following excellent compared with polyclonal antibody and monoclonal antibody
Point:
1) without Fc recognition site, it can avoid false positive issue caused in conjunction with protein A；
2) there is the longer area CDR3, and pairs of complementary relationship is not present in the area CDRs and other structural domains of itself, therefore
With more flexibilities and convex surface property, small size (12~15kD, 2 × 2 × 4nm) in addition, can its preferably and antigenic surface
Crack and lacuna combine, so that the antigentic specificity and affinity of nano antibody are improved, in nanomole to picomolar range
Inside there is good affinity.In identical detection range, the affinity of monovalent nano antibody is the two of common bivalent antibody
Times.Especially for the more complex bacterium of surface texture or high molecular weight protein etc., nano antibody is beneficial to overcome surface texture
Steric effect and surface antigen identify.
3) nano antibody stability height, good water solubility, can in microflora largely synthesis expression, be nano antibody it is low
Cost, efficient production create condition.
4) C-terminal (C-terminus) of nano antibody is located at the opposite positions of antigen binding site, is easy to be oriented function
Energyization modification, and then it is oriented modification.
For the nano antibody of SEB, there is not been reported at present, thus for SEB high-affinity, Gao Teyi, at low cost receive
The exploitation of meter Kang Ti is conducive to the sensitivity and specificity for further increasing SEB immunology detection, to reach wanting for on-site test
It asks.
Summary of the invention
For above-mentioned prior art deficiency and defect, the object of the present invention is to provide a kind of staphylococcus aureus intestines
Toxin B nano antibody B6, application and kit, it is poor to solve antibody specificity in the prior art, and detection method is at high cost, operation
Complicated technical problem.
In order to achieve the above object, the application, which adopts the following technical scheme that, is achieved:
A kind of Staphylococcal enterotoxin B nano antibody B6 includes framework region FR and complementary determining region CDR, institute
The amino acid sequence that framework region FR includes FR1~FR4 is stated,
Wherein the amino acid sequence of FR1 is as shown in SEQ ID NO.:2, the amino acid sequence of FR2 such as SEQ ID NO.:4 institute
Show, the amino acid sequence of FR3 is as shown in SEQ ID NO.:6, and the amino acid sequence of FR4 is as shown in SEQ ID NO.:8；
The complementary determining region CDR includes the amino acid sequence of CDR1~CDR3,
Wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO.:3, the amino acid sequence of CDR2 such as SEQ ID NO.:5
Shown, the amino acid sequence of CDR3 is as shown in SEQ ID NO.:7.
A kind of amino acid sequence such as SEQ of Staphylococcal enterotoxin B nano antibody B6, the nano antibody B6
Shown in ID NO.:1.
A kind of preparation method of Staphylococcal enterotoxin B nano antibody B6, which is characterized in that be immunized in hunchbacked source
Screening can tie the nano antibody that specificity is closed with target molecule SEB in nano antibody library, and pass through Phage amplification or genetic engineering
It is prepared by the mode of recombinant expression；
The Phage amplification is will to show the bacteriophage for having anti-SEB nano antibody, by way of biology amplification, breeding
Production shows the bacteriophage particles for having SEB nano antibody；
The mode of the genetic engineering recombinant expression refers to the gene of nano antibody, by being cloned into expression vector, with
The form of protein expression carries out the preparation of nano antibody.
The nucleotide sequence such as SEQ ID NO.:9 institute of the coding Staphylococcal enterotoxin B nano antibody B6
Show.
The Staphylococcal enterotoxin B nano antibody B6 is examined in Staphylococcal enterotoxin B immunology
Application in survey.
The Staphylococcal enterotoxin B nano antibody B6 is used to prepare Staphylococcal enterotoxin B and exempts from
The application of epidemic disease detection kit.
A kind of Staphylococcal enterotoxin B immunity detection reagent, the kit carry the golden yellow
Staphylococcal enterotoxin B nano antibody B6.
Compared with prior art, the present invention beneficial has the technical effect that
(I) nano antibody that the present invention obtains has relative molecular mass is small, stability is strong, yield is high, energy is specific to know
Other SEB, wider compared with conventional monoclonal antibody purposes, specificity is stronger.
(II) nano antibody that obtains of the present invention can avoid in conjunction with staphylococcus aureus surface albumin A, show compared with
High specific, with stability is good, molecular weight is small and can be mass-produced.
(III) it is at high cost, complicated for operation, poor specificity can to solve existing detection method for the nano antibody that the present invention obtains
Problem has broad application prospects
Detailed description of the invention
Fig. 1 is for elutriation positive colony Salmonella qualification result, wherein clone's B6OD value is maximum；
Fig. 2 is the Salmonella standard curve to be established with nano antibody B6, and the range of linearity is 16.63~1000ng/
ML, linear relationship R2=0.99, lowest detection is limited to 8.78ng/mL；
Fig. 3 is the specificity analysis of nano antibody B6；
Fig. 4 is the resistance to acid and alkali analysis of nano antibody B6；
Fig. 5 is the thermal stability analysis of nano antibody B6；
Explanation is further explained in detail to particular content of the invention below in conjunction with drawings and examples.
Specific embodiment
Specific embodiments of the present invention are given below, it should be noted that the invention is not limited to implement in detail below
Example, all equivalent transformations made on the basis of the technical solutions of the present application each fall within protection scope of the present invention.
Alashan Bactrian Camel is immunized using SEB in the present invention, extracts from the peripheral blood lymphocytes of immunized two-humped camel
Its RNA, specific amplification camel single-chain antibody variable region gene, to construct nano antibody gene pool, analyze its storage capacity and
Diversity.Pass through the nanometer that with display technique of bacteriophage, screening can be specifically bound with target molecule (SEB) from nano antibody library
Antibody constructs nano antibody B6 expression vector, carries out prokaryotic expression, purifying and identification to it to get anti-to required nanometer
Body B6.ELISA detection method is established using the nano antibody that elutriation obtains.Nano antibody prepared by the present invention is as a kind of novel
Genetic engineering antibody, due to its unique structure feature, antigen binding ability is strong, can be used for fast and accurately SEB detection.
Two-humped camel is immunized using SEB in the present invention, is then established using the two-humped camel peripheral blood lymphocytes for golden yellow
The phage display nano antibody library of color staphylococcal enterotoxin A.Then Staphylococcal enterotoxin B is inhaled in test
It is attached on ELISA Plate, using the nano antibody library of display technique of bacteriophage screening immunity, have been directed to one kind to obtain
The specific nano antibody B6 of Staphylococcal enterotoxin B, with amino acid sequence described in SEQ ID NO.:1.
Nano antibody mentioned by the present invention includes that four framework regions (Framework region, FR) and three complementations are determined
Determine area (Complementarity-determining region, CDR).Wherein, framework region (FR1~FR4) is respectively selected from SEQ
ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8, complementary determining region are respectively (CDR1~CDR3)
It is respectively selected from SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.:7.Frame plot structure is relatively conservative, mainly plays dimension
Hold the effect of protein structure；Complementary determining region structure is relatively diversified, is mainly responsible for the identification of antibody.
The invention further relates to the nucleotide for encoding the nano antibody amino acid sequence, sequence is SEQ ID NO.:9.
The nano antibody that the present invention refers to can be carried out a large amount of by way of Phage amplification or genetic engineering recombinant expression
Preparation.Phage amplification, which refers to, to show the bacteriophage for having the nano antibody, by way of biology amplification, mass propagation production
Show the bacteriophage particles for having the nano antibody.The mode of genetic engineering recombinant expression, which refers to, will encode the base of the nano antibody
Cause carries out a large amount of preparations of the nano antibody by being cloned into expression vector in the form of protein expression.
The invention further relates to application of the nano antibody in immunology detection.The type of immunology detection includes enzyme
Join the immune credits based on Ag-Ab specific reaction such as immuno absorbence detection, colloidal gold immunochromatographimethod, immunodotting hybridization
Analyse detection type.
Nano antibody of the present invention is in use, can have nano antibody by the displaying that Phage amplification obtains
Bacteriophage particles are directly used in analysis detection, it is of course also possible to by nano antibody after prokaryotes or eucaryote expression
Immunology detection analysis is carried out in the form of albumen.
Amino acid sequence of the present invention can be used as precursor, is transformed by random or site-directed mutagenesis technique, energy
Enough obtain property (affinity, specificity and stability etc.) better mutant.
The building of embodiment 1, hunchbacked source nano antibody phage display library
1) two-humped camel is immune
Using SEB as immunogene using bull Alashan Bactrian Camel is immunized in a manner of subcutaneous multi-point injection, five are carried out altogether
Wheel is immune.Initial immunity is using Freund's complete adjuvant (Freund ' s complete adjuvant) and isometric immunizing antigen
It is injected after emulsification, immunizing dose is 100 μ g/.Booster immunization is primary every two weeks backward, using incomplete Freund's adjuvant
It is injected after (Freund ' s incomplete adjuvant) and isometric immunogene emulsification, each immunizing dose is 50
μ g/ is only.The 7th day after 5th booster immunization, two-humped camel peripheral blood is taken, for constructing nano antibody phage display library.
2) separation of lymphocyte
7th day after last time is immune, 200mL peripheral blood is acquired with Plastic Blood Bags (containing anti-coagulants), before use
With isometric PBS dilute blood sample.Ficoll-Paque PLUS lymphocyte separation medium is balanced to room temperature, is drawn
15mL is addedSeparation of lymphocytes pipe (band porous barrier), is centrifuged with horizontal rotor centrifuge 1000g room temperature
30s makes lymphocyte separation medium be located just at sieve or less.It is thin that lymph is added after the blood sample diluted is balanced to room temperature
Born of the same parents' separating pipe, 30mL/ branch are centrifuged 10min with horizontal rotor centrifuge 1000g room temperature, and centrifuge braking acceleration is adjusted to 0.From
Red blood cell is located at separation of lymphocytes bottom of the tube after the heart, and top layer is blood plasma, blood plasma and white clear lymphocyte separation medium it
Between one layer of ring to fill milky white color substance be lymphocyte, carefully remove upper plasma with dropper, until apart from cellular layer 5~
10mm.Lymphocyte is collected into another clean 50mL centrifuge tube with dropper, and the PBS of the ice bath of at least 10 times volumes is added,
After being mixed by inversion, 250g, 4 DEG C of centrifugation 10min.It discards supernatant, cell, 250g, 4 DEG C of centrifugations is resuspended with the PBS of 45mL ice bath
10min washs cell twice with same method again.After last time is centrifuged, cell is resuspended with the PBS of 10mL ice bath, it is thin with blood
Born of the same parents' tally counts, and is sub-packed in 1.5mL centrifuge tube after counting, 1 × 107A cell/, 250g, 4 DEG C of centrifugation 10min,
Supernatant is abandoned, cell precipitation is directly used in RNA extraction, or -80 DEG C save backup.
3) extraction of lymphocyte RNA
1mL Trizol reagent is added in centrifuge tube, the lymphocyte agglomerate of centrifugation bottom of the tube is blown and beaten with pipettor,
It is broken up；
1/5 volume of chloroform is added into above-mentioned lysate.Centrifuge tube lid is covered tightly, 15s is acutely shaken, is stored at room temperature 5min.4
DEG C, 12000g is centrifuged 10-15min.1/2 volume isopropanol is added into new centrifuge tube in careful upper strata aqueous phase of drawing.It is mixed by inversion
After be placed at room temperature for 10min.4 DEG C, 12000g is centrifuged 10min.It carefully discards supernatant, isometric 75% ethyl alcohol is added.It is vortexed abundant
Washing, and tube bottom is flicked, allow precipitating to suspend.4 DEG C, 7500g is centrifuged 5min, abandons supernatant.Be placed at room temperature for and be air-dried 5~
10min.30~100 μ L are added and take a small amount of detection until completely dissolved without RNase water dissolution RNA, -70 DEG C of remaining solution guarantors
It deposits.Measure the OD of total serum IgE260And OD260/OD280, determine the concentration and quality of total serum IgE.
4) synthesis of cDNA and the amplification of VHH gene
Using total serum IgE as template, cDNA is synthesized through two-step reaction using reverse transcription PCR, the specific steps are as follows: according to reverse transcription
PCR system 1 (being shown in Table 1) prepares reaction system, ice bath immediately after 65 DEG C of reaction 5min；It is added in first step reaction solution according to anti-
It transcribes PCR system 2 (being shown in Table 2) to prepare in reaction system, 42 DEG C of reaction condition, 30min, 50 DEG C, 60min, 70 DEG C, 15min；
- 20 DEG C of PCR product freeze it is spare.
1 reverse transcription PCR system 1 of table
2 reverse transcription PCR system 2 of table
According to two-humped camel VHH upstream and downstream sequence, with 5.0 software design PCR primer of Primer Premier, and company is sent
Synthetic primer, sequence are as follows:
CALL001:GTCCTGGCTGCTCTTCTACAAGG
CALL002:GGTACGTGCTGTTGAACTGTTCC
VHH-FOR:5 '-CATGCCATGACTGTGGCCCAGGCGGCCGAGTCTGGRGGAGG-3 '
VHH-REV:5 '-CATGCCATGACTCGCGGCCGGCCTGGCCGGAGACGGTGACCWGGGT-3 '.
First round PCR:
Using cDNA as template, first round PCR amplification is carried out using primer CALL001 and primer CALL002, reaction system is
PCR system 3, see Table 3 for details:
3 first round of table PCR system 3
Reaction condition: 95 DEG C, 5min, 95 DEG C, 30s；55 DEG C, 30s, 72 DEG C, 45s；30 circulations；72℃,10min.4℃
It saves.PCR product is identified with 1.2% agarose gel electrophoresis, cuts the purpose band near 700bp, with being tapped and recovered reagent
Operating procedure recycles PCR product to box to specifications, measures the concentration of recovery product for testing in next step.
Second wheel PCR: with first round PCR glue recovery product (band near 700bp) for template, with primer VHH-FOR
VHH genetic fragment is expanded with VHH-REV, reaction system 4: see Table 4 for details；Reaction condition: 98 DEG C, 10s, 55 DEG C, 15s, 72 DEG C,
30s；72 DEG C, 10min, 30 circulations.PCR product cuts purpose band (near 400bp) through 1.5% agarose gel electrophoresis,
With plastic recovery kit, operating procedure recycles PCR product to specifications, measures the concentration of recovery product for testing in next step.
Table 4 second takes turns PCR system 4
5) building and identification in library:
The endonuclease reaction of carrier and Insert Fragment
According to the digestion system of table 5,50 DEG C of Sfi I overnight digestion pHEN I phagemid vectors and VHH segment.
5 Sfi I endonuclease reaction system of table
Whether agarose gel electrophoresis detection digestion is complete, recycles digestion products using DNA Purification Kit.
The connection of carrier and Insert Fragment
It is attached reaction by the linked system of table 6, and negative control and positive control are set.
6 coupled reaction system of table
16 DEG C of reaction 12h；After 5 μ L 3M sodium acetates (pH5.2) are added, the cold dehydrated alcohol of 125 μ L is added, -20 DEG C put
Set 1h.4 DEG C, 10000g is centrifuged 15min, abandons supernatant；70% cold ethyl alcohol cleans precipitating；4 DEG C, 10000g is centrifuged 5min, in abandoning
Clearly；After vacuum drying, 20 μ L sterile waters are resuspended precipitating, it is quantitative simultaneously -20 DEG C freeze it is spare.
The electrotransformation of connection product
It takes 5 μ L connection products to add in 80 μ L competent cell E.coli TG1, mixes well, place 1min on ice.Turn
Enter electroporated (voltage 1.8kV) in the electric shock cup of 0.1cm, is added 900 μ L LB culture mediums into electric shock cup immediately, 37 DEG C
160rpm cultivates 1h.Bacterium solution is coated on LB-AG plate, 37 DEG C of inversion overnight incubations
The rescue of initial libraries
Inoculation is more than the cell of 10 times of storage capacities in 100mL 2 × YT/amp/2% glucose, is cultivated to OD600 up to 0.5；
It is added helper phage (20:l infection multiplicity), 37 DEG C, after standing 15min, 220rpm cultivates 45min；4 DEG C, 1000g centrifugation
10min；Supernatant is abandoned, the fresh 2 × YT/amp/kan culture medium of 100mL is added, precipitating, 30 DEG C of overnight incubations is resuspended；4℃
10000rpm is centrifuged 10min, takes supernatant；The PEG-NaCl solution of 1/5 volume, 4 DEG C of 3~4h of standing are added；4 DEG C of 10000rpm from
Heart 15min, abandons supernatant, and precipitating is resuspended with 1mLPBS；10 μ L are taken to measure storage capacity, 50% glycerol of final concentration, -80 DEG C of guarantors are added in remaining
It deposits.
Embodiment 2: the affine elutriation and its identification of nano antibody
1) the affine elutriation of nano antibody: firstly, SEB is diluted to 50 μ g/mL of final concentration, 4 DEG C of packets with PBS (pH7.4)
It is stayed overnight.After second day is washed 5 times with PBST (10mM PBS, 0.1%Tween-20 (v/v)), addition 5%BSA-PBS (or
5%OVA-PBS) close 1 hour for 37 DEG C.Then it is washed 6 times with PBST, 100 μ L camel source single domain heavy chain antibody libraries (drop is added in every hole
Degree about 2.0 × 1011Cfu), it is incubated for 2 hours for 37 DEG C.Unbonded bacteriophage is discarded, is washed 10 times with PBST, is added 100 μ L's
After Glycine-HCl (0.2M, pH2.2) elutes 8min, neutralized immediately with 15 μ L Tris-HCl (1M, pH9.1).10 μ L are taken to wash
De- bacteriophage measures titre, remaining E.coli TG1 bacterial strain that logarithmic phase is grown to for infecting 25mL is expanded.Third
It precipitates the bacteriophage after amplification with PEG/NaCl, and measures the titre of bacteriophage.
In the panning process of second, third and fourth round, coated SEB concentration is respectively 25 μ g/mL, 12.5 μ g/mL
With 6.25 μ g/mL, being added after bacteriophage is incubated for PBST washing times is respectively 12 times, 15 times and 18 times, remaining step is same as above.
2) identification of positive phage clones: after third round and fourth round elutriation measure phage titre plate on
Machine picking 50 clones, carry out the amplification of bacteriophage, carry out positive phage clones using enzyme-linked immunosorbent assay method
Identification.Method particularly includes: firstly, SEB is diluted to 500ng/mL with PBS (pH7.4), 4 DEG C of coatings are overnight.Use PBST within second day
After (10mM PBS, 0.05%Tween-20 (v/v)) is washed 3 times, 5% skimmed milk power of 300 μ L is added, 37 DEG C are closed 2 hours；
Confining liquid is abandoned, after PBST is washed 3 times, 100 μ L Phage amplification liquid (2.0 × 10 are added11Cfu), with naive phage peptide library work
For negative control, 37 DEG C are incubated for 1 hour；1:5000 times of diluted HRP is added and marks anti-100 μ L of M13 bacteriophage secondary antibody, 37 DEG C incubate
It educates 1 hour；100 μ L tmb substrate solution are added, are protected from light colour developing 10min；50 μ L terminate liquid (2M H are added2SO4) terminate reaction；
With the absorption value at microplate reader (Thermo Scientific Multiskan FC) measurement 450nm.It chooses OD450 and is greater than feminine gender
The phage clone of 2 times of control is positive colony, and 23 plants of positive colonies, respectively B1-B3, B5-B7, B9-B19 are obtained,
B21-B28, B30 (shown in attached drawing 1).
Embodiment 3: the sequencing of nano antibody encoding gene and its determination of amino acid sequence
B6 is cloned and carries out DNA sequencing, can get the amino acid sequence of nano antibody according to DNA sequencing result and password sublist
Column.
A large amount of preparations of embodiment 4:B6 nano antibody
(1) it is prepared in a manner of Phage amplification
It will show that the bacteriophage for having positive nano antibody is added to 20mL in the culture for being inoculated with E.coli TG1,37
DEG C, 220rpm shaken cultivation 6h.Culture is transferred in another centrifuge tube, 4 DEG C, 10000rpm centrifugation 10min, by the upper of supernatant
Portion 80% is transferred in a fresh centrifuge tube, after the PEG/NaCl of 1/6 volume of addition, 4 DEG C of standing 120min, 4 DEG C, 10000rpm
It is centrifuged 10min, abandons supernatant；Add a small amount of PBS cleaning bacteriophage.4 DEG C of 10000rpm are centrifuged 10min, abandon supernatant, and 1mL is added
PBS is resuspended, as Phage amplification liquid.
(2) it is prepared in the form of protein expression
The plasmid for extracting B6 clone, is transferred to Escherichia coli Top10 ' for recombinant expression carrier.It is single that one is chosen from conversion plate
Colony inoculation is in 5mL LB liquid medium, and 37 DEG C, 220r/min shaken cultivation is stayed overnight, by overnight culture by 1% inoculation
Amount (v/v) is inoculated in the LB/Amp of 50mL, in 2% dextrose culture-medium, 37 DEG C, and 220r/min shaken cultivation；When culture bacterium
Bulk concentration OD600When reaching 0.5, the IPTG of addition 0.1mM into culture, 30 DEG C, 8~12h of 220r/min shaken cultivation；It will
For culture in 4 DEG C, 8000rpm, centrifugation 20min collects bacterial sediment.The PBS solution that cell is pre-chilled in 5mL, ultrasonication is resuspended
After 10min, 8000rpm centrifugation 20min takes supernatant, and supernatant is carried out affinitive layer purification to get the nano antibody B6 of expression.
Embodiment 5: the foundation of standard curve
Using ELISA method carry out sensitivity identification, method particularly includes: with PBS (pH7.4) by SEB to 1000,
500,250,125,62.5,31.25,15.625,7.8125,3.90625 μ g/mL, 4 DEG C of coatings are overnight；Use PBST within second day
After (10mM PBS, 0.05%Tween-20 (v/v)) is washed 5 times, 3% skimmed milk power of 300 μ L is added, 37 DEG C are closed 1 hour；
The nano antibody B6 of 100 μ L, 10 μ g/mL is added, 37 DEG C are incubated for 1 hour；The anti-His antibody of 1:10000 dilution HRP label is added
100 μ L, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, is protected from light colour developing 10min, measures OD450, draw standard curve
(as shown in Figure 2), the range of linearity are 16.63~1000ng/mL, linear relationship R2=0.99, lowest detection is limited to 5.91ng/
ML shows preferable sensitivity.
The stability assessment of 6 nano antibody of embodiment
(1) pH stability experiment
With PBS (pH7.4) by the μ of SEB to 1000,500,250,125,62.5,31.25,15.625,7.8125,3.90625
G/mL, 4 DEG C of coatings are overnight；After second day is washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 300 μ are added
3% skimmed milk power of L, 37 DEG C are closed 1 hour；PBST (10mM PBS, 0.05%Tween-20 (v/v)) is washed 3 times；By nanometer
Antibody uses pH5.0,6.0,7.4,8.0 and 9.0 PBS to be diluted to 10 μ g/mL respectively, and 37 DEG C are incubated for 1 hour；1:10000 is added
The 100 μ L of anti-His antibody of HRP label is diluted, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, are protected from light colour developing
10min measures OD450, the OD of more different pH value450Variation, to obtain acidproof alkali ability.Experimental result is as shown in figure 3, result
Show between pH6~8, SC50(semi-saturation signal value concentration) there was no significant difference, shows that nano antibody B6 has centainly
Acidproof alkaline stability.
(2) heat-resistant experiment
Coating: with PBS (pH7.4) by SEB to 1000,500,250,125,62.5,31.25,15.625,7.8125,
3.90625 μ g/mL, 4 DEG C of coatings are overnight；After second day is washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)),
3% skimmed milk power of 300 μ L is added, 37 DEG C are closed 1 hour；PBST (10mM PBS, 0.05%Tween-20 (v/v)) washing 3
It is secondary；Nano antibody is diluted to 10 μ g/mL with PBS, is respectively placed in 37,50,70,90 DEG C of water-bath 10min, after being restored to room temperature,
100 μ L are taken to be added in the lath handled well respectively again, 37 DEG C are incubated for 1 hour；The anti-His that 1:10000 dilution HRP label is added is anti-
100 μ L of body, 37 DEG C are incubated for 1 hour；100 μ L tmb substrate solution are added, is protected from light colour developing 10min, measures OD450.Compare not equality of temperature
The absorbance value under treatment conditions is spent, obtains the temperature capacity of nano antibody, the results showed that between 37~70 DEG C, SC50(half
Saturation signal value concentration) there was no significant difference, show that nano antibody B6 has certain thermal stability.
Embodiment 7: specificity identification
The specificity identification of positive nano antibody is carried out using the method for ELISA, method particularly includes: it will with PBS (pH7.4)
Staphylococcal enterotoxin B, staphylococcus aureus toxin A are diluted to 500ng/mL respectively, by Staphylococcus aureus
Bacterium ATCC25923, staphylococcus aureus ATCC29213, staphylococcus aureus ATCC26111 are diluted to 10 respectively7cfu/
ML, 4 DEG C of coatings are overnight；After being washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 3% that 300 μ L are added is de-
Rouge milk powder, 37 DEG C are closed 1 hour；After being washed 3 times with PBST (10mM PBS, 0.05%Tween-20 (v/v)), 100 μ L are added
The conjugate of horseradish peroxidase and nano antibody, 37 DEG C are incubated for 1 hour；With PBST (10mM PBS, 0.05%Tween-20
(v/v)) after washing 3 times, 100 μ L tmb substrate solution are added, is protected from light colour developing 10min, 50 μ L2M H is added2SO4Terminate liquid terminates
After reaction, OD450 is measured.As a result see Fig. 2, B6 nano antibody and Staphylococcal enterotoxin B, staphylococcus aureus
ATCC25923, staphylococcus aureus ATCC29213, the equal no cross reaction of staphylococcus aureus ATCC26111, show to receive
Meter Kang Ti B6 and staphylococcus aureus show that albumin A without combination, shows preferable specificity.
Nucleotides sequence list electronic document
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>a kind of Staphylococcal enterotoxin B nano antibody B6, application and kit
<130> 2018
<160> 9
<170> PatentIn Version 3.5
<210> 1
<211> 123
<212> PRT
<213> Llama
<400> 1
Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu
1 5 10 15
Ser Cys Lys Ala Ser Gly Pro Asn Leu Arg Glu Tyr Ala Met Ala
20 25 30
Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ser Cys
35 40 45
Ile Arg Gly Ser Gly Asp Tyr Thr Thr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln Asn Thr Leu Tyr
65 70 75
Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Met Tyr Tyr
80 85 90
Cys Ala Ala Ala Arg Tyr Ala Arg Tyr Tyr Ala Asn Asn Cys Leu
95 100 105
Ala Ser Ala Glu Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Xaa
110 115 120 123
<210> 2
<211> 20
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(20)
<223> FR1
<400> 2
Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Lys Ala Ser
1 5 10 15 20
<210>3
<211>10
<212> PRT
<213>Llama
<220>
<221> Domain
<222> (1)..(10)
<223> CDR1
<400>3
Gly Pro Asn Leu Arg Glu Tyr Ala Met Ala
1 5 10
<210>4
<211> 16
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(16)
<223> FR2
<400>4
Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ser Cys Ile
1 5 10 15 16
<210>5
<211>10
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(10)
<223> CDR2
<400>5
Arg Gly Ser Gly Asp Tyr Thr Thr Tyr Ala
1 5 10
<210>6
<211>37
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(37)
<223>FR3
<400>6
Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln
1 5 10 15
Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr
20 25 30
Ala Met Tyr Tyr Cys Ala Ala
35 37
<210>7
<211>19
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(19)
<223>CDR3
<400>7
Asp Pro Ala Thr Tyr Tyr Ala Cys Ser Tyr Arg Leu Asn His Gly
1 5 10 15
Glu Tyr Gly Tyr
19
<210>8
<211>11
<212> PRT
<213> Llama
<220>
<221> Domain
<222> (1)..(11)
<223>FR4
<400>8
Trp Gly Gln Gly Thr Gln Val Thr Val Ser Xaa
1 5 10 11
<210>9
<211>364
<212>DNA
<213> Llama
<400>8
ggacggtgac ctgggtcccc tggccccagt agccatattc cgctgaagcc agacaattgt 60
tagcatagta ccgcgcgtac cgcgctgccg cacagtaata catggccgtg tcctcaggtc 120
tcaggctgtt catttgcaga tacagggtgt tctgagcgtt gtctctggag atggtgaatc 180
ggcccttcac ggagtctgca taggttgtgt aatcaccact cccgcgaata catgagaccc 240
cctcgcgctc ttttcctgga gcctggcgga accaggccat ggcatactca cgaagattgg 300
gtccagaggc tttacaggag agtctcagag acccccctgc ctgcaccaag cctcccccag 360
actc 364
Claims (7)
1. a kind of Staphylococcal enterotoxin B nano antibody B6, which is characterized in that include framework region FR and complementary decision
Area CDR, the framework region FR include the amino acid sequence of FR1~FR4,
Wherein the amino acid sequence of FR1 is as shown in SEQ ID NO.:2, the amino acid sequence of FR2 as shown in SEQ ID NO.:4,
The amino acid sequence of FR3 is as shown in SEQ ID NO.:6, and the amino acid sequence of FR4 is as shown in SEQ ID NO.:8；
The complementary determining region CDR includes the amino acid sequence of CDR1~CDR3,
Wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO.:3, the amino acid sequence of CDR2 such as SEQ ID NO.:5 institute
Show, the amino acid sequence of CDR3 is as shown in SEQ ID NO.:7.
2. a kind of Staphylococcal enterotoxin B nano antibody B6, which is characterized in that the amino acid of the nano antibody B6
Sequence is as shown in SEQ ID NO.:1.
3. Staphylococcal enterotoxin B nano antibody B6 as described in claim 1, which is characterized in that described in encoding
The nucleotide sequence of Staphylococcal enterotoxin B nano antibody B6 is as shown in SEQ ID NO.:9.
4. a kind of preparation method of Staphylococcal enterotoxin B nano antibody B6, which is characterized in that received what hunchbacked source was immunized
Screening can tie the nano antibody that specificity is closed with target molecule SEB in rice antibody library, and pass through Phage amplification or genetic engineering weight
It is prepared by the mode of group expression；
The Phage amplification is will to show the bacteriophage for having anti-SEB nano antibody, by way of biology amplification, breeding production
Show the bacteriophage particles for having SEB nano antibody；
The mode of the genetic engineering recombinant expression refers to the gene of nano antibody, by being cloned into expression vector, with albumen
The form of expression carries out the preparation of nano antibody.
5. Staphylococcal enterotoxin B nano antibody B6 is in golden yellow Portugal described in Claims 1 to 4 any claim
Application in grape coccus enterotoxin B immunology detection.
6. Staphylococcal enterotoxin B nano antibody B6 described in Claims 1 to 4 any claim is used to prepare gold
The application of staphylococcus aureus enterotoxin B immunity detection reagent.
7. a kind of Staphylococcal enterotoxin B immunity detection reagent, which is characterized in that the kit carries right
It is required that Staphylococcal enterotoxin B nano antibody B6 described in 1~4 any claim.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910763770.4A CN110526966B (en) | 2019-08-19 | 2019-08-19 | Staphylococcus aureus enterotoxin B nano antibody B6, application and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910763770.4A CN110526966B (en) | 2019-08-19 | 2019-08-19 | Staphylococcus aureus enterotoxin B nano antibody B6, application and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110526966A true CN110526966A (en) | 2019-12-03 |
| CN110526966B CN110526966B (en) | 2021-08-17 |
Family
ID=68662369
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910763770.4A Active CN110526966B (en) | 2019-08-19 | 2019-08-19 | Staphylococcus aureus enterotoxin B nano antibody B6, application and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110526966B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113185610A (en) * | 2021-05-21 | 2021-07-30 | 西北农林科技大学 | Staphylococcus aureus enterotoxin A nano antibody, application and kit |
| CN113416248A (en) * | 2021-06-22 | 2021-09-21 | 中国人民解放军军事科学院军事医学研究院 | Nano antibody and application thereof |
| CN113583119A (en) * | 2021-07-07 | 2021-11-02 | 西北农林科技大学 | Anti-staphylococcus aureus nanobody Nb56, application and kit |
| WO2022148480A1 (en) * | 2021-01-11 | 2022-07-14 | 星济生物(苏州)有限公司 | ANTIGEN-BINDING PROTEIN TARGETING STAPHYLOCOCCUS AUREUS α-HEMOLYSIS AND APPLICATION THEREOF |
| CN116854829A (en) * | 2023-07-25 | 2023-10-10 | 西北农林科技大学 | Antibody SEB27, fusion protein SEB27-vHRP, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1818066A (en) * | 2005-09-21 | 2006-08-16 | 吉林大学 | Food-poisoning fungus concatenated fusion mycinamicin and use thereof |
| CN102286100A (en) * | 2011-07-19 | 2011-12-21 | 中国人民解放军军事医学科学院微生物流行病研究所 | SEB (staphylococcal enterotoxin B) resisting immune globulin F(ab')2 and preparation method thereof |
-
2019
- 2019-08-19 CN CN201910763770.4A patent/CN110526966B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1818066A (en) * | 2005-09-21 | 2006-08-16 | 吉林大学 | Food-poisoning fungus concatenated fusion mycinamicin and use thereof |
| CN102286100A (en) * | 2011-07-19 | 2011-12-21 | 中国人民解放军军事医学科学院微生物流行病研究所 | SEB (staphylococcal enterotoxin B) resisting immune globulin F(ab')2 and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| TURNER KENDRICK B.等: "Isolation and Epitope Mapping of Staphylococcal Enterotoxin B Single-Domain Antibodies", 《SENSORS》 * |
| ZANGANEH SAEED等: "Rapid and Sensitive Detection of Staphylococcal Enterotoxin B by Recombinant Nanobody Using Phage Display Technology", 《APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY》 * |
| 郭鹏利等: "基于纳米抗体的酶联免疫吸附法检测食品中金黄色葡萄球菌肠毒素B", 《食品与发酵工业》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022148480A1 (en) * | 2021-01-11 | 2022-07-14 | 星济生物(苏州)有限公司 | ANTIGEN-BINDING PROTEIN TARGETING STAPHYLOCOCCUS AUREUS α-HEMOLYSIS AND APPLICATION THEREOF |
| CN113185610A (en) * | 2021-05-21 | 2021-07-30 | 西北农林科技大学 | Staphylococcus aureus enterotoxin A nano antibody, application and kit |
| CN113185610B (en) * | 2021-05-21 | 2023-05-12 | 西北农林科技大学 | Staphylococcus aureus enterotoxin A nano antibody, application and kit |
| CN113416248A (en) * | 2021-06-22 | 2021-09-21 | 中国人民解放军军事科学院军事医学研究院 | Nano antibody and application thereof |
| CN113583119A (en) * | 2021-07-07 | 2021-11-02 | 西北农林科技大学 | Anti-staphylococcus aureus nanobody Nb56, application and kit |
| CN116854829A (en) * | 2023-07-25 | 2023-10-10 | 西北农林科技大学 | Antibody SEB27, fusion protein SEB27-vHRP, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110526966B (en) | 2021-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110526967A (en) | A kind of staphylococcus aureus toxin A nano antibody A13, application and kit | |
| CN110526968A (en) | A kind of Staphylococcal enterotoxin B nano antibody B7, application and kit | |
| CN110526966A (en) | A kind of Staphylococcal enterotoxin B nano antibody B6, application and kit | |
| CN110563839A (en) | Staphylococcus aureus enterotoxin B nano antibody B1, application and kit | |
| Abbady et al. | Evaluation of a nanobody phage display library constructed from a Brucella-immunised camel | |
| CN110577594B (en) | Staphylococcus aureus enterotoxin A nano antibody A21, application and kit | |
| CN102766207B (en) | Bactrian camel heavy-chain (HC) variable-domain antibody resisting porcine circovirus 2 as well as preparation method and application thereof | |
| CN106290918A (en) | A kind of ELISA kit detecting antibodies toward salmonella | |
| CN104086652B (en) | Resisting O-type foot and mouth disease virus specificity single domain antibody and recombinant expression carrier thereof | |
| CN113527476B (en) | Novel nano antibody for resisting H5 subtype avian influenza virus and application thereof | |
| CN109336979A (en) | Nano antibody, coded sequence and its screening technique of a kind of clostridium difficile glutamte dehydrogenase and application | |
| CN114957454B (en) | anti-CSFV E2 protein nano antibody, fusion protein, preparation method and application thereof | |
| CN116023486B (en) | Staphylococcus aureus alpha-hemolysin nano antibody, preparation method and application thereof | |
| CN112707963A (en) | Nano antibody, recombinant vector, host cell for broad-spectrum recognition of salmonella and application thereof | |
| Yang et al. | Selection and identification of single-domain antibody fragment against capsid protein of porcine circovirus type 2 (PCV2) from C. bactrianus | |
| CN102276719A (en) | Avian influenza virus single domain antibody, pentameric antibody and preparation and application thereof | |
| CN105037545B (en) | AFP nano antibodies A80 based on AFP antigens | |
| CN115925913B (en) | Nanobody BC16 capable of specifically recognizing staphylococcus aureus enterotoxin B, C and application thereof | |
| CN113583119B (en) | Anti-staphylococcus aureus nanobody Nb56, application and kit | |
| CN113185610B (en) | Staphylococcus aureus enterotoxin A nano antibody, application and kit | |
| CN103467599B (en) | Bactrian camel source C-strain E2 VHH and application | |
| CN105504053A (en) | Specific HCA (heavy chain antibody) for PEDV (porcine epidemic diarrhea virus) M protein | |
| CN114853896B (en) | Nanometer antibody for resisting glycosyltransferase A subunit and application thereof | |
| CN114507288A (en) | Affinity-mature quinalphos-resistant nano antibody and application thereof | |
| CN104558168A (en) | Bt toxalbumin targeted Cry1B nano antibody as well as coding sequence and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |